100 POINTS
Part B
Utilize your graphic organizer from Part A to create your presentation. Check with your teacher about how to present it. Then, use the space below to reflect on the experience of creating the presentation, including how you conducted your research and how you presented it.


Connect and Reflect
Reflect on the process of researching and analyzing immigration policy and trends and creating a presentation. How did this process increase your understanding of immigration policy and current immigration issues? What do you think the future holds for immigration trends?

100 POINTSPart BUtilize Your Graphic Organizer From Part A To Create Your Presentation. Check With Your

Answers

Answer 1

Some of the factors that affect immigration trends are:

Death rateWarsBetter lifeEconomic opportunities

Also, it is important to note that to prepare for your presentation, you need to:

Include immigration laws that help the trendsList the major events that make people migrate to a certain place in their drovesMake use of statistics and diagrams to show these trends,

What is a Presentation?

This refers to the formal talk that makes use of diagrams, images, and videos to show data and try to convince a group of people.

What are Immigration Trends?

This refers to the number of people that are moving from one place to another in a specific time period and this can either be high or low.

Hence, we can see that immigration trends have to do with the mass move of people from one country or place to another as a result of demographic and economic factors mostly.

Read more about immigration trends here:

https://brainly.com/question/11385433

#SPJ1

Answer 2

Answer:

these where my answers

Explanation:

100 POINTSPart BUtilize Your Graphic Organizer From Part A To Create Your Presentation. Check With Your
100 POINTSPart BUtilize Your Graphic Organizer From Part A To Create Your Presentation. Check With Your

Related Questions

During the
Kingdom, Queen Hatshepsut was a powerful female pharaoh who encouraged trade.

Answers

if it’s true or false, true

22. (4-4) What killed 13 of the population of
Athens during the Peloponnesian War?

Answers

Answer:

The plague of Athens

Explanation:

In 430 BC, a plague struck the city of Athens, which was then under siege by Sparta during the Peloponnesian war.

Which group was originally nomadic

Answers

Answer:

Bedouin

Explanation:

they are Arabian. there are more people but that's like the top one

Which term best describes Russia's transition to a market economy?
O compromised
O successful
O difficult
Ocorrupt

Answers

Answer: Difficult

Explanation: After the year 1990, Russia made possibilities to shift its economy from a centrally planned one to a market based one. But, it came across major difficulties in making the transition feasible.

The correct answer is = difficult

Why did Congress pass numerous pieces of legislation during the first Hundred Days of Franklin Roosevelt’s administration?

A.) so that Congress would get credit for resolving the problems of the Depression
B.) because they knew the legislation could quickly resolve the problems of the Depression
C.) to assure Roosevelt’s reelection
D.) to assure people that the government was acting quickly to try to solve the problems of the Depression

Answers

It is D because I’m smart and you should trust me!!

ow did jefferson's support of the french revolution reflect his philosophy of government? a. he thought people should be able to wage war for their rights. b. he thought a strong national government is crucial to a nation's success. c. he believed a monarchy could successfully protect its citizens from harm. d. he believed in republican, representative government.

Answers

The correct answer (d) he believed in republican, representative government.

Jefferson probably thought that the French Revolution was the best time for France at the time it began. He thought that the American Revolution, which had come to a conclusion only a few years earlier, served as direct inspiration for the French Revolution. Jefferson most certainly anticipated a similar outcome.

He wished for France to develop into an American-style liberal democracy. This wasn't some crazy dream. After all, the Marquis de Lafayette's "Declaration of the Rights of Man and of the Citizen" was influenced by his "Declaration of Independence." This declaration of universal human rights from 1789 served as the philosophical cornerstone of the French Revolution. It was intended for this list of human rights to apply to nations other than only France and France alone. In fact, Jefferson believed that the revolutionary spirit that had begun in France would spread to other parts of the world.

Learn more about  French Revolution to visit this link

https://brainly.com/question/27833385

#SPJ4

Can anyone help in history?

Can anyone help in history?

Answers

Answer:

b

Explanation:

Help please
List at least three ways the English Bill of Rights and the Act of Settlement resolved political and religious problems in England in the 1600s.

Answers

After the fall of King James II; William III and Mary II jointly ruled England and enacted the English Bill of Rights into law in 1689.

The following were the salient features of the list:

By establishing and maintaining a standing army inside the kingdom during times of peace with the approval of Parliament, and quartering troops in violation of the law. By assuming and using a power to waive, suspend, and carry out laws with the approval of parliament.By forcing some Protestant decent subjects to be disarmed at the same time that Papists were both armed and in the workforce in violation of the law.

To know more about the English Bill of Rights here:

https://brainly.com/question/19965454

#SPJ1

What was the second major step in the creation of the United Nations?

Answers

The second major step in the creation of the United Nations was the drafting of the UN Charter.

The Charter was written during the San Francisco Conference, which took place from April to June 1945. It was created by representatives from 50 countries and aimed to establish a global organization dedicated to promoting peace, security, and cooperation. The Charter outlined the structure of the UN, its membership, and the responsibilities of its various organs, including the General Assembly, Security Council, and the International Court of Justice. The Charter was signed on June 26, 1945, and the United Nations officially came into existence on October 24, 1945.

Learn more about Conference here:

https://brainly.com/question/15140185

#SPJ11

How do developed countries maintain an advantage over developing
countries in international trade?
A. They reduce their levels of foreign aid as developing countries
lower their trade barriers.
B. They maintain high tariffs on the agricultural goods that many
developing countries export.
O C. They use trade embargoes to prevent developing countries from
exporting manufactured goods.
D. They invest large amounts of money in high-technology productive
processes

Answers

Answer: They maintain high tariffs on the agricultural goods that many developing countries export.Explanation:Workers are going to developed countries in search of better-paying jobs.

Hope this helped :-)

Based only on the passage, what was the Lincoln's primary purpose for the Emancipation Proclamation?

A. to save the Union
B. to defeat the Confederacy
C. to keep European powers out of the war
D. to destroy slavery

Based only on the passage, what was the Lincoln's primary purpose for the Emancipation Proclamation?A.

Answers

Answer:

To save the Union

Explanation:

He states that he would save the Union by not freeing slaves, freeing all the slaves, or freeing only some slaves.

To save the Union was Lincoln's primary purpose for the Emancipation Proclamation. The correct option is A.

What was Abraham Lincoln's primary goal?

As president, Lincoln's main objective was to keep the nation united. It didn't seem likely that he would succeed for a while. The South was winning the war in its early stages. The Union won the war only after the Battle of Gettysburg, which took place in Pennsylvania in July 1863.

Lincoln, however, went to war in order to preserve the Union, whether or not slavery existed. The equation was altered by the Emancipation Proclamation. On April 12, 1861, the Civil War officially began. Lincoln avoided making any public statements linking the war and the rights of slaves even though he morally opposed slavery.

Thus, the ideal selection is option A.

Learn more about Abraham Lincoln here:

https://brainly.com/question/2380000

#SPJ2

Which statement best reflects a responsibility rather than a duty of citizenship?

A. Citizens should volunteer in their communities.
B. Citizens must always pay taxes,
C. Citizens are free to vote for whomever they want.
D. Citizens can be forced to serve in the military.

if you are right I will give you brainliest!​

Answers

Answer:

c pay taxes

Explanation:

Answer:Must obey the law

Explanation:

I got it wrong because of the person above me

Before the Japanese learned the slaking process the clay was in what condition?
O Smooth, plastic and cold
O Smooth, slick, and creamy
O Sandy, Smooth and cracky
O Sandy, Course and not Plastic

Answers

Sandy, smooth, and cracky

identify the aims and accomplishments of the new jersey plan within the continental congress.

Answers

The aim of New Jersey Plan within the Continental Congress was the revision of the Articles of Confederation. Its major accomplishments were protection of smaller states interests, the Great Compromise, and maintenance of state sovereignty.

The New Jersey Plan was a proposal presented at the Continental Congress in 1787. Its main aim was to revise the Articles of Confederation, which were the governing documents of the newly formed United States of America. The plan was presented by William Paterson, a delegate from New Jersey.

The New Jersey Plan aimed to preserve the sovereignty of the individual states while creating a stronger central government that could regulate commerce, tax, and raise an army. Its main accomplishments were:

1. Protecting the interests of smaller states: The plan proposed a unicameral legislature with equal representation for each state, regardless of its population size. This was an alternative to the Virginia Plan, which suggested representation based on population.

2. Influencing the Great Compromise: Although the New Jersey Plan was not fully adopted, it played a crucial role in shaping the Great Compromise. The compromise combined elements from both the Virginia and New Jersey Plans, creating a bicameral Congress with the House of Representatives (based on population) and the Senate (equal representation).

3. Maintaining sovereignty of states: The New Jersey Plan emphasized the importance of preserving state sovereignty and preventing an overly powerful central government. This concern was partially addressed in the final US Constitution through the separation of powers and a system of checks and balances.

Overall, the New Jersey Plan was a significant contribution to the formation of the United States Constitution. It provided a valuable counterpoint to the Virginia Plan, which called for a bicameral legislature and representation based on population. The New Jersey Plan helped to shape the final document, which balanced the interests of both small and large states.

Learn more about New Jersey Plan:

https://brainly.com/question/5956921

#SPJ11

highest denomination coin ever circulated in the world ​

Answers

Answer:

THE COIN. The Spirit of Haida Gwaii pure gold coin is the world's first 10-kg gold coin of 99.999% purity. Its $100,000 face value makes it the world's highest denomination 10-kg gold coin and highest denomination non-circulation coin.

Explanation:

Hope it helps! Correct me if I am wrong :>

A 3 column table with 4 rows. Column 1 is labeled Country with entries 1. Norway, 2.Australia, 3. United States, 4. Netherlands. Column 2 is labeled Life expectancy (years) with entries 81.3. 82.0, 78.7, 80.8. Column 3 is labeled Average education (years) withenries 12.6, 12.0, 13.6, 11.6.
Citizens in
have a life expectancy of 82 years.

Citizens in
receive 11.6 years of education on average.

This chart suggests that countries with a long life expectancy and a high level of education have a
HDI ranking.

Answers

Answer:

Citizens in Australia have a life expectancy of 82 years.

This chart shows that people in Australia have an average life expectancy of 82 years and this is most probably due to the economic, social and political stability of the country.

Citizens in Netherlands receive 11.6 years of education on average.

In the Netherlands, the average amount of education received is 11.6 years which means that it includes the years of basic education.

This chart suggests that countries with a long life expectancy and a high level of education have a high HDI ranking.

Countries with a high Human Development Index ranking usually have high averages when it comes to education and life expectancy because these are the results of human development.

Answer:

d

Explanation:

A higher education has a higher life expectancy

the united states acquisition of the Philippines, Puerto Rico, and Hawaii are all examples of late-nineteenth century
A. imperialism
B. isolation
C. populism
D. progressivism

Answers

Answer:

A

Explanation:

The answer is imperialism

what operation did general douglas macarthur demonstrate his genius for mobility and by passing enemy strongholds in the south west pacific?

Answers

The operation that General Douglas MacArthur demonstrated his genius for mobility and bypassing enemy strongholds in the southwest Pacific was the island-hopping campaign during World War II.

General Douglas MacArthur employed the strategy of island-hopping in the southwest Pacific as a means of advancing toward the Japanese mainland while bypassing heavily fortified enemy positions. This strategy involved selectively capturing key islands that provided strategic advantages and skipping over others that were heavily defended. By doing so, MacArthur effectively cut off Japanese supply lines and isolated their forces on isolated islands, making it easier to neutralize them.

The island-hopping campaign allowed MacArthur to quickly advance and gain control over crucial islands such as Guadalcanal, New Guinea, and the Philippines. This strategy showcased his understanding of the importance of mobility and the ability to bypass strong enemy positions, rather than engaging in direct assaults that would have resulted in heavy casualties. By employing this approach, MacArthur was able to steadily push the Japanese forces back and eventually liberate territories from their control. The success of the island-hopping campaign demonstrated MacArthur's strategic acumen and his ability to adapt to the challenges of the Pacific theater of war.

To learn more about  MacArthur Click Here: brainly.com/question/17300951

#SPJ11

The Life of a Cowboy what is it about

Answers

Answer:Cowboys and cattle ranchers were the first group of European settlers to move permanently onto the Great Plains. To a degree they adopted or copied many of the ways of the Native Americans.

Explanation:

What region was causing confusion among the U.S?

Answers

West-central Utah's Confusion Range has been described as a wide structural trough or synclinorium with minimal overall shortening.

What is Confusion Range  in US?

West-central Utah in the United States is home to the Confusion Range, a mountain range with a north-south orientation. Its borders are the Great Salt Lake Desert to the north, Tule Valley to the east, Snake Valley to the west, and the Ferguson Desert to the south. To the south, the range trends into the Wah Wah Mountains, Mountain Home Range, and Burbank Hills. The Conger Range is a branch of the mountains to the west that lies in the range's centre. The name "rugged seclusion and ambiguous topography" gave rise to the Confusion Range.

According to recent structural investigations, the Confusion Range is actually best described as an east-vergent fold-thrust system that experienced around 10 km of horizontal shortening during the Late Jurassic to Eocene Cordillera.

To know more Related to Confusion Range in US,Refer to:

https://brainly.com/question/10793942

#SPJ1

which of the following statements about late-nineteenth- and early-twentieth-century immigrants is not true? group of answer choices most were young, between 15 and 40. most were skilled urban workers. most came from southern and eastern europe. most settled in cities.

Answers

The statement that is not true about late-nineteenth- and early-twentieth-century immigrants is: most were skilled urban workers.

The United States of America, as the “land of opportunity,” attracted a large number of immigrants to its shores during the late 19th and early 20th centuries. In the late 19th and early 20th centuries, life for immigrants was not easy. Many immigrants, especially the poor, lived in tenements, which were cramped, dirty, and overcrowded urban apartment buildings. Immigrants worked long hours in factories and in other kinds of manual labor. Many times they worked for very low wages under unpleasant circumstances, which often resulted in workplace accidents.

Furthermore, the competition for jobs was fierce. Many immigrants turned to labor unions and political organizations to fight for better working conditions and rights as the 20th century progressed. Most of the immigrants that arrived in the United States in the late 19th and early 20th centuries were young, between the ages of 15 and 40, but the vast majority of them were not skilled urban workers. They came to America from southern and eastern Europe and settled in cities, where they found employment as unskilled laborers.

Know more about America here:

https://brainly.com/question/28994954

#SPJ11

In what ways is the house closer to the people than the senate

Answers

Answer:

because the house serves the people not the senate their ditie is the concerns of the people not the senate

Explanation:

Assume you are an environmental consultant retained by a municipal authority in Lancaster County proposing to build a new sewage treatment plant. The company is looking at two sites:
Site A is on Shearers Creek, a tributary to Chickies Creek (aka Chiques Creek).
Site B is on an unnamed tributary to Chickies Creek (aka Chiques Creek).
The authority seeks your advice on the best location to site the sewage treatment plant. With the authority’s limited budget and lack of desire to raise sewage rates on municipal residents, its stated goals are to comply with all relevant environmental requirements at the least cost. What is your advice to your client and why?

Answers

Site B is the recommended location for the sewage treatment plant due to lower costs and minimal environmental impact.

Site B is the recommended location for the sewage treatment plant due to its advantages in terms of cost and environmental impact. By choosing Site B, the municipal authority can minimize expenses while complying with environmental regulations. Building the plant on an unnamed tributary to Chickies Creek would likely require less investment compared to Site A, enabling the authority to stay within its limited budget. Additionally, locating the plant on an unnamed tributary would have a lower impact on the overall ecosystem, minimizing potential disturbances to the sensitive Shearers Creek, a tributary to Chickies Creek. Therefore, Site B offers the most cost-effective and environmentally responsible choice for the sewage treatment plant.

Constructing the sewage treatment plant on Site B ensures that the authority can achieve its stated goals while maintaining compliance with environmental regulations. The lower costs associated with Site B allow the municipal authority to avoid increasing sewage rates for residents, which aligns with their objective of minimizing financial burden on the community. Moreover, by selecting an unnamed tributary as the location, the environmental impact on the critical Shearers Creek is significantly reduced. This approach demonstrates a responsible and conscientious approach to infrastructure development, prioritizing both economic considerations and the preservation of local ecosystems. Thus, Site B emerges as the preferred choice, providing the best balance between cost-effectiveness and environmental compliance.

To know more about environmental impact, visit:

https://brainly.com/question/13389919

#SPJ11

Why were many Americans opposed to the Vietman War, how did they express their opposition, and how did they contribute to the removal of American troops and North Vietnam's victory?

Answers

Many Americans opposed the Vietnam War because of the opposition-centered idea and some people believed that it was an unjustified war.

The opposition centered itself around the idea of mandatory military forces which many considered unfair and unjust. Many drafted fighters were students who had to quit their education in order to fight. This may hit the nation's growth in the future era.

Opposition to this war was displayed in a variety of ways. Some Americans partook in anti-war rallies and protests, including the well-known March on the Pentagon in 1967. Others wrote notes to their elected representatives and signed petitions to stop the war.

To learn more about the Vietnam war

https://brainly.com/question/1749435

#SPJ4

In colonial America, what religion(s) did the southern colonies have?

Answers

Baptist and Anglican


Rewrite the paragraph so that the verb tenses are correct.


Storm clouds darkened the blue sky as I ride my bike home from school. I have seen clouds like that before, and the wind will shake the trees violently. I couldn’t seem to pedal fast enough. Up ahead, I saw my house and breathe a sigh of relief. As soon as I walked in the door, I knew something was up. My mother explains that news reporters will be saying that a big storm is coming. Suddenly, I hear a loud pop! Then there was another pop! I will race to look out the window and saw hail the size of golf balls falling from the sky. I’m so glad I made it home before it will start falling.




Answers

As I walked home, the storm began. The wind was very strong, so I had a hard time walking forward. I was able to make it to the house by walking backwards, still with great difficulty.

What are winds?

The horizontal movement of air is known as wind. The winds blow when there is pressure difference. Winds always blows from high pressure to low pressure areas.

The speed of winds vary from region to region. Sometimes the winds are very strong which are known as storms, they can even break the trees.

The strong winds are very fearful, they can even be fatal for human. So, it becomes very difficult for a person to walk in such stormy winds.

Learn more about winds here:

https://brainly.com/question/12641106

#SPJ1

What conclusion can you draw from the fact that the constitution gives the legislature power to pass laws about the prices railroads charge?

Answers

The conclusion that can be drawn from the fact that the constitution gives the legislature power to pass laws about the prices railroads charge is that the government has a role in regulating private industry to prevent monopolistic practices and ensure fair competition.

Why it is?

The power granted to the legislature to regulate railroad pricing indicates that the government recognizes the importance of regulating private industry to promote economic competition and prevent monopolistic practices.

This demonstrates that the government has a responsibility to protect the interests of consumers and prevent businesses from exploiting their power to the detriment of the public. The power granted to the legislature reflects a fundamental belief in the need for government intervention in the economy to ensure fair competition and protect the rights of consumers.

To know more about Constitution related question visit:

https://brainly.com/question/29799909

#SPJ1

how were Suleyman l and abbas l simlar

Answers

Answer:They both reformed vicilian life and brought culture to their empires hope this helps

Explanation:

How did henry johnson ward off a german attack of a listening post he was manning, eventually killing four german soldiers?.

Answers

Henry Johnson repulsed the Germans using grenades, the butt of his rifle a bolo knife, and his bare hands, killing four and injuring others.

Johnson's regiment was given French rifles and helmets by the French Army, which also posted it to Outpost 20 at the border of the Argonne Forest in the Champagne region of France.

On the night of May 14, 1918, Johnson, who was assigned to an observation station, was attacked by a sizable German raiding force that may have included up to 36 soldiers.

Johnson successfully repelled the Germans by using grenades, the butt of his rifle, a bolo knife, and his bare hands. He killed four Germans while injuring others, freed Needham Roberts from capture, and preserved the lives of his fellow soldiers.

Johnson was wounded 21 times throughout the encounter. He was given the honorific nickname "Black Death" for this bravery as a tribute to his skill in battle.

To know more about Henry Johnson:

https://brainly.com/question/11399224

#SPJ4

4 Industrial Revolution Facts​

Answers

Answer:

1. There wasn't any law that prevent children from working

2. Poor workers were overworked and overpaid

3. The poor workers endure to live in filthy places due to overpopulation and majority of them doesn't possess the elements to live like shelter

4. The industrial revolution started in Britain because they are rich in minerals like the coal.

Other Questions
T/F Since system intrusions take place over a very short period of time, there is no need to maintain IDPS log data for more than a few hours. 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA in which of the following molecules can you confidently predict the bond angles about the central atom, and for which would you be a bit uncertain? 2 times the sum of 5 and 3 is.... * regulation of pupillary constriction and dilation is an example of the effects of the sympathetic and parasympathetic divisions on the same organ. Write an equation and solve.Some girls were playing tag on a playground. The number of girls was three less than twice the number of boys. If there are 7 girls, how many boys were playing tag? Fill in the blank with "all", "no", or "some" to make the following statements true.If your answer is "all", explain why.If your answer is "no", give an example and explain.If your answer is "some", give two examples that demonstrate when the statement is true and when it is false. Explain your examples.Note: An example must include either a graph or a specific function.(a) For: real numbers a, (x+2)=x+16.(b) For real numbers z, V+8x+16= x+4.(c) For real numbers z, if (x-1)(x+3)=6, then x-1=6 or 1+3=6.(d) For functions and g, if and g are both odd functions, then f+g is odd.(e) For values of k, z, and y, if x Can someone help me please The following statements do not make sense. Rewrite the sentences by replacing the underlined words or phrases with words or phrases that make sense. Follow the model.Haz la cama! Vamos a comer.the underlined words are " haz la cama" The largest industry in Guatemala is:banana farmingO illegal drugso tourismO coffee are you afraid of death? Solve the following inequality algebraically. |x5>10 someone help me with this table !!!!!!!*40 people responded that they use mouthwash. *Of the people who use mouthwash, 30 people use floss. *55 people responded that they do not floss. *45 people responded that they don't floss and don't use mouthwash Which statement offers the best comparison between the North and South at the beginning of the Civil War? The South had more factories than the North. The South produced more food than the North. The North had fewer people than the South.a The North had a longer coastline than the South Read this passage from Two Friends. What does the word in bold word mean?Besieged Paris was in the throes of famine. Even the sparrows on the roofs and the rats in the sewers were growing scarce. People were eating anything they could get.Infestation of pestsViolent crimeExtreme lack of food Can anyone help me pls can this be a metaphor or quote or phrase??? Pls leave explanation when obtaining blood pressure on a patient in a standing position, the patient states that he suddenly feels weak and is going to pass out. your immediate action should be to: Over the course of "An Uncomfortable Bed," what theme does the author develop about faulty assumptions? Arranging pasted information from sources into a "remix" constitutes original work and does not count as plagiarism. which od the following aspects is most likely to identify as work as romanesque