A dog food storage container is in the shape of a rectangular prism. If the dimensions of the container are 22 inches by 34 inches by 20 inches, what is the maximum amount of food that the container can hold? 14,960 cubic inches of food 7,480 cubic inches of food 3,736 cubic inches of food 1,868 cubic inches of food

Answers

Answer 1

The maximum amount of food that the rectangular prism container can hold is 14,960 cubic inches.

Volume of a Rectangular Prism Formula:

The volume of the rectangular prism is equal to the area of the base times its height. The volume of a rectangular prism = Length x Width x Height cubic units.

According to the Question:

The maximum amount of food that the container can hold is equal to the volume of the rectangular prism. We can find the volume by multiplying the length, width, and height:

V = 22 inches × 34 inches × 20 inches

V = 14,960 cubic inches

Therefore, the maximum amount of food that the container can hold is 14,960 cubic inches. Answer: A) 14,960 cubic inches of food.

Learn more about rectangular prism:

brainly.com/question/21308574

#SPJ4

Answer 2

Answer: 14,960

Step-by-step explanation: i took the test


Related Questions

Question 1 (4 points)
Simplify.
9 to the power of 2 and 9 to the power of 7


Answers

(9)2 and (9)7

If base is same then powers can be added

(9)2+7

(9)9


=387,420,489

Which rigid motion transformation means
you flip an object over a line of
symmetry?

Posible Answers

A. Rotation

B. Reflection

C. Translation

D. Dilation

Answers

Answer:

Reflection

Step-by-step explanation:

find the coefficients of the fourier cosine series for the function defined by use pi for . give the general form the coefficient .

Answers

The Fourier cosine series for a function f(x) on the interval [-L,L] is given by the formula:

f(x) = a0/2 + SUM[n=1 to infinity] {ancos(npi*x/L)}

where the coefficients an are given by:

an = (2/L) * INTEGRAL[-L to L] {f(x)cos(npi*x/L) dx}

For the function f(x) = x(2L-x) defined on the interval [0,L], the Fourier cosine series can be calculated as follows:

a0 = (2/L) * INTEGRAL[0 to L] {f(x) dx} = (2/L) * INTEGRAL[0 to L] {x(2L-x) dx} = 2/3 * L

an = (2/L) * INTEGRAL[0 to L] {f(x)cos(npix/L) dx} = (2/L) * INTEGRAL[0 to L] {x(2L-x)cos(npix/L) dx}

Using integration by parts, we can simplify this expression to:

an = (4L/(npi)^2) * [(-1)^n - 1]

Therefore, the Fourier cosine series for the function f(x) = x(2L-x) on the interval [0,L] is:

f(x) = (L/3) + SUM[n=1 to infinity] {(4L/(npi)^2) * [(-1)^n - 1] * cos(npix/L)}

This series converges to the function f(x) on the interval [0,L].

Learn more about Fourier cosine series here: brainly.com/question/32204119

#SPJ11

You measure the length of the same side of a block five times and each measurement has an uncertainty of Δ
b = 0.1 mm. What is the uncertainty in the best estimate for b?

Answers

The uncertainty in the best estimate for the length of the side of the block is approximately 0.0447 mm.

To determine the uncertainty in the best estimate for the length of the block side, we can consider the range of values obtained from the measurements. Since the uncertainty represents the possible deviation from the true value, the range of measurements can be used to estimate the uncertainty in the best estimate

To find the standard deviation represents the average amount of variation or spread among the measurements , we use the formula σ = Δb / √n, where σ is the standard deviation, Δb is the uncertainty in each measurement, and n is the number of measurements.

In this case, Δb = 0.1 mm and n = 5. Plugging these values into the formula, we get σ = 0.1 / √5 ≈ 0.0447 mm.

learn more about standard deviation here:

https://brainly.com/question/29115611

#SPJ11

Consider the plane T. and three collinear (but not coplanar) points P, Q, and W.

Can either P, Q, or Wbe a point on the plane T?

A Yes, because if points are collinear, they must all fall on the same plane and be coplanar.
B Yes, because even if points are collinear, one of the points may fall on a plane while the others do not.
C No, because if points are collinear, they must all fall on the same plane and be coplanar.
D No, because even if points are collinear, one of the points may fall on a plane while the others do not.

Answers

Answer:

B Yes, because even if points are collinear, one of the points may fall on a plane while the others do not.

Step-by-step explanation:

good luck

The table shows the distances and times that two dogs Which statements are true about the data shown in th table? Check all that apply. ran. O Fido ran faster than Ruff. O Ruff ran faster than Fido. Dog Distance (feet) Time (seconds) O The dogs ran at the same speed. O Fido's speed was 3 feet per second O Ruff's speed was 4 feet per second. Fido 54 18 Ruff 64 16​

Answers

Answer:

what!!!!!????

Step-by-step explanation:

I don't understand what are we supposed to do

Answer:

B, D, and E

Step-by-step explanation:

I just had the same question

−3x(4x−2),2x(6x 2 +4x−3) multiply
(2x−3)(5x+6),multipy the polynomial by the box method

Answers

2x(6x2 + 4x − 3) × (2x − 3)(5x + 6)

= (2x)2(6x2 + 4x − 3)(5x + 6)

= 12x3(5x + 6) + 8x2(5x + 6) − 6x(5x + 6)

= 60x4 + 48x3 − 45x2 − 36x

kya earned$630 per week . if she worked for 30 hourswhat is her hourly rate

Answers

Answer:

$21

Step-by-step explanation:

630 ÷ 30 = 21

think it's right

Quadrilateral ABCD has vertices A(3, 8), B(6, -8),
C(-6, -6), and D(-3, 4). Using the origin as the
center of dilation, the quadrilateral is horizontally
stretched by scale factor 4/3 then vertically
compressed by scale factor 1/2
Part A
Graph quadrilateral A"B"C"D".

Quadrilateral ABCD has vertices A(3, 8), B(6, -8),C(-6, -6), and D(-3, 4). Using the origin as thecenter

Answers

the dilatation of the quadrilateral ABCD, where the vertices' coordinates are \(A (x1,y1), B (x2,y2), C (x3,y3),D(x4,y4){}\) is written as: with scale factor k.

What are the vertices of a quadrilateral ABCD?

A(,3,8), B(6,-8), C(-6,-6) and D are the vertices of the quadrilateral ABCD (-3,4) Establish the rhombic shape of ABCD.

A polygon with four sides exactly is referred to as a quadrilateral. The fact that a quadrilateral has exactly four vertices and four angles is also implied by this.

Each diagonal is parallel to the other. It is therefore a rhombus. The diagonals of the parallelogram are a rectangle, rhombus, and square since they are congruent and perpendicular to one another. A rhombus is ABCD.

\(A(x1,y1){}\)⇒\(A'(kx1,ky1){}\)

\(B(x2,y2){}\)⇒\(B'(kx2,ky2){}\)

\(C(x3,y3){}\)⇒\(C'(kx3,ky3){}\)

\(D(x4,y4){}\)⇒\(D'(kx4,ky4){}\)

Therefore, a dilated quadrilateral A'B'C'D"s vertices would have the coordinates \(A'(kx1,ky1), B'(kx2,ky2), C'(kx3,ky3), and D(kx4,ky4){}\)

It should be noted that "k" could have an integer, decimal, or fractional value.

To learn more about quadrilateral refer to:

https://brainly.com/question/27991573

#SPJ1

PLssssss HELPPPPPPP will GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!


Mr. Mayhood had 4½ pounds of sand in a bucket. He put 2¾ pounds

of sand around his flower bed. How much sand did he have left in the

bucket?

Answers

Answer:

For addition 7 1/4. For subtraction 1 3/4. For multiplication 12 2/8. For division 1 7/11.  

Step-by-step explanation:

Solve for x and y 60° 15°

Solve for x and y 60 15

Answers

Answer:

y = 4x hope this Helps!

Step-by-step explanation:

y = kx

k = y/x = 60/15 = 4

y = 4x

Find the probability that in a single roll of a die, an odd number or a number greater than 2 comes up.A.1B.5/6C.4/6D.6

Answers

As given by the question

There are given that the roll of die.

Now,

In the die, there are total outcomes is 6.

And,

The value in die which is odd number is:

1, 3, 5,

The number that an odd number or a number greater than 2

So, the succesfull outcomes is:

1, 3, 4, 5, 6.

Then,

The probability will be:

\(\begin{gathered} P=\frac{\text{succesfully outcomes}}{\text{total numbers of outcomes}} \\ P=\frac{\text{5}}{\text{6}} \end{gathered}\)

Hence, the correct option is B

a census reports that the mean retirement age is 68.3 years. in a random sample, the mean retirement age is 65.8 years. what is the mean of 68.3 years?

Answers

The mean retirement age in the census report is 68.3 years.

The given information states that the population mean retirement age is 68.3 years, and a random sample of retirement age has a sample mean of 65.8 years. We can use this information to estimate the population mean with a certain level of confidence.

However, the question asks us to find the mean of 68.3 years, which is simply the given population mean. Therefore, we can state that the mean of 68.3 years remains the same, as it is not affected by the sample mean or any other sample statistic.

In other words, the population mean of 68.3 years is a fixed value, and it does not change based on the sample mean or any other sample statistic. Therefore, we can simply state that the mean retirement age is 68.3 years, which is the given information provided in the question.

You can learn more about random sample at

https://brainly.com/question/29348144

#SPJ11

Does the parabola open up or down?

f(x) = -5x² - 2

Answers

Answer:

Down

Step-by-step explanation:

The negative before the x^2 makes it Down.

PLEASE HELP ASAP
For her phone service, Charmaine pays
a monthly fee of $14, and she pays an
additional $0.05 per minute of use. The
least she has been charged in a month is
$75.20. What are the possible numbers
of minutes she has used her phone in a
month?

Answers

1,224 minutes.

75.20 minus 14 = 61.2

61.2 / 1,224minutes

Derivative of log(tanhx)

Answers

Derivative of log(tanhx) = 2cossec(2x)

Let us assume y = log (tan hx)

On differentiating both sides ,

\( \frac{dy}{dx \: } = \frac{d \: log(tanhx)}{dx} \)

\( \frac{dy}{dx} = \frac{d log( \tan(hx) ) }{d \tan(hx).d \tan(hx) } \times dx\)

\( \frac{dy}{dx} = \frac{1}{ \tan(hx) \times \sec( {h}^{2x} ) } \)

\( \frac{dy}{dx} = \frac{ \cos(hx) }{ \sin(hx) } \times \frac{1 }{ \cos(h {}^{2} ) } \)

\( \frac{dy}{dx} = \frac{2}{2 \sin(hx). \cos(hx) } \)

\( \frac{dy}{dx} = \frac{2}{ \sin(h)(2x) } \)

dy/dx = 2 cos sec (2x)

For more information on this,

https://brainly.in/question/13374651

-Wilson Middle School wants to rent tables for their weeklong art festival. One rental company charges a $20 setup
fee and $12 per table for the week. Another rental company charges a $30 setup fee and $10 per table for the week.
How many tables can the school rent for the charge to be the same for both companies?

Answers

Answer:

5 tables

Step-by-step explanation:

Let x be the number of tables the school needs to rent, and c be the total cost of renting the tables.

We can use the following equation to represent the cost of renting from the first company:

c = 20 + 12x

And we can use the following equation to represent the cost of renting from the second company:

c = 30 + 10x

As c is the same constant in both equations, we can say the following:

20 + 12x = 30 + 10x

Now we can solve this equation by simplifying:

20 + 12x = 30 + 10x

20 + 2x = 30

2x = 10

x = 5

Therefore, the school will need to rent 5 tables for the cost to be the same from both renting companies.

Answer: 5 tables

Step-by-step explanation:

The first rental company will charge $32 for one table.

The second rental company will charge $40 for one table.

So if we make a table, and keep adding $12 to the first company and $10 to the second it will look like this.

First company                          Second company                   Table

 $32                                                  $40                                     1

 $44                                                  $50                                     2

 $56                                                  $60                                     3

 $68                                                  $70                                     4

 $80                                                  $80                                     5

Therefore, the school can rent 5 tables for the same price in both companies.

A quadratic function y=f(x) is plotted on a graph and the vertex of the resulting parabola
(−4,−5). What is the vertex of the function defined as g(x)= f(-x)−4?

Answers

Answer:

(-2,6)

Step-by-step explanation:

y=f(x) has vertex (-4,6)

g(x)=-f(x-2) shifts the graph 2 units to the right, not to the left, and the graph is reflected over the x-axis

therefore the vertex is (-2,6) and the reflection over the x-axis has no affect on the vertex

for my homework i need to factorise 14x^2-x-3

Answers

Answer:

the factorisation of 14x^2 - x - 3 is (7x + 3)(2x - 1).

Step-by-step explanation:

To factorise the quadratic expression 14x^2 - x - 3, we can use the following steps:

Look for two numbers that multiply to 14 and add to -1. The numbers we need are -7 and 2.Write the expression as a product of two binomials: (14x^2 - 7x) + (-x - 3).Now, we use the difference of squares factorization to separate the middle term: (7x + 3)(2x - 1).Check our answer by multiplying the two binomials together and comparing the result to the original expression.

So, the factorisation of 14x^2 - x - 3 is (7x + 3)(2x - 1).

Answer:

Step-by-step explanation:

14×14-×-3

196-×-3=196-3

=193

julie buys a bike for $2700 and sells it a year later, making a 15% profit
How much profit did Julie make?

Answers

Answer:

$405.

Step-by-step explanation:

That would be 15% of $2700

= 2700 * 0.15

= $405

Tanner is 2 years younger than his

brother. Tanner's age t in years is 2

less than his brother's age b.

dependent variable:

independent variable:

equation:

Answers

The equation will be:

t = b - 2

And we can see that:

independent variable = brother's age.dependent variable = Tanner's age.

How to identify the variables?

Here we have two variables:

t = taner's age

b = age of Tanner's brother.

The independent variable is the one that does not depend on the other, in this case (for how it is worded) is the brother's age.

The dependent variable depends on the other, on this case, Tanner's age.

Now let's write the equation, we know that Taner's age is 2 years less than his brother, then:

t = b - 2

That is the equation.

Learn more about independent variables at:

https://brainly.com/question/25223322

#SPJ1

Rewrite the following equation in slope-intercept form.

y + 6 = 9(x − 8)


Write your answer using integers, proper fractions, and improper fractions in simplest form.

Answers

Slope intercept: y=9x-78

Where appropriate give answers to 3 s. F


Dylan kicks a rugby ball. Its height, hm, is given by


h = 20t - 5t(square)+ 1 where is the time in seconds after the kiek


a When is the ball 10 m above the ground?


When does the ball land?

Answers

a. The time when the rugby ball is 10 m above the ground is 3.48 or 0.525 seconds.

b. The time when the rugby ball would land is 4.05 seconds.

How to determine the time when the rugby ball is 10 m above the ground?

Based on the information provided, we can logically deduce that the height (h) in meters, of this rugby ball above the​ ground is related to time (t) by the following quadratic function:

h(t) = 20t - 5t² + 1

Part a.

In order to determine the time when the rugby ball is 10 m above the ground, we would substitute the value h = 10 into the height function above as follows;

h(t) = 20t - 5t² + 1

10 = 20t - 5t² + 1

5t² - 20t + 10 - 1 = 0

5t² - 20t + 9 = 0

\(t=\frac{20 \pm \sqrt{220} }{10}\)

Time, t = 3.48 or 0.525 seconds.

Part b.

Next, we would determine the time when the ball would land by setting the height function to zero (0) as follows;

h(t) = 20t - 5t² + 1

0 = 20t - 5t² + 1

5t² - 20t - 1 = 0

\(t=\frac{20 \pm \sqrt{420} }{10}\)

Time, t = 4.05 seconds.

Read more on time here: brainly.com/question/26746473

#SPJ4

if the cross-price elasticity of demand for two goods is 1.25, then:________

Answers

If the cross-price elasticity of demand for two goods is 1.25, then the two goods are substitutes.

Cross Price Elasticity of Demand:

The cross elasticity of demand is an economic concept that measures the response of the quantity demanded of one good to changes in the price of another good. Also known as the cross-price elasticity of demand, this measure is calculated by dividing the percentage change in quantity demanded for one good by the percentage change in price of another commodity.

\(E_X_Y\) = \(\frac{Percentage change in Quantity of X }{Percentage Change in Quantity of Y}\)

\(E_X_Y\) = ΔQ/Q ÷ ΔP/P

       = ΔQ/Q × P/ΔP

       = ΔQ/ΔP × P/Q

where:

Q = Quantity of good X

P = Price of good Y

Δ = Change

​The cross elasticity of demand for a substitute is always positive because an increase in the price of a substitute increases the demand for one good. For example, when the price of coffee rises, the demand for tea (alternative beverage) increases as consumers switch to cheaper but alternative beverages. This is reflected in the formula for the cross-elasticity of demand, as the numerator (the percentage change in demand for tea) and the denominator (the price of coffee) represent positive increases.

Items with a coefficient of 0 are unrelated and independent products. Commodities can be weak substitutes for which both products are positive but have a low cross-elasticity of demand. This is often the case with various alternative products such as tea or coffee. Commodities that are strong substitutes have a higher cross-elasticity of demand. Consider a different brand of tea. An increase in the price of green tea from one company has a greater impact on the demand for green tea from the other company.

The cross elasticity of demand is 1.25. Positive cross elasticity means that when the price of one good changes, the quantity demanded of another good changes in the same direction. For example, when the price of one good increases, the demand for another good increases.

This indicates that the two products are fungible. When the price of a product rises, consumers will prefer the cheaper product. As a result, the demand for alternatives will increase.

Learn more about Substitute:

https://brainly.com/question/13058734

#SPJ4

From midnight to 7:00 am, the temperature dropped 0.8°C

temperature at 7:00 am was 4.4 deg * C what was the temperature at midnight?

Answers

Answer:

5.2

Step-by-step explanation:

add back 0.8 from 7 am temp which is 4.4 degrees.

Answer:

5.2 °C

Step-by-step explanation:

4.4°C + 0.8°C = 5.2°C

Number Theory:
Is 41 a square modulo 1 000 000?
Hint: The congruence x2 ≡ 41 mod 106 has a solution if and only if both congruences x2 ≡ 41 mod 26 and x2 ≡ 41 mod 56 have solutions

Answers

After considering all the given data we conclude that yes  41 is a square modulo 1 000 000, under the condition that both congruences x₂ ≡ 41 mod 26 and x₂ ≡ 41 mod 56 have solutions.

We can apply the Chinese Remainder Theorem (CRT) to solve this problem.

Firstly, we have to evaluate the solutions of x² ≡ 41 mod 26 and x² ≡ 41 mod 56.

For x² ≡ 41 mod 26, we clearly see that x² ≡ 15 mod 26 is a solution since 15² = 225 ≡ 41 mod 26.

For x² ≡ 41 mod 56, we can apply the fact that x² ≡ a mod p has solutions if and only if \(a^{(P-1)} /2\) ≡ 1 mod p (Euler's criterion).

Since p = 56 = 7 × 8, we have:

\(a^{(p-1)} /2\) = a²¹ ≡ (a⁷)³ ≡ (-1)³ ≡ -1 mod p

Hence, x² ≡ 41 mod 56 has no solutions.

Now we can apply CRT to find the solutions of x² ≡ 41 mod (26 × 56) = 1456.

Since gcd(26,56) = 2, we have:

26 × u + 56 × v = gcd(26,56) = 2

Evaluating  this equation gives us u = -13 and v = 6.

So, the solutions of x² ≡ 41 mod (26 × 56) are:

x ≡ (15 × 56 × 6 - (-13) × 26 × (-1)) mod (26 × 56) = 937 or

x ≡ (-15 × 56 × 6 - (-13) × (-26) × (-1)) mod (26 × 56) = 519.

Hence, there are two solutions for x modulo one million: 519 and 481.

To learn more about Chinese Remainder Theorem

https://brainly.com/question/30806123

#SPJ1

There is a probablity of ____ that any individual at a random from
a population will fall (plus or minus) one standard deviation of
the mean.

Answers

Step-by-step explanation:

I hope this answer is helpful ):

There is a probablity of ____ that any individual at a random froma population will fall (plus or minus)

A line’s y intercept is 3 , & its slope is 8 . What is its equation in slope-intercept form ?

Answers

Answer:

y = 8x + 3

Step-by-step explanation:

Slope intercept form: y = mx + b

here, m is the slope and b is the y-intercept.

      m = 8 and b = 3

          y = 8x + 3

Evaluating functions
Linear and quadratic or cubic

Evaluating functions Linear and quadratic or cubic

Answers

Answer:

f(3) = -39g(-6) = -28

Step-by-step explanation:

You want f(3) and g(-6) when f(x) = -4x² -3 and g(x) = 5x +2.

Function evaluation

To find the value of the function for a particular value of the variable, put that value in place of the variable and do the arithmetic.

  f(3) = -4(3²) -3 = -4(9) -3 = -36 -3

  f(3) = -39

  g(-6) = 5(-6) +2 = -30 +2

  g(-6) = -28

__

Additional comment

Your calculator can help with the arithmetic.

Evaluating functions Linear and quadratic or cubic

I NEED AN ANSWER ASAP PLEASE

I NEED AN ANSWER ASAP PLEASE

Answers

Step-by-step explanation:

the correct answer is option a 6a-7

Other Questions
Find the average value of 4(x + 1) f(x) = x2 over the interval [2; 4] (6) 3.2 The velocity of a bullet from a rifle can be approximated by v(t) = 6400t2 6505t + 2686 where t is seconds after the shot and v is the velocity measured in feet per second. This equation only models the velocity for the first half-second after the shot. What is the average velocity of the first half second? 120 bacteria in a petri dish double every 30 minutes. Write equation for number of bacteri after x hours you are a salesperson for a company that sells a home bible study program. during your prospecting stage, you decide to contact rev. cleo larue, a strong religious leader in the community, in order to get his endorsement of you and your product and hopefully the names of prospects. you are using the method of prospecting known as What are good filmson the concept of what goes around comes around sammy indicated his love for his mother by approaching her whenever he wanted to be comforted Find the equation of the tangent(s) to the curve at the given point. Then graph the curve and tangent(s)x = 6 sin(t), y = t + t ; (0,0) Which of the following statements aligns more with a growth mindset rather than a fixed mindset?(Check all that apply)a.) I'll work even harder than beforeb.) We can better ourselvesc.) Good, I'm learning Use these formulas to determine the cost of each of these appliances of devices over a given period of time. One of your classes at school takes place in the computer lab. you work on an assignment for an hour. the school lab has old desktop computers that use 100 watts/hour and large crt (tube) monitors that use 75 watts/hour. For the point P(-24,23) and QC - 17,28), find the distance d(P,Q) and the coordinates of the midpoint M of the segment PQ. What is the distance? Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG It is important to build credibility by citing sources. Business writers follow a narrative pattern in business documents. Which of the following examples is the best way to build your credibility in a business document? a) Only 57 percent of American adults have basic financial literacy skills, putting it in 4th place among nations with advanced economies. b) Standard and Poor's 2014 study on global financial literacy found that only 57 percent of American adults had basic financial skills, putting the U.S. 4th among nations with advanced economies. c) A study on the financial literacy among American adults show that the U.S. ranks 4th among 144 nations. I need some help. Can you help me answer this question? Calculate the cash surrender value for Lee Chin, age 39, who purchased a $280,000 20-year endowment policy. At the end of year 10, Lee stopped paying premiums. (Use Table 20.2.)Note: The answer is NOT 140,000 Hideo and Hannah decide to go on a vacation. As a result, they withdraw $5,000 from their savings account to purchase $5,000 worth of traveler's checks. As a result of these changes,a.M1 increases by $5,000 and M2 decreases by $5,000.b.M1 decreases by $5,000 and M2 increases by $5,000.c.M1 increases by $5,000 and M2 stays the same.d.M1 and M2 stay the same. did you receive any distributions from a retirement plan after 2014? 9, 13, 17, 21, 25,...What is the common difference?What is the value of the first term?Write a simplified expression for the right half of the equation that canthbe used to find the n term in the sequence.an insulin, which controls blood sugar levels, is a hormone produced by the pancreas. individuals with type 1 diabetes have an autoimmune disorder that destroys the cells in their --pancreas that produce insulin. why would it be beneficial to use genetically modified organisms (gmos) to produce insulin? please choose the correct answer from the following choices, and then select the submit answer button. answer choices only genetically modified organisms produce insulin. type 1 diabetics require insulin on a daily basis. it would prove that scientists can produce useful products from genetically modified organisms. it would not be beneficial because other tissues contain the genes to produce insulin and will take over this role if the pancreas is destroyed. Picnics R Us (PRU) is a small catering firm with five employees. During a typical summer weekend, PRU caters 15 picnics with 20 to 50 people each. The business has grown rapidly over the past year, and the owner Suzie White wants to install a new information system for managing the ordering and buying process. PRU has a set of 10 standard menus. When potential customers call, the receptionist describes the menus to them. If the customer decides to book a picnic, the receptionist records the customer information (name, address, phone number, etc.) and the information about the picnic (e.g., place, date, time, standard menus, their quantities and total price) on a contract. The customer is then faxed a copy of the contract. Sometimes, the customer accepts the price; other times, the customer requests some changes, which have to go back to the owner for a new cost estimate. The customer must sign and return the contract along with a deposit (often by a credit card or check) before the picnic is officially booked. The remaining money is collected when the picnic is delivered. Each week, the owner looks through the picnics scheduled for that weekend and orders supplies (e.g., plates) and food (e.g., bread, chicken) needed to make them. The owner would like to use the system for marketing as well. The system should help track how customers learned about PRU and identify repeat customers so that PRU can mail special offers to them. The owner also wants to track the picnics on which PRU sent a contract or actually booked a picnic. Given the above information, please do the following:1. Identify the main entities (min 10 entities excluding any associative entities). You should use them in steps 2 and 3.2. Based on the business description identify all the relationships between entities and write relevant business rules that explain each relationship (As all relationships are bidirectional, make sure to articulate business rules both ways for each link in the final fully attributed data model). Make suitable assumptions for any missing details.3. Create fully attributed data model (Entity Relationship Diagram) based on Crows foot notation in MS Visio. You should also provide correct cardinality at both ends of each relationship i.e., (0,M / 1,M / 0,1 / 1,1) using Crows foot notation. For any non-specific (M:N) relationships identified between entities, you should resolve them by adding associative entities in your data model.The current answer to this question on the site is not right I don't believe A popular type of music radio program in the late 1920s wasA. The Nashville jubilee B. The honky-think singalongC. The opera showD. The barn dance show how many word files are in the gcfi-osx.001 image? what or who is the subject of the first message from jim shu? sebastian jim shu superior bicycles free tools what phone number had the most search results? 602-839-2763 800-810-0595 662-656-5045 859-232-2380 the ext3 file system is used in mac os x. true or false? who sent the last e-mail to jim shu? martha dax sebastian mwangonde nau tjeriko bart johnson