1. The point of an argument can also be called its

Answers

Answer 1
The point of an argument is to persuade people to a particular action or new behavior.

Related Questions

nose que escribir XD

Answers

JAJAAJJA HOLAAAAAAAAAA

1. A customer goes to a bank and gets change for a $100 bill. The change is to be in $1, $5, and $10 bills.
There were four times as many $5 bills as $10 bills. If there are 25 bills in all, how many are $5 bills?
b. 4
d. 12
a. 3
c. 6

Answers

Answer:

12

Explanation:

12x$5=$60

3x$10=$30

10x$1=$10

Adding all these together brings you to $100 with 25 bill and there being 4 times more 5's the 10's.

Using the original story from Task A and your new figurative language from Task C, copy the story, inserting your own modifications in place of the originals. Underline or highlight the five modifications that you made.​

Answers

\(\huge\mathcal{\fcolorbox{aqua}{azure}{\red{Answer:-}}}\)

Once upon a time, in a quaint village nestled among rolling hills, there lived a young girl named Suki. Suki's heart danced with joy whenever she cast her fishing line into the glistening waters of the nearby river. The rhythmic lapping of the waves against the shore and the anticipation of a tug on her line filled her with an intoxicating thrill. Fishing was her solace, her sanctuary amidst the chaos of the world.

As time went by, Suki's love for fishing grew deeper, intertwining with another newfound passion - photography. She was captivated by the art of capturing moments frozen in time, the ability to immortalize the beauty of nature through the lens of a camera. With each click of the shutter, she felt a surge of exhilaration, as if she were reeling in not just fish but also the essence of the world around her.

Driven by her dual passions, Suki yearned to combine fishing and photography into a harmonious symphony of creativity. She longed to become a fishing photographer, to capture the essence of the serene rivers and lakes she frequented and the resolute determination of those who pursued the elusive catch. Through her lens, she aimed to reveal the hidden stories of nature and the unspoken bond between humans and the water.

Suki embarked on a quest to study the works of contemporary photographers who had mastered the art of capturing the spirit of fishing. She immersed herself in the captivating images of *Corey Arnold*, who painted vivid narratives of seafaring adventures and the relentless pursuit of bounty in the depths of the ocean. She marveled at the raw and intimate portraits of *Mike Brodie*, who captured the essence of the individuals who found solace in the rivers, their souls entwined with the ebb and flow of the water. Suki also studied the breathtaking work of *Kitra Cahana*, who revealed the spiritual and cultural dimensions of fishing in diverse communities around the world. And she found inspiration in the masterful storytelling of *Steve McCurry*, whose photographs wove tales of resilience and beauty amidst the backdrop of fishing communities.

Armed with her fishing gear and camera, Suki set out on her own journey to become a fishing photographer. With each click of the shutter, she sought to encapsulate the serenity of the waters, the unwavering determination of the anglers, and the profound connection between humans and nature. Her photographs spoke in a language beyond words, a visual symphony of colors, textures, and emotions that resonated with all who beheld them.

In the realm where fishing and photography intertwined, Suki found her true calling. She became a storyteller of the waters, weaving tales of patience, adventure, and the enduring beauty of the natural world. Through her lens, she captured the essence of a world both familiar and mysterious, inviting others to embark on their own journeys of discovery and connection.

And so, Suki's legacy as a fishing photographer was born, her images immortalized in galleries and publications, her name whispered in awe among those who shared her love for both fishing and the art of capturing moments. She had transformed her passions into a symphony of imagery, a testament to the magic that unfolds when we follow our hearts and merge our deepest loves into a singular expression of artistry and devotion.

The FAFSA4caster can be used:
OA. during your senior year of high school.
O B. anytime.
OC. during your freshman year of college.
OD. during your junior year of high school.

Answers

It can be used during your senior year of high school. The correct option is A.

What is FAFSA?

The Free Application for Federal Student Aid (FAFSA)4caster is a free financial aid tool from the federal government that enables you to practice filling it out.

It calculate how much financial aid you might be eligible for based on your assets and income as well as those of your family and students.

The FAFSA4caster has experience find out how much government funding is anticipated to be Free Application for Federal Student Aid, or FAFSA.

Thus, the correct option is A.

For more details regarding FAFSA, visit:

https://brainly.com/question/27799328

#SPJ9

13. Pressing Ctrl+O will
A. close an open file.
B. open a file when Word is already running.
C. exit out of the Word application.
D. save an open file.

Answers

Pressing Ctrl+O will open a file when Word is already running. So, option B is the right choice.

Launch Microsoft Word on your Ms Word.If Word is not already running, double-click on its icon or search for it in the Start menu to open it.Once Word is running, press and hold the Ctrl key on your keyboard.While holding the Ctrl key, press the letter "O". The Ctrl+O shortcut stands for "Open."The "Open File" dialog box will appear, allowing you to browse your computer's files and folders.Navigate to the location where the file you want to open is stored.Select the file by clicking on it once.Click on the "Open" button in the dialog box.The selected file will now be opened in Microsoft Word.

Remember, this shortcut is specific to Microsoft Word and may have different functionalities in other applications.

The right answer is option B. open a file when Word is already running.

For more such question on Word

https://brainly.com/question/24749457

#SPJ8

The answer is B

Pressing Ctrl +O will open a file when word is already running. The selected file will now be opened in Microsoft word .

Pedestrians, cyclists, skateboarders, and highway construction workers are known as _

Answers

Answer:

Pedestrians, cyclists, skateboarders, and highway construction workers are known as pedestrians.

It is a busy saturday and you realize that a customer who just left the store did so
without getting change back.

Answers

Answer:

Wow what a busy Saturday AND SPMEONE LEFT THE STORE!! I will help you do

A 6-sided die is biased in such a way that the probability of a "six" appearing on top is 20% and all other possibilities have an equa chance of appearing on top. If the die is thrown 5 times, what is the probability that a "six" will appear at most 3 times?​

Answers

Using binomial probability to calculate this, the probability is 0.007

What is the probability that a "six" will appear at most 3 times?​

To calculate the probability that a "six" will appear at most 3 times when a biased 6-sided die is thrown 5 times, we can use the concept of binomial probability.

Let's break down the possibilities:

0 "six" appearing: Probability = (0.8)⁵

1 "six" appearing: Probability = 5C1 * (0.2)¹ * (0.8)⁴

2 "six" appearing: Probability = 5C2 * (0.2)² * (0.8)³

3 "six" appearing: Probability = 5C3 * (0.2)³ * (0.8)²

The notation "nCr" represents the number of combinations of n items taken r at a time.

To calculate the total probability of at most 3 "six" appearing, we sum up the probabilities for each case:

P(at most 3 "six") = (0.8)⁵ + 5C1 * (0.2)¹ * (0.8)⁴ + 5C2 * (0.2)² * (0.8)³ + 5C3 * (0.2)³ * (0.8)²

Calculating this expression will give us the desired probability.

Probability = 0.007

Learn more on binomial probability here;

https://brainly.com/question/15246027

#SPJ1

A
is a document that describes an individual's accomplishments,
abilities, and educational experience.
O A. résumé
OB. contact sheet
O C. letter of reference
OD. letter of recommendation

Answers

Answer:



Explanation:

What is likely to happen to the economy when there's too little money or credit
circulating?
A) Banks will give out more loans.
B) The unemployment rate will go up.
C) Prices will go up.
D) Businesses will be able to hire more employees.

Answers

I am almost positive the answer is B if this helped please give the brainliest

A number of reasons can contribute to deflation, such as a lack of money in circulation, which raises the value of that money and lowers prices, and an excess of supply relative to demand, which forces businesses to lower their prices to attract customers. Thus, option B is correct.

What is the role of credit circulating in the economy?

Inflation occurs as a result of price increases that happen too quickly. People do not have surplus disposable income, and there is no economic growth if there is too little money in the economy.

Borrowing costs are frequently the result of more money being available, which encourages higher investment and more money in the hands of consumers, both of which promote consumption.

Businesses react by placing additional orders for raw materials and raising production levels.

Therefore, unemployment rate will go up, to the economy when there's too little money or credit circulating.

Learn more about economy here:

https://brainly.com/question/13121877

#SPJ2

Controlling populations of harmful invasive species is a challenge. Using any pest control method could potentially harm the ecosystem. If you had to decide whether to use the frog control method proposed by the scientists in the video, what five questions would you ask the scientists before making your decision?

Answers

Answer:

i am unsure

Explanation:

you didn't show the video there is no background information

Answer:

Numerous studies have shown that caffeine is toxic to a variety of wildlife at high concentrations. The effects are less clear in cases of continual exposure at low levels  like those documented in nature by Granek and Nagoda  because little research has been done in this area. Studies involving the use of caffeine on plants have shown that, initially, cell growth rates are stable but soon the caffeine begins to kill or distort these cells, resulting in a dead or stunted plant.

Explanation:

that's what I put down for plato

Which format for informational resources do you prefer? Defend your answer.

Answers

Here are a few answers:

Almanac - an almanac is a book of statistical data, graphs and charts.

Atlas - a book, collection, or maps.

Encyclopedia - a comprehensive reference book containing articles on a wide range of subjects or on numerous aspects of a particular field, usually arranged alphabetically.

The growth in which system has resulted mostly from deliberate policies that have
increased the severity of sentences?
O a. trial
O b. labor
O c. pretrial
O d. corrections

Answers

Answer:

trail

Explanation:

Describe the difference between elaboration and visual imagery.

Answers

Answer:

Multitasking is an example of what can happen when an individual attempts to divide one’s attention among more than one task.

Explanation:

edge 2020

The differences is that Elaboration absorb new idea and strike a link to another idea. Visual imagery is forms a mental picture so as to know a new word.

What is visual imagery?

Visual imagery is known to be a form of imagery that often takes place in our head. It often occurs after reading.

Conclusively the act of Visualization is an very way of comprehension, because people need to be able to form or make the picture in their head of what they want the story to look or be like.

Learn more about visual imagery from

https://brainly.com/question/4151383

The Cornell System for notetaking
a was developed by Dr. Walter Pauk at Cornell University.
b involves dividing your paper into three sections: Notes in the right-hand ccolumn; labels or possible questions for recall on the left-hand column; and a summary at the bottom.
c is easily done on a computer.
d provides a handy way to review and test yourself using your notes.
e All of the above.

Answers

The Cornell System for notetaking was developed by Dr. Walter Pauk at Cornell University.

What is Cornell method in note taking?It involves dividing your paper into three sections: Notes in the right-hand column; labels or possible questions for recall on the left-hand column; and a summary at the bottom

The Cornell Note Taking method is known to be a type of short cut that hinders the use of long sentences.

Conclusively, Here, one have to use short notes that are often write down by a person using the right-hand column by applying the use of recognizable abbreviations and symbols.

Learn more about notetaking from

https://brainly.com/question/17184401

The Cornell System for notetaking a was developed by Dr. Walter Pauk at Cornell University. b involves

nêu cảm nhận của em về thái độ người kể chuyện cô bé bắn diêm

Answers

Answer:

Người kể chuyện thể hiện một tình yêu thương, xót xa nhưng vẫn rất trân trọng đối với số phận quá đỗi bất hạnh của cô bé bán diêm. ... + Hình ảnh cái chết của cô bé bán diêm tưởng là an nhiên, giải thoát nhưng lại quá xót xa, lạnh lẽo.

45,43,45,44,44,44,47

Using this data, create a dot plot where each dot represents a season.

Answers

this data, create a dot plot where each dot represents a season.

The data represent the​ time, in​ minutes, spent reading a political blog in a day. Construct a frequency distribution using 5 classes . In the​ table, include the​ midpoints, relative​ frequencies, and cumulative frequencies. Which class has the greatest frequency and which has the least​ frequency?
13 18 11 18 7
19 6 10 12 7
14 17 18 6 16
18 10 1 0 15
complete the table starting with lowest class limit
class frequency midpoint r.frequency c. frequency

Answers

The class with the greatest frequency is the class "15.2 - 19" with a frequency of 7. The class with the least frequency is the class "0 - 3.8" with a frequency of 2.

To construct a frequency distribution with 5 classes for the given data representing time spent reading a political blog in a day, we need to determine the class intervals and calculate the frequency, midpoint, relative frequency, and cumulative frequency.

First, we find the range of the data:

Range = Maximum value - Minimum value

Range = 19 - 0

Range = 19

To determine the class width, we divide the range by the desired number of classes:

Class width = Range / Number of classes

Class width = 19 / 5

Class width ≈ 3.8

Now, we can construct the frequency distribution table:

Class          Frequency   Midpoint   R. Frequency   C. Frequency

0 - 3.8           2              1.9                2/20 = 0.1           2

3.8 - 7.6        4              5.7                4/20 = 0.2           6

7.6 - 11.4      4              9.5                4/20 = 0.2           10

11.4 - 15.2    3              13.3              3/20 = 0.15         13

15.2 - 19       7              17.1              7/20 = 0.35         20

By organizing the data into classes and analyzing the frequencies, we can gain insights into the distribution of reading time and identify the most and least common time intervals spent on reading the political blog.

For more questions on Midpoint   , click on:

https://brainly.com/question/896396

#SPJ8

What is the volume of a sphere with radius 4 cm?(Round to nearest cubic centimeter) Use pi = 3.14 and V = 4/3 pi r^3

Answers

Answer:

268 cm^3

Explanation:

Plug in the radius and calculate.

Given: f (x ) = x2 - 5. g (x) = x2 + 5. What is f (x) x g (x)

Given: f (x ) = x2 - 5. g (x) = x2 + 5. What is f (x) x g (x)

Answers

Answer:

x^4 − 25

Explanation:

x^2 * x^2 = x^4 and -5 * +5 = -25

helppppppppppppm plssssssssssss

helppppppppppppm plssssssssssss

Answers

Answer  i have the same quiz i have 82% on it

Answer is c because but in carved seal

According to a recent marketing campaign, 130 drinkers of either Diet Coke or Diet Pepsi participated in a blind taste test to see which of the drinks was their favorite. In one Pepsi television commercial, an anouncer states that "in recent blind taste tests, more than one half of the surveyed preferred Diet Pepsi over Diet Coke." Suppose that out of those 130 , 48 preferred Diet Pepsi. Test the hypothesis, using α=0.05 that more than half of all participants will select Diet Pepsi in a blind taste test by giving the following:

Answers

a)The test statistic is 0.35

b) The P-value is 0.3632

c) There is not sufficient evidence to reject the null hypothesis that p = 0.5

How to explain the information

Given data

Sample size, n =130

Population proportion, p= 0.5

Significance level, = 0.05

Number of success , x= 67

Sample proportion, = 67/130

= 0 5154

The test statistic will be:

= 0.5154 - 0.5 / ✓0.5(1 - 0.5) / 130

= 0.35

Learn more about statistic on

https://brainly.com/question/15525560

#SPJ1

SALLY AMES
Weekly Budget; Weekly Salary - $425.00
ITEM
$
%
$42.50
$127.50
Donations.
Room and board ....
Clothing ...
Recreation, etc
....
Savings, Insurance
Lunches
$15.00
....$8.00
. . . $21.00
$28.00
What is Sally's smallest single expense? recreation, etc
What percent is this expense of her income (to the nearest tenth)?
id

Answers

Sally's smallest single expense is recreation which is $8.00.

The percent of this that is the expense of her income is 1.88%

How to calculate the percentage?

A percentage is a value or ratio that may be stated as a fraction of 100. If we need to calculate a percentage of a number, we should divide it's entirety and then multiply it by 100. The percentage therefore refers to a component per hundred. Per 100 is what the word percent means. It is represented by %.

From the information, the following can be deduced:

Weekly salary = $425

Donation = $42.50

Clothing = $15.00

Recreation = $8.00

In this case, recreation is the smallest. The percentage will be:

= Recreation / Total salary × 100

= 8 / 425 × 100

= 1.88%

Learn more about percentages on:

brainly.com/question/24304697

#SPJ1

A library charges a cents for the first 5 days that a
book is borrowed and b cents for each day over
the 5 days.
What is the total cost for borrowing a book for c
days where c is greater than 10?
A. a + bc
B. a + b(c - 5)
C. a + b(c-10)
D. b + a(c-10)

Answers

Answer:

OPTION B

Explanation:

The total cost for borrowing a book for c days, where c is greater than 10, can be calculated as follows:

For the first 5 days, the cost is a cents per day. So the cost for the first 5 days is 5a cents.

For the remaining days (c - 5), the cost is b cents per day. So the cost for the remaining days is b(c - 5) cents.

Therefore, the total cost for borrowing a book for c days is the sum of the cost for the first 5 days and the cost for the remaining days:

Total cost = 5a + b(c - 5) = 5a + bc - 5b

Option B, a + b(c - 5), is the correct answer.

The total cost for borrowing a book for c days is a + b(c - 5).The correct answer is option B.

To calculate the total cost for borrowing a book for c days, where c is greater than 10, we need to consider two scenarios: the first 5 days and the remaining days after that.

For the first 5 days, the library charges a cents per day. So, the cost for the first 5 days is 5a.

For the remaining days (c - 5), the library charges b cents per day. So, the cost for the remaining days is (c - 5) * b.

To find the total cost, we sum up the costs for the first 5 days and the remaining days:

Total cost = 5a + (c - 5) * b.

Simplifying this expression, we get:

Total cost = 5a + bc - 5b.

Rearranging the terms, we can write it as:

Total cost = a + bc - 5b.

Therefore, the correct option is B. a + b(c - 5).

For more such questions on book,click on

https://brainly.com/question/24372153

#SPJ8

Raj can exchange 15 Euros for 11 British Pounds. At
this exchange rate, approximately how many British
Pounds should he receive in exchange for 100 Euros?
A) 21
B) 73
C) 137
D) 340

Answers

B)73 as it is the same rate as from 15 euros to 11 pounds - hope this helps :)

Someone help me please

Someone help me please

Answers

y=x+4 and f1(x)=17 if not then ask instructor

How does lack of community participation contribute to poor service delivery

Answers

Answer:

In summary, lack of community participation can contribute to poor service delivery by limiting feedback, inadequate needs assessment, limited accountability, and limited resources. Therefore, it is important to involve communities in the planning, implementation, and monitoring of public services to improve service delivery.

Explanation:

Lack of Feedback: If the community is not involved in the planning, implementation, and monitoring of public services, it becomes difficult for authorities to obtain feedback on the effectiveness of the services provided. Without feedback, it is difficult to identify areas that need improvement, and this can result in poor service delivery.

Inadequate Needs Assessment: When community members are not involved in the needs assessment process, it becomes difficult to identify the specific needs of the community. This can result in services that are not tailored to the specific needs of the community, leading to poor service delivery.

Limited Accountability: Community participation provides an avenue for holding service providers accountable for their actions. When community members are not involved in monitoring the delivery of services, it becomes difficult to hold service providers accountable for their actions. This can result in poor service delivery, as service providers may not be held accountable for their shortcomings.

Limited Resources: Community participation can also lead to the identification of additional resources that can be used to support the delivery of public services. When community members are not involved, it becomes difficult to identify additional resources that can be used to support service delivery. This can result in poor service delivery due to limited resources.

is time spent on phone dependent of battery life remaining or vice versa?
Produce a scatterplot of the provided dataset. Make sure to include a title and to assign labels to your axis. Edit the graph (i.e., set the background to transparent; borders to transparent; add greyed out grid lines) and add a regression line. Comment on the noted relationship (e.g., is it positive; is it negative?). What else can be said about the relationship concerning time spent on phone and battery life? If we were to break up the scatterplot into 4 quadrants; what would data points in the top left, bottom left, top right and bottom right say about the relationship concerning time spent on phone and battery life? For this example, in which quadrant(s) do the data points lie.)

Answers

The scatterplot will show that there is a negative relationship between time spent on the phone and battery life remaining.

How to explain the scatterplot

The scatterplot shows a clear negative relationship between time spent on the phone and battery life remaining. As time spent on the phone increases, battery life remaining decreases. The regression line also shows a negative slope, which confirms this relationship.

In bottom right, data points in this quadrant represent times when the battery life was low and the time spent on the phone was high. This is the most likely quadrant for data points to fall in, as it represents times when the phone was being used heavily.

In this example, all of the data points fall in the bottom right quadrant, which confirms that there is a negative relationship between time spent on the phone and battery life remaining.

Learn more about scatterplot on

https://brainly.com/question/6592115

#SPJ1

Recall that Benford's Law claims that numbers chosen from very large data files tend to have "1" as the first nonzero digit disproportionately often. In fact, research has shown that if you randomly draw a number from a very large data file, the probability of getting a number with "1" as the leading digit is about 0.301. Now suppose you are an auditor for a very large corporation. The revenue report involves millions of numbers in a large computer file. Let us say you took a random sample of n = 225 numerical entries from the file and r = 51 of the entries had a first nonzero digit of 1. Let p represent the population proportion of all numbers in the corporate file that have a first nonzero digit of 1.

Use the value of the sample test statistic to find the corresponding z value. (Round your answer to two decimal places.)


Find the P-value of the test statistic. (Round your answer to four decimal places.)
P-value =

Answers

Answer:

We can use the formula for the test statistic for a hypothesis test of a single proportion:

z = (p-hat - p) / sqrt(pq/n)

where p-hat is the sample proportion, p is the hypothesized population proportion (0.301 according to Benford's Law), q = 1 - p, and n is the sample size.

Plugging in the values given, we get:

z = (0.2278 - 0.301) / sqrt(0.301*0.699/225) = -2.83

To find the P-value, we need to find the probability that a standard normal distribution is less than -2.83 (since this is a left-tailed test). Using a standard normal table or calculator, we find this probability to be 0.0023.

Therefore, the P-value is 0.0023.

Explanation:

Fix any words that are used incorrectly. If there are no errors, submit the text without
making any changes.
If Tim isn't averse to traveling for a bit longer, he could save money by taking
the train between Seattle and Portland instead of flying.

Answers

There arnt❌ any error’s.
Other Questions
Write the standard equation for the circle center (9, 6), r = 9 2x3-x2-2x+1 divided by 2x-1 Create one sentence summarizing what you have read. You must keep your sentence to 20words or less. You may take more than one try to get to twenty DNA sequence: 5 CTGTTACTGCAGCTAACGTGGATCCGGTCAATCTTCA 33 restriction enzymes: (| = cleavage site)Hindlil5-A|AGCTT-33-TTCGA|A-5BamHI5-G|GATCC-33-CCTAG|G-5Pstl5-CTGCA|G-3G33-G|ACGTC-5Q: If the DNA sequence is mixed with all 3 restriction enzymes, what is the digestion product sequence for both DNA strands?Show transcribed data5' CTGTTACTGCAGCTAACGTGGATCCGGTCAATCTTCA 3' Hindlil 5-A|AGCTT-3' 3'-TTCGA|A-5 BamHI 5-G|GATCC-3' 3-CCTAG|G-5 Pstl 5'-CTGCA|G-3 G3 3-G|ACGTC-5 What are the 9 regions in the US? Assume a monopolist faces a market demand curve P=80-Q and has the short-runtotal cost function TC=730+10Q.A. What is the profit-maximizing level of output and the market price? B. Calculate the mark-up of the monopolist using the Lerner Index. Interpret yourresult. C. Using the result from part B, what is the elasticity of demand at the monopolistprice? Interpret your result. D. Will the monopolist produce or shutdown? Explain why and show using theshutdown rule.E. Calculate the profit or loss incurred by the monopolist. F. What would happen in the long run if the government regulated this market andset the price at $15 and why? Show work to support your answer. Decide whether each of the following pairs of structures more likely represents analogy or homology, and explain your reasoning: (a) a porcupine's quills and a cactus's spines; (b) a cat's paw and a human's hand; (c) an owl's wing and a hornet's wing which of these is not an advantage of frontloading? reduces frustration saves the readers time eliminates the need for researching sets a proper frame of mind On a black Friday, Jumia sold a pair of jeans trousers marked N7 000 at a discount of 10%. Find the Discount What is one EXTERNAL CONFLICT in Ray Bradbury's "The Fox and The Forest"? What are the four bases of DNA you must choose four of the following? The axis on which Earth now rotates is tilted at an angle. If the axis was to be changed so that it was perfectly upright, which change would be expected on Earth? Current angle of tilt Change to upright for Earth's axis axis for Earth For every season, the length of the day would be shorter. There would no longer be periods of light and darkness. There would not be the same pattern of seasonal changes in weather It would always be winter in the Southern Hemisphere. 1. Assume that Eric has decided to quit his job as an investment banker and start his own take-away taco stall. Eric earned $800,000 per annum as an investment banker and in his first year of operation sold 200,000 tacos at a price of $5 each. Eric also invested $1,000,000 of his savings in purchasing a taco cart. Previously the money had earned interest of 10%per annum in the bank. Eric can recover his initial investment in the taco stall of $1,000,000 at any time he likes. Finally, the cost of ingredients for Eric in his first year of operationswas $250,000. In his first year of operations:a. Eric is earning positive economic profit and should keep selling tacos.b. Eric is earning normal economic profit but should keep selling tacos.c. Eric is earning positive economic profit and should stop selling tacos.d. Eric is earning normal economic profit but should stop selling tacos.e. Eric is earning negative economic profit and should return to investment banking Which of the following is true aboutyour "gross" pay?A. It is the money you make before taxes.B. It is the money you take home after taxes are takenout..C. It is the amount of money you pay in social securitytax.D. It is the amount of money you pay in federal tax. The lifeline of Egypt is the _____ River. What is the equation for the translation of x2 + y2 = 16 seven units to the right and five units up?(x + 7)2 + (y + 5)2 = 16(x 7)2 + (y 5)2 = 16(x + 7)2 + (y 5)2 = 16(x 7)2 + (y + 5)2 = 16 12. How will the temperature change in a room with an open refrigerator door, once equilibrium is established 3through: (3, 4), perp. to y = -x-5xWrite the slope-intercept form of theequation of the line described. *(4 Points)82A) y = -x + 4B) y=-+4C) y=xx +45D) y = --X+4OAOD For a monatomic ideal gas, pressure is proportional to Group of answer choices the average atomic velocity. the atomic mean free path. the ideal gas constant R. the average of the squared atomic velocity. CAN SOMONE HELP ME PLEASE !!