To assert a tortious interference claim against Mjgreen, Aromatic must show the following four elements:
A valid contractual relationship or business expectation must meet the following criteria: 1. Existence; 2. Knowledge by the defendant of the relationship or expectation; 3. Intentional interference leading to a breach or termination of the relationship or expectation; and 4. Damage to the party whose relationship or expectation was disrupted.
Tortious interference with a contract or business expectation happens when someone purposefully ruins the plaintiff's business or contractual relationship with a third party. Early Roman law allowed the head of a household to file a lawsuit against a third party who had harmed a member of his household, giving rise to the tort of tortious interference.
Learn more about tortious interference here:
https://brainly.com/question/13776673
#SPJ4
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
Answer:
The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.
The concept of federal law taking precedence over state or local law is commonly called the _____ doctrine.
Answer:
Preemption
Explanation:
What can officers do to maintain effective communication during emergency situations
Answer:
Explanation:
In emergency situations like school shooting, bomb threats and other emergency situations, people will tend to panic. The officer would need to explain what is going and to calm the people down by keeping their explanation short. It can also save lives and reduce injury. Knowing the proper protective actions to take enables people to reduce their risks.
Conduct a case study on a location of your choice and identify sources of air or water pollution. Discuss any environmental laws the pollutants or polluters are violating. You will have the option to discuss a relevant factor in your location, such as environmental injustice, epigenetics, or sustainable development. This will be due at the end of Unit 7. Instructions: • Research, find, and describe a case of air or water pollution from a location of your choice from within or outside of the United States. • Discuss the pollutants and how they would be in violation of any current pollution laws or legislation in the area. If here in the United States, how they would be in violation of the Clean Air or Clean Water Acts? Or perhaps the country you have researched has no restrictions on pollution for air and water, discuss how this would further endanger the lives of humans and wildlife in the area. • Choose one (1) of the following special topics below and discuss how the source of pollution is contributing to it. Be sure to support your work with at least two (2) pieces of scientific evidence: o An Environmental Injustice o A threat to Epigenetics by potentially causing inheritable gene defects o Defies sustainable development (contributes to the degraded environment and causes harm to wildlife or the ecosystem) Requirements: • Provide multiple pieces of supporting evidence in your claims, using at least two (2) scholarly resources. • Include all references and citations formatted correctly in APA. • Project should be at least three (3) pages in length, with additional Title and Reference pages. • Use complete sentences and appropriate grammar and spelling.
One example of a case of air pollution is the city of Delhi in India. Delhi has been experiencing severe air pollution issues for many years, particularly during the winter season.
The main sources of air pollution in Delhi include vehicular emissions, industrial pollution, construction activities, and the burning of agricultural residues.
In terms of legislation, India has implemented various laws and regulations to address air pollution. The Air (Prevention and Control of Pollution) Act, 1981 is the primary legislation that empowers the central and state pollution control boards to regulate and control air pollution. The act provides for the prevention, control, and abatement of air pollution through measures such as emission standards, setting up pollution control committees, and conducting regular monitoring.
The pollutants in Delhi's air, such as particulate matter (PM2.5 and PM10), nitrogen oxides (NOx), sulfur dioxide (SO2), and volatile organic compounds (VOCs), would be in violation of the air quality standards set by the Central Pollution Control Board (CPCB) in India. These standards aim to protect human health and the environment by defining permissible limits for different pollutants.
If we consider the special topics you mentioned, one aspect related to Delhi's air pollution is environmental injustice. The impact of air pollution is not evenly distributed across the population, with marginalized communities often being disproportionately affected. Factors such as socioeconomic status, access to healthcare, and living conditions can exacerbate the health risks associated with air pollution, leading to environmental injustice.
To read more about Air Pollution click here
https://brainly.com/question/31023039
#SPJ11
Why would intellectual property theft fit the mission of private technology security and possibly be more applicable than it is to law enforcement?
a. Law enforcement has sought to transfer authority at the federal level for technology crimes to come under the purview of private security firms.
b. Private security officers simply have more technological training than law enforcement.
c. Law enforcement does not tend to get involved in white-collar crime.
d. Private security firms specialize in a wide range of areas and crime, which often require more manpower and time than law enforcement has to give.
100 points
C) Law enforcement does not tend to get involved in white-collar crime.
The job of dealing with white-collar crime typically is given to the FBI. In recent years however, the amount of crime in this field has skyrocketed, giving birth to a whole new field of private technology security. Law enforcement is unable to assist in white-collar crimes without information and data passed on from the FBI or other technology security companies.
I hope this helps! :)
the supreme court decision in what case led many affirmative action opponents to believe that the court may have been on its way to abolishing affirmative action completely?
Answer:
Explanation:
The Supreme Court decision in the case of Fisher v. University of Texas at Austin (2013) led many affirmative action opponents to believe that the Court may have been on its way to abolishing affirmative action completely.
In this case, a white student named Abigail Fisher challenged the University of Texas at Austin's use of race as a factor in its admissions process. Fisher argued that the university's affirmative action policy violated the Equal Protection Clause of the Fourteenth Amendment, as well as federal civil rights laws.
The Supreme Court ultimately ruled in favor of the University of Texas, upholding the constitutionality of its affirmative action policy. However, the decision was a narrow one, with the Court emphasizing that universities must show a compelling interest in using race as a factor in admissions, and that they must use race-neutral alternatives whenever possible.
While the Fisher decision did not abolish affirmative action outright, many opponents of affirmative action saw it as a significant setback for the policy, as it signaled that the Court was becoming increasingly skeptical of the use of race in university admissions. Some opponents of affirmative action saw the Fisher decision as a step towards a future Supreme Court decision that could potentially abolish affirmative action altogether.
Dash convinces Esmé to enter into a contract for the purchase of a Falafel Waffle Food Cart by knowingly misrepresenting a number of material features about the facility and the business. Most likely, Esmé can rescind the contract on the basis of
Answer: fraudulent misinterpretation
Explanation:
Fraudulent misrepresentation occurs when a person is tricked into an agreement through the use of false statements or lies. The misrepresentation can be through gestures, spoken words, written words or through silence.
In this case, we are informed that Dash convinces Esmé to enter into a contract to buy a Falafel Waffle Food Cart by knowingly misrepresenting a number of material features about the facility and the business.
Esmé can rescind the contract on the basis of fraudulent misinterpretation.
What does a political field director do?
The Political director is in charge of managing the business or organization, defending the interests of shareholders, establishing management policies, and making critical decisions.
The protection of the shareholders' interests is the main duty of the board of directors of a public corporation, who are chosen by the shareholders. In truth, directors are obligated by law to prioritize shareholders' interests before their own. The board of directors performs a supervisory function by monitoring and assessing the company's operations. Board members' main roles include planning and supervision. Although there are distinctions, there are several situations when board members can give the CEO or CFO specific authority. Additionally, directors frequently assign particular tasks to Board committees. The board's committees function as divisions of the whole board.
Learn more about Political directors here:
https://brainly.com/question/29359566
#SPJ4
In the end of the court case it was decided by the court that Sally was just over-reacting and should not receive any retribution for the stolen boyfriend. She decides she wants a second opinion and therefore appeals. The court is known as: *
Answer:
Appellate Court.Explanation:
The Appellate Court, also known as the Court of Appeals, is a judicial court that hears cases which have been already heard in other courts. The duty of an appellate court is to review the processes and verdicts givens by the trial courts.
Here, since Sally is not satisfied with the judgement made by the trial court, she can apply for a hearing in the Appellate Court. The appellate court would review hear case and make the final decision.
Before parliamentary acts were passed to regulate working, how many hours per day did most children work?.
Before the given parliamentary acts were passed in order to the regulate working, then children are not allowed to work for more than 12 hours in a day.
By 1833, any Government exceeded what become to be the primary of many acts handling running situations and hours. At first, there has been restricted energy to implement those acts however because the century advanced the guidelines have been enforced extra strictly.
Nonetheless, the hours and running situations have been nevertheless very difficult with the aid of using today’s standards, and no guidelines have been in region to defend person male workers. Working in the road jobs protected shining shoes, promoting newspapers, canning fish, making garments and weaving fabrics. With the understanding that youngsters labored in factories, mines, and different jobs we could speak approximately their wages and hours. A regular day for those abused youngsters become everywhere from 12 to 19 hours a day.
Learn more about parliamentary visit: brainly.com/question/1504316
#SPJ4
A half-page plea in a traditional newspaper to pass environmental legislation or carry out sanctions against governments that permit whaling is clearly which of the following?
Select one:
a. Either an editorial message or a commercial message.
b. Both an editorial message and a commercial message.
c. Neither an editorial message nor a commercial message.
d. A commercial message only.
e. An editorial message only.
Feedback
A half-page plea in a traditional newspaper to pass environmental legislation or carry out sanctions against governments that permit whaling is clearly A commercial message only. Option C
What is a commercial message?
Generally, Any sign, phrase, logo, or other visual that directly or indirectly identifies, promotes, or draws attention to a company, a product, a service, or other commercial activity is referred to as a commercial message.
The phrase, written content, and visuals make up the core components of an advertising message.
However, the narrative is just as powerful. If they are summed up at the conclusion with an impactful phrase, they become even more memorable.
A notion that an advertiser wishes to convey to their target audience is called an advertising message. Its objective is to persuade users to carry out a certain action, such as signing up, making a purchase, or booking a reservation.
Read more about the commercial message
https://brainly.com/question/13139056
#SPJ1
Which success factor or reward of IS implementation enables you to see the real-time status or availability of a process or product?
A.
efficiency
B.
visibility
C.
quality
D.
productivity
3. While seem by some as a way to get rich, the
tax on the poor.
O Lottery
O Credit Card Industry
O Stock Market
Sales Tax
is actually a tax on the poor
many people have argued that Ghana has no laws. Do you subscribe to this class of people.
Answer:
No, I do not. Ghana does have laws.
Explanation:
Ghana has a very operational legal system. Its judicial universe is patterned after that of Britain's Common Law system.
Besides having a functional and healthy legal complex, Ghana is known for the adroitness of its judges, the independence of its legal system from the politics or the influence of the political class, and the ability to dispense justice fairly.
The republic of Ghana's legal system rests on the foundation of its constitution. Her constitution which exists as the supreme law of the Republic was approved by 92 percent of the electorate through a national referendum on the 28th day of April nineteen-ninety-two.
Cheers
I NEED THE ANSWER ASAP PLEASE!!!!!!!Where do all proposed laws begin? *
A) With the president
B) On the floor of the Senate
C) In the judicial branch
D) In a congressional committee
Should prosecution for a crime in both state and federal courts be prohibited by the double jeopardy clause?
The double jeopardy clause, as outlined in the Fifth Amendment of the United States Constitution, prohibits an individual from being tried for the same crime twice. This principle is intended to protect citizens from being subjected to the trauma and financial burden of multiple trials for the same offense. However, there is ongoing debate about whether prosecution for a crime in both state and federal courts should also be prohibited by the double jeopardy clause.
One argument for prohibiting prosecution in both state and federal courts is that it would prevent the government from using the legal system as a means of harassment or punishment. If an individual is acquitted or convicted in a state court, it would be unjust for them to be subjected to another trial in a federal court for the same crime. This would also prevent the government from using multiple trials as a means of securing a conviction, even if there is not enough evidence to support a guilty verdict in one court.
On the other hand, some argue that prosecution in both state and federal courts should not be prohibited by the double jeopardy clause because it allows for different levels of government to hold individuals accountable for their actions. For example, if a crime is committed on federal land or involves crossing state lines, it may be appropriate for both state and federal prosecutors to pursue charges. Additionally, some argue that prohibiting prosecution in both state and federal courts would hinder the government's ability to effectively combat organized crime or other complex criminal activities that may span multiple jurisdictions.
In conclusion, the double jeopardy clause is an important principle that is intended to protect citizens from being subjected to multiple trials for the same crime. However, whether prosecution in both state and federal courts should be prohibited by the double jeopardy clause is a complex issue that requires careful consideration of the potential consequences for citizens and the government's ability to effectively combat crime.
Which conflict would most likely be settled by law rather than ethics?
Family members disagree over division of responsibility for household chores.
A teen breaks a neighbor's fence panel while practicing archery.
A student and teacher disagree on the final course grade earned.
A driver damages another car in a grocery store parking lot.
The conflict that would most likely be settled by law rather than ethics is: d. A driver damages another car in a grocery store parking lot.
What is conflict?Conflict can be defined as a form of disagreement that occur between two or more people. Conflict is what led to the development of conflict resolution as conflict resolution help to settle the disagreement the people that were involved in a conflict had .
The case that may be settle by the court of law is when a person damage or destroy another person property in which the person that commit the damage refuse to repair the damage, the owner of the property can sue the person in the law of court for damage which will be settle by the jury and if found guilty the person must pay for the damage.
Therefore the correct option is D.
Learn more about conflict here: https://brainly.com/question/25668660
#SPJ1
Answer:
A driver damages another car in a grocery store parking lot.
Explanation:
Got this right on the quiz! Although another choice might also be settled by law, this one is MOST LIKELY to be settled using law.
The United States is on par with Russia in having more persons per capita in prison. Is that a sign that the United States is a nation that enforces its laws, or is it an
indication that something is inherently wrong with its criminal justice system? Please explain and then respond to a
According to the criminal justice system, the United States is the one that enforces the laws, and the poor are disproportionately represented in the prison population.
What is criminal?
The person who committed a crime is referred to as a "criminal." A individual is legitimately arrested if they are the indifferent perpetrator of the crime. Lawbreakers are classified into four types: persistent, moralistic, juridical, and organized. The perpetrator must be punished by the court.
According to the criminal justice, the United States is the one that writes the laws, and the crimes police are overburdened. A substantial proportion of the poor end up in prison.
Hence, the significance was the criminal aforementioned.
Learn more about on criminal, here:
https://brainly.com/question/23059652
#SPJ1
Based on the facts of the previous question, Jay stays in the hospital for a few days as he is recuperating. Then, a couple of weeks after he gets released from the hospital, Jay receives a bill from the hospital for $10,000 for his medical care. If this went to court, the judge would probably describe this situation as:________.
a. a bilateral contract, enforceable against Jay.
b. a unilateral contract, enforceable against Jay.
c. an implied contract, enforceable against Jay.
d. no contract at all. Jay should not have to pay anything.
Answer: c. an implied contract, enforceable against Jay.
Explanation:
An Implied contracts is usually between physician and a patient this contracts do not state the course of action or payment at the start or inception of the service. Example, a medical examination usually takes place the moment a patient's request for it, this tests are usually either at the patients home or at the medical facility where the doctor practices. After the examination a course of action or payment is decided. Same applies to Jay after been treated and discharged from the hospital a course of action or payment may be made.
Common Law
A formal, written accusation submitted bt the court by a grand jury, alleging a
specified person has committed a specified offense, usually a felony
Governmental department for keeping order
Law of a country based on customs
A formal, written accusation submitted bt the court by a prosecutor, alleging a
specified person has committed a specified crime
The act of something that is against the law
To summon one to do the right
Generally, harassment only applies if you were the direct target of the offensive conduct. True or false?.
Answer:
True
Explanation:
It is a false statment that By and large, harassment possibly applies on the off chance that you were the immediate objective of the hostile lead.
Harassment can apply regardless of whether you were not the immediate objective of the hostile direct. Provocation alludes to any unwanted way of behaving, remarks, activities, or correspondence that establishes a threatening or scaring climate for an individual or a gathering in light of safeguarded qualities like race, religion, identity, age, handicap, or different elements. It can happen while seeing such way of behaving coordinated at others or in any event, when in a roundabout way impacted by it.
Numerous enemy of segregation and badgering regulations perceive the more extensive effect of provocation, permitting people who experience an unfriendly climate or witness harassment to make a lawful move or look for response to resolve the issue and safeguard their privileges.
Learn more about objective, from:
brainly.com/question/31807796
#SPJ7
What types of information are part of the electronic discovery process? (Select all that apply.)
metadata
voicemail messages
network system information
computer files
Winston pays a yearly fee to Barbara to rent stall space for his horse at the fairgrounds. Winston’s tenancy is best classified as:
Which of the following is a main reason why some states were not in favor of ratifying the US Constitution?
Some states were not in favor of ratifying the US Constitution as it did not include the bill of rights.
They feared that without the bill of rights, the new national government would threaten individual liberties/
The 1787 Constitutional Convention drafted the document, which required ratification by nine or more state conventions.
A conflict arose over ratification, with the Federalists supporting a strong union and the Constitution's adoption and the Anti-Federalists opposing the establishment of a powerful national government and rejecting ratification.
The Anti-Federalists wrote a number of essays and made a number of speeches against ratification of the Constitution in order to counter the Federalist effort.
James Madison proposed twelve amendments during the First Congress in 1789, which were ratified. Ten of them were approved by the states, went into effect in 1791, and are now commonly referred to as the Bill of Rights.
To know more about the ratification of the constitution, click here:
https://brainly.com/question/30007168
#SPJ4
Which of the following is not true about the answer in pre-trial procedures
Answer:
what is the followin questions?
Explanation:
which kind of court would handle a criminal case in which the accused is charged with illegally acquiring guns in mexico and selling them to someone in california?
A criminal case involving the illegal acquisition of guns in Mexico and their sale to someone in California would typically be handled by a federal court, specifically the United States District Court for the district where the crime occurred.
The reason for this is that the crime falls under federal jurisdiction because it entails breaking both state and federal laws as well as crossing international and interstate borders.
Federal offences, such as the unlawful importation or exportation of firearms, fall within the exclusive jurisdiction of the federal court system, as do other federal offences.
As a result, the matter would be heard and decided by a federal court.
For such more question on criminal:
https://brainly.com/question/740707
#SPJ11
What impact do you believe this will have on suspect identification from police, prosecution, and defense perspective?
Impact that forensic evidence will have on suspect identification from police, prosecution, and defense perspective is that it will help with the data of the criminal and unveil the identity of criminal.
What is Forensic evidence?Forensic evidence is the use of science in the domain of legal proceedings.
It help to know if the suspect is guilty or not by conducting series of tests. These tests are been conducted with the help of experts in the scientific, medical, or technological field.
Learn more about forensic evidence on:
https://brainly.com/question/3049628
#SPJ1
Choose one of the following cases:
McCulloch v. Maryland, Gibbons v. Ogden, or District of Columbia v. Heller.
In at least two well-written paragraphs, explain why the case is important to understanding the changing nature of American federalism.
The case chosen for discussion is the Gibbons v. Ogden 1824 case, which accorded Congress the authority to regulate commerce and navigation, thereby confirming that federal law takes precedence over state laws.
What was the Gibbons v. Ogden 1824 case?The Gibbons v. Ogden case involved a dispute over shipping monopolies in New York.
When the case reached the Supreme Court, it was decided that Congress had the authority to regulate commerce and navigation according to the Constitution's Commerce Clause.
The implication is that Congress exercises authority over interstate and some intrastate commerce.
Thus, Gibbons v. Ogden expanded the federal powers over the states as a landmark decision.
Learn more about Gibbons v. Ogden at https://brainly.com/question/10443322
#SPJ1
The Texas Constitution creates two top appellate courts: one for civil cases and one for criminal cases. True False
The Texas Constitution creates two top appellate courts: one for civil cases and one for criminal cases. This statement is True.
What is Constitution?A constitution is a collection of guiding ideas or accepted precedents that serve as the foundation for a polity, organisation, or other sort of body's legal system and frequently specify how that institution is to be governed. A written constitution is said to be one that contains these principles in a single legal document or group of legal papers; a codified constitution is one that contains all of these principles in a single comprehensive document.What is civil law?A significant area of law is civil law. The phrase relates to non-criminal law in common law legal systems such those in England, Wales, and the United States. The law of property, as well as the laws governing civil wrongs and quasi-contracts, are all examples of civil law (other than property-related crimes, such as theft or vandalism). Like criminal law, civil law can be broken down into substantive law and procedural law. The major issue of civil law is the rights and obligations of people (natural and legal persons) toward one another.Learn more about Constitution here:
https://brainly.com/question/19411179
#SPJ4
The University of California Los Angeles maintains a police force of _____.
600 officers
16 sworn officers who split their time between campuses
6 sworn officers and 66 civilian guards
over 60 sworn officers
The University of California Los Angeles maintains a police force of over 60 sworn officers.
The University of California Los Angeles (UCLA) has 64 sworn police officers who are joined by 40 full-time civilian department members. Together they try to maintain campus safety through crime prevention and education programs. They are also responsible in maintaining law and order.
The University of California Police Department or UCPD shares a partnership with the CARE. It is Campus Assault Resources and Education program. CARE is a safe place for survivors of sexual assault and help in maintaining discipline in the university. It also promotes safety awareness about recent activities through community outreach programs.
To know more about University of California here
https://brainly.com/question/16551247
#SPJ1