Which organism is the secondary consumer in this food chain?
A. Aspen
B. Hawk
C. Rabbit
D. Snake
Answer:
Snakeeeeeeeeeeeeeeee
Describe any variation (numerical and non-numerical) between individual replicate
measurements for the respiratory-rate experiment (before and after exercise).
The independent variables of measuring physical properties are given below -
What is physical properties?
A physical properties in any property that is measurable, whose value describe a state of physical system.
The changes in the physical properties of a system can be used to describe its changes between the momentary that state of
physical properties are often referred to as observables.
They are not modal properties.
Any variable that can be attributed a value without attributes a value to any to any other variables is called independent variables.
It is a variable that stands alone and isn't changed by other variables you are trying to measure.
To know more about physical properties click-
https://brainly.com/question/19921381
#SPJ9
List three ways to keep the environment clean
What is produced besides a polymer during dehydration synthesis?
Answer:
They are an important type of chemical reaction for living organisms since they produce many important biological polymers like proteins and polysaccharides.
Explanation:
the daily temperature range (difference between high and low temperature each day) has increased, on average, in the 20th century. t//f
The daily temperature range (difference between high and low temperature each day) has increased, on average, in the 20th century is True
Step 1: The Earth's average temperature has been steadily increasing over the past several decades due to the effects of climate change. This is the result of human activities, such as burning fossil fuels, that release greenhouse gases into the atmosphere and trap more heat in the atmosphere.
Step 2: As the Earth's average temperature increases, so does the difference between the daily high and low temperatures. This is because warm air can hold more moisture than cold air, so temperatures will fluctuate more when the air is warmer.
Step 3: When the air is warmer, the difference between the daily high and low temperatures will be greater than when the air is cooler. This is why the daily temperature range has increased in the 20th century, as the average temperature of the Earth has risen.
To learn more about daily temperature:
https://brainly.com/question/28041542
#SPJ4
I NEED HELP FAST PLEASE HELP ME
Answer: climax community,
Explanation:
When you performed BLAST search for a DNA sequence, which description is correct for “Identity value”?
a) Identity value is the number of matched nucleotide letters.
b) Identity value is the proportion of matched nucleotide letters among total size of the sequence.
c) Identity value is an estimated p-value from BLAST algorithm
d) Identity value is the number of unmatched nucleotide letters.
Answer:
the answer there is C and I also think it is
The option (C) is correct. Identity value is an estimated p-value from BLAST algorithm.
What is BLAST?In bioinformatics, BLAST is an algorithm and program for comparing primary biological sequence information, such as the amino-acid sequences of proteins or the nucleotides of DNA and/or RNA sequences.
Moreover, BLAST is a computer algorithm that is available for use online at the National Center for Biotechnology Information (NCBI) website, as well as many other sites. BLAST can rapidly align and compare a query DNA sequence with a database of sequences, which makes it a critical tool in ongoing genomic research.
Hence, BLAST is a sequence similarity search tool, and it calculates an E-value and a bit-score to assess the quality of each match. An E-value represents the number of hits of equal or greater score expected to arise by chance.
Learn more about BLAST:
https://brainly.com/question/81913
#SPJ2
An ___ Is all the interacting abiotic and biotic factors in a particular area
1) community
2)ecosystem
3)Environmental science
4)biosphere
Answer:
ECOSYSTEM
Explanation:
HOPE IT HELPS(◕ᴗ◕✿)
Bats and birds have many things in common with each other. Both bats and birds can fly . Many bats and birds hunt for similar food, like bugs. Both bats and birds take care of their young offspring. In fact, both birds and bats migrate through Florida.
Why do both birds and bats migrate?
A. Cold weather makes it hard to find food.
B. They run out of space where they live.
C. Cold temperatures make it hard to grow bigger.
D. Shorter days and longer nights.
Please help.
Answer:
A
Explanation:
Cold weather makes it hard to find food. They travel to areas where food is available.
Please answer both these questions separately!!!!
1. List and define six important physical properties of the soil.
2. Explain how a soil series differs from a land capability class.
Answer:
it help in the fertilization of plants upper most layer of the Earthserves as manurehuman activitieshuman resourcesshelterA researcher investigates a recently discovered species of plant. The plant has vascular tissues and exhibits a sporophyte and a gametophyte generation, but lacks seeds. How should the researcher classify the plant?
A.
angiosperm
B.
gymnosperm
C.
bryophyte
D.
pteridophyte
Answer:
D. pteridophyte I did this btw
Explanation:
Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.
Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.
Methionine can be abbreviated as Met.
The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.
We can use the codon chart to determine the amino acid sequence.
The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.
Each codon codes for a different amino acid.
For example, the codon AUG codes for the amino acid methionine.
To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).
Then we write down the amino acid sequence for the codons we read, using the codon chart.
Here, the sequence starts with AUG, which codes for methionine.
After that, the next codon is UAA which is a stop codon, so we can stop.
The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).
For more such questions on Methionine
https://brainly.com/question/29481268
#SPJ8
why RNA chain is always transcribed on 3' to 5' template strand ?
Explanation:
RNA growth is always in the 5′ → 3′ direction: in other words, nucleotides are always added at a 3′ growing tip, . Because of the ANTIPARALLEL nature of the nucleotide pairing, the fact that RNA is synthesized 5′ → 3′ means that the template strand must be oriented 3′ → 5′.
hope it helps you mark me brain list
The image shows an energy pyramid. Vulture Coyote Prairie dog Grass Which statement about how energy flows through this ecosystem is supported by this ecological pyramid? OA. The highest trophic level has the most available energy because vultures are a tertiary consumer. B. The organisms of the second trophic level obtain their energy from the coyotes located in the third trophic level. C. The grasses' trophic level has the most energy, but only some of that energy moves to the second trophic level. D. The third trophic level is made up of prairie dogs that get their matter and energy from the grasses.
The third trophic level is made up of prairie dogs that get their matter and energy from the grasses (option d).
The energy pyramid depicted in the image illustrates the flow of energy through an ecosystem. In an energy pyramid, each level represents a trophic level, indicating the position of organisms in a food chain. The pyramid narrows as it ascends, indicating the decrease in available energy at higher trophic levels.
In this specific pyramid, the lowest trophic level is occupied by the grass. This makes sense because grass is a producer that captures energy from the sun through photosynthesis. As a result, it possesses the most energy within the ecosystem.
Moving up the pyramid, the second trophic level is occupied by the prairie dogs. They are herbivores that primarily consume grass for their energy needs. This demonstrates that the prairie dogs acquire their matter and energy from the grasses, supporting option D.
The third trophic level contains the coyotes, which are tertiary consumers. Tertiary consumers feed on other consumers, not producers. Therefore, option A is incorrect since vultures, not coyotes, are tertiary consumers in this ecosystem.
Option B is also incorrect because the coyotes do not obtain their energy from other coyotes located in the third trophic level. They acquire their energy indirectly from the grasses through the prairie dogs.
Finally, option C is incorrect as it states that the grasses' trophic level has the most energy. While the grasses are indeed the primary producers and possess the most energy, not all of that energy moves to the second trophic level.
Thus, the correct statement supported by the ecological pyramid is option D: The third trophic level is made up of prairie dogs that get their matter and energy from the grasses.
For more such questions on energy, click on:
https://brainly.com/question/5650115
#SPJ8
PLEASE HELP ASAP!!! CORRECT ANSWERS ONLY PLEASE!!
Answer:
Fault H, then layer G and F
Explanation:
The fault H first because the layers are deformed , which means the rocks accumulated on the fault under pressure.
How is cell theory related to mitosis and meiosis?
Answer:
Cell theory states that all living organisms are made up of cells, and that cells are the basic unit of life. Mitosis and meiosis are both processes of cell division, which are essential for the production of new cells. Mitosis is the process of a single parent cell dividing into two identical daughter cells, while meiosis is the process of two parent cells dividing into four daughter cells with half the number of chromosomes as the parent cells. Therefore, cell theory is related to mitosis and meiosis because both processes are necessary for the production of new cells, which is a fundamental part of the cell theory.
Explanation:
Explain how different links can show a relation between two species. Describe evidence that shows other correlations and causations between the species.
Different links show relationships between two species. In the scientific world, there are three types of links, including mutualism, parasitism, and commensalism.
Mutualism is a relationship in which both species benefit. Parasitism is where one species benefits, and the other is harmed. Commensalism is a relationship in which one species benefits, and the other is not harmed or helped.One example of a mutualistic relationship is the bee and flower relationship. Bees collect nectar and pollen from flowers for their food, while at the same time, the bee helps in pollination. The bee gets food from the flower, and the flower is pollinated. This is a mutualistic relationship. A parasitic relationship is the relationship between tapeworms and humans. Tapeworms live inside the host and get their food from the host, thereby, causing harm to the host. Evidence that shows correlation and causation between the species includes physical changes in the organism or adaptations to the environment. For example, an animal that feeds on a certain plant may evolve to have a longer tongue to reach the nectar of that plant. In summary, different links show relationships between species, including mutualism, parasitism, and commensalism. The evidence for the correlation and causation between species includes physical changes or adaptations in the organism or environment.For more questions on species
https://brainly.com/question/30766242
#SPJ8
In humans, oculocutaneous (OCA) albinism is a collection of autosomal recessive disorders characterized by an absence of the pigment melanin in skin, hair, and eyes. That is, normal pigmentation (A) is dominant over albinism (a). For this question, assume it is a single gene with two alleles. Assume it is a single gene with two alleles. If two people have normal pigmentation, what possible phenotypes may be observed in their offspring?
Answer:
The definition of the problem is listed in the explanation segment below.
Explanation:
The parent phenotype is an albino on every one of them. Albino gene seems to be located primarily while it has its whole genotypes in such a recessive state called "aa". When this trait becomes autosomal, it does have an equivalent amount of alleles across both parent members. The gametes including its albino genotypes.⇒ \(Mother \ aa\times Father \ aa\)
⇒ \(a\times a\)
Genotype including its offspring - albino. Well, all offspring will also have albino phenotypes.So that the above is the right answer.
Select ALL the functions of the digestive system
A. Breakdown food so that the body can absorb nutrients
B. Filter and eliminate the produced liquid waste
C. Eliminate the produced solid waste
help me please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please please
Answer:
all of the above they all work together
Recently many of flordias citrus trees have been affected by a bacterial disease called citrus greening insects of a particular species that feed on citrus trees transmit the bacteria into the tree
Answer:
D
Explanation:
If you develop a tree that can resist bacteria and stay healthy you can eat it
( this is just my opinion but i believe this is correct)
What is the term for the moon going around the earth
Answer:
orbit
Explanation:
In which of the following situations would primary succession occur?A. in a desert facing a severe droughtB. on an island just formed by a volcanoC. in an area after a forest fireD. in an abandoned farm field
Remember that primary succession occurs when new land is formed or bare rock is exposed, providing a habitat that can be colonized. This colonization occurs for the first time after the land is formed.
One example of this succession is an eruption of volcanoes since as lava flows into the ocean, new rock is formed.
we can conclude that the correct answer is:
Answer:B. on an island just formed by a volcano
_____________ motion is when a planet moves _____________ relative to the fixed stars.
Retrograde, backwards
Prograde, backwards
Prograde, sideways
Retrograde, forwards
Answer:
Retrograde, backwards
U 2 can help me by marking as brainliest.........
Retrograde motion when a planet moves backwards relative to the fixed stars.
What is Retrograde motion?Retrograde motion is the term used to describe when a planet appears to reverse its course in the sky (from the Latin word retrogradus – "going backward").
The planets in the sky normally move in the same direction as the Sun, from west to east, as the Earth revolves around the Sun from day to day and week to week.
It is known as direct or retrograde motion in astronomy. Contrast this motion with the normal east-to-west motion of the planets and the Sun in the sky, which is brought on by the Earth's rotation on its axis.
Therefore, Retrograde motion when a planet moves backwards relative to the fixed stars.
To learn more about retrograde motion, refer to the link:
https://brainly.com/question/1276082
#SPJ2
92ml 3.0 fl oz what is the ratio
The ratio between 92 mL and 3.0 fl oz is 46 : 44, or it can be further simplified to 23 : 22.
To find the ratio between 92 mL and 3.0 fl oz, we need to convert the units to a common measurement. Let's convert 3.0 fl oz to milliliters (mL).
1 fluid ounce (fl oz) is equal to approximately 29.5735 milliliters (mL).
Therefore, 3.0 fl oz is equal to 3.0 * 29.5735 = 88.72 mL (rounded to two decimal places).
Now we can express the ratio between 92 mL and 88.72 mL:
92 mL : 88.72 mL
Simplifying the ratio by dividing both sides by the greatest common divisor, we get:
46 : 44
So, the ratio between 92 mL and 3.0 fl oz is 46 : 44, or it can be further simplified to 23 : 22.
Know more about ratio here:
https://brainly.com/question/4771743
#SPJ8
Which type of energy transfer occurs primarily in liquids and gasses?
Answer:
Convection and conduction are the two most prominent methods of heat transfer in liquids and gases.
Question 6 Q
The presence of tiny hairs, called setae, on the toe pads of some geckos is associated with the ability to adhere to smooth surfaces. This ability allows geckos to climb in areas where many predators cannot. Scientists
studying the evolution of setae have identified three closely related species of gecko, only one of which can adhere to smooth surfaces. A model of the evolutionary relatedness between these species is represented in the
figure.
G. humeralis
D
OG. concinnatus
OG. antillensis
Can adhere
O Cannot adhere
Which of the following best describes how the ability to adhere to smooth surfaces affects the fitness of G. humeralis?
The ability to adhere to smooth surfaces is likely to decrease the fitness of G. humeralis because the ability decreases the likelihood of predation
The ability to adhere to smooth surfaces is likely to decrease the fitness of G. humeralis because the ability increases the likelihood of predation.
The ability to adhere to smooth surfaces is likely to increase the fitness of G. humeralis because the ability decreases the likelihood of predation.
The ability to adhere to smooth surfaces is likely to increase the fitness of G. humeralis because the ability increases the likelihood of predation.
The ability to adhere to smooth surfaces is likely to increase the fitness of G. humeralis because the ability decreases the likelihood of predation. Therefore, option C is correct.
What are setae?A stiff hair, bristle, or bristlelike process or part of an organism. Setae on the bodies of spiders are used as sensory organs, while setae on the bodies of many polychaete worms, such as earthworms, are used for locomotion.
Thus, the ability to adhere to smooth surfaces is likely to increase the fitness of G. humeralis because the ability decreases the likelihood of predation. Therefore, option C is correct.
Learn more about setae, here:
https://brainly.com/question/20392483
#SPJ1
Which structure is less likely to suffer severe damage during an earthquake: a high-rise, steel- frame hotel built on sediment, or a wood-frame house built on bedrock? Explain.
Answer:
The correct answer is - A wood-frame house built on bedrock.
Explanation:
An earthquake would damage a steel-frame building built on sediment in comparison of a wooden house built on the bedrock due to the fact that waves of an earthquake do not go through solid things easily such as the earth core or the bedrock land rather than reclaimed land or sediments.
So, the bedrock will shake less than the hotel or heave building built on sediment. A house that made up of wooden-frame would shake only whereas the steel-frame might damage more.
the Ptolemaic theory, what is it?
Centimeters
A farmer is collecting data about one of her cows. Which of the following points
types of data is an example of qualitative data? Select all that apply. *
The color of the cow
The number of pairs of chromosomes in each of the cow's body cells
The body temperature of the cow
nne
The age of the cow
Answer:
The color of the cow
The body temperatire of the cow
The age of the cow
Explanation:
Qualitive data involves using your senses to observe.
The diagram below represents a stack of rock layers. Examine the diagram, and answer the question that follows.
What do these layers and their fossils suggest about Earth's history?
A.
There have been changes in Earth's lifeforms over time.
B.
Lifeforms on Earth have been the same over time.
C.
No lifeforms were present when these layers formed.
D.
Only one kind of lifeform lived where these layers formed.
Fossils are animals and vegetable remains that get deposited or printed in sedimentary layers. Option A is correct: There have been changes in Earth's lifeforms over time.
What is a fossil?
Fossils are animal and vegetable rests found in different strata of sedimentary rocks. Sedimentary layers deposit chronologically, so they are used to reflect history. They keep in each layer some of the forms of life that inhabited that area in the past.
Fossils are very useful while dating ages. Index fossils are the fossilized organizms that only used to exist in a given era or geological period during evolution.
Fossil registers show that similar or different structured have been inhabiting the same area in the same period of time.
According to this framework, we can assume option A is correct: There have been changes in Earth's lifeforms over time.
In the image, from the bottom (oldest layers) to the upper part (most recent layers), we can see how the organisms inhabiting this area changed with the pass of time.
You can learn more about fossils at
https://brainly.com/question/14988327
#SPJ1