A home and garden store sells small and large plants. The store sells 6 small plants for a total of $22.20 and 3 large plants for a total of $115. 80. The price of each type of plant is proportional to the number of each type of plant sold.

Answers

Answer 1

The price of small plants is $3.70 each, and the price of large plants is $38.60 each.The prices are proportional to the number of each type of plant sold.

To determine the price of each type of plant, we need to find the cost per plant. Let's assume the price of each small plant is x, and the price of each large plant is y.

According to the given information, 6 small plants are sold for a total of $22.20. This can be expressed as the equation:

6x = $22.20

Dividing both sides of the equation by 6, we get:

x = $22.20 / 6

x = $3.70

So, the price of each small plant is $3.70.

Similarly, 3 large plants are sold for a total of $115.80. This can be expressed as the equation:

3y = $115.80

Dividing both sides of the equation by 3, we get:

y = $115.80 / 3

y = $38.60

So, the price of each large plant is $38.60.

In summary, the store sells small plants for $3.70 each and large plants for $38.60 each. The prices are proportional to the number of each type of plant sold.

Learn more about proportional here: brainly.com/question/33460130

#SPJ11


Related Questions

solve for X. Assume that lines which appear tangent are tangent

solve for X. Assume that lines which appear tangent are tangent

Answers

Answer:

C

Step-by-step explanation:

A randomly sampled group of patients at a major U.S. regional hospital became part of a nutrition study on dietary habits. Part of the study consisted of a 50‑question survey asking about types of foods consumed. Each question was scored on a scale from one: most unhealthy behavior, to five: most healthy behavior. The answers were summed and averaged. The population of interest is the patients at the regional hospital. A prior study conducted at the hospital showed that averaging scores over 50 questions produces a Normal population distribution.

If we obtain a sample of =15n=15 subjects and wish to calculate a 95% confidence interval, the critical value ∗t∗ is:

Answers

The critical value (t*) for a 95% confidence interval with a sample size of n = 15 = ≈ 2.145

We can be determined using a t-distribution table or a statistical calculator with the appropriate degrees of freedom.

For a sample size of n = 15,

the degrees of freedom (df) for a t-distribution = (n - 1), which in this case would be (15 - 1) = 14.

Using a t-distribution table or a statistical calculator,

the critical value (t*) for a 95% confidence interval with df = 14 = ≈ 2.145.

What is a critical value?

In statistics, a critical value is a cutoff point used in hypothesis testing or constructing confidence intervals. It is used to determine whether a test statistic falls in the critical region, which would lead to the rejection of the null hypothesis.

For example, in the above case of a confidence interval, a critical value can be used to determine the margin of error or the range within which the true population parameter is likely to fall with a certain level of confidence.

Read more about critical value at brainly.com/question/31529408

#SPJ1

A married couple and their 5 children buy tickets to a ball game. The tickets
cost 20 dollars apiece, but each of their children gets a 15 percent discount.
How much does the family pay to go to the game?

Answers

Answer:

Price of an adult ticket: $25

Price of a child's ticket is 25-0.20(25) = $20

Total cost = 2 adult tickets + 4 child tickets

= 2(25)+4(20)

= 50+80 = $130

Price of an adult ticket: $20

Price of a child's ticket is \(20-0.15(20) = \$17\)

\(\text{Total cost = 2 adult tickets + 5 child tickets}\)

\(= 2(20)+5(17)\)

\(= 40+85 = \bold{\$125}\)

Pleaseeee help
Given that one standard deviation below the mean is 24 and one standard deviation above the
mean is 31, what is the Mean?

A)55
B)34
C)27.5
D)28

Answers

Answer:

C. 27.5

Step-by-step explanation:

since 24 and 31 are one standard deviation below or above the mean, we could subtract the two values and divide them by two to help find the mean.

we would first subtract the two values

31-24 = 7

we would then divide that number by 2 since we are finding the average between the two numbers

7/2 = 3.5

using the 3.5, you add it to the lower value (24) and subtract it from the higher value (31)

24+3.5 = 27.5

31-3.5 = 27.5

since both calculated numbers were equal, we know that we calculated the mean correctly.

Deux pays​ , le Pays Chaud et le Pays​ Froid, mènent des​ enquêtes sur les​ dépenses de consommation. Au Pays Chaud​ , les consommateurs​ achètent 60 bouteilles​ d'eau, 16 kilos de pain et 8 litres​ d'huile d'olive par​ année. Au Pays​ Froid, les consommateurs​ n'achètent aucune bouteille​ d'eau (ils sucent des​ glaçons qui ne leur​ coûtent rien), mais ils​ achètent 84 litres​ d'huile d'olive et 29 kilos de pain par​ année. Les prix dans les deux pays sont les​ mêmes, et​ mesurés avec la​ même monnaie, le dollar. Dans​ l'année de​ base, l'eau​ embouteillée coûtait 0,95 ​$ la​ bouteille, le​ pain,4,80​$ le​ kilo, et​ l'huile d'olive,10,35 ​$ le litre. Dans​ l'année courante,​ l'eau embouteillée​ coûte 1,95 ​$ la​ bouteille, le​ pain,6,30 ​$ le​ kilo, et​ l'huile d'olive, 11,20 ​$ le litre. Quel est​ l'IPC au Pays Chaud dans​ l'année courante?

Answers

If you write in english language maybe i can help you

This table shows how much each type of meat costs at a local deli.
Type of Meat Price per Pound
Ham $5.99
Turkey $4.99
roast beef $6.99
salami $2.99
bologna $3.99
A customer purchased 1/ 4 pound of ham, 1 1/2 pounds of turkey, 1 pound of roast beef, and
3/ 4 pound of bologna. Approximately what will the customer pay before taxes

Answers

5.99 • .25 = 1.50
4.99 • 1.5 = 7.48
6.99 • 1 = 6.99
3.99 • 0.75 = 2.99
The costumer will pay approximately $18.96 before taxes.

The price that the customer pay before taxes is $18.965.

What is Multiplication?

Multiplication of two numbers is defined as the addition of one of the number repeatedly until the times of the other number.

a × b means that a is added to itself b times or b is added to itself a times.

Given a table which shows the unit price of the meat at a local deli.

A customer purchased 1/ 4 pound of ham, 1 1/2 pounds of turkey, 1 pound of roast beef, and 3/ 4 pound of bologna.

In order to get the price of each meat, multiply unit price with the amount that the customer buy.

Total price = (1/4 × $5.99) + (3/2 × $4.99) + (1 × $6.99) + (3/4 × $3.99)

                  = $18.965

Hence the total price paid is $18.965.

Learn more about Multiplication here :

https://brainly.com/question/29174867

#SPJ3

evaluate the expression 5 3 =

Answers

Answer:

Do you mean to multiply? you don't have any sign. if you meant multiply its 15, if you meant divide it's 1 2/3, if it's addition it's 8, if its subtraction it's 2

If t is a number between 6 and 9, t+5 is between what two numbers?

Answers

Answer:

11 and 14

Step-by-step explanation:

t can be 7 or 8

7+5=12

8+5=13

12 and 13 are between 11 and 14

The number t + 5 is in between 11 and 14.

What is an inequality?

"It is a mathematical statement of an order relationship (greater than, greater than or equal to, less than, or less than or equal to) between two numbers or mathematical expressions."

What is addition property of inequality?

" Let x, y, and z be real numbers.

If x > y, then x + z > y + z."

For given question,

t is a number between 6 and 9.

So, we have an inequality.

⇒ 6 < t < 9

By addition property of inequality,

⇒ 6 + 5 < t + 5 < 9 + 5

⇒ 11 < t + 5 < 14

Therefore, the number t + 5 is in between 11 and 14.

Learn more about the inequality here;

https://brainly.com/question/19003099

#SPJ2

COMPLETE THE STATEMENT. round to the nearest hundredth if necessary.

COMPLETE THE STATEMENT. round to the nearest hundredth if necessary.

Answers

Answer:

1.13

Step-by-step explanation:

check attached file

COMPLETE THE STATEMENT. round to the nearest hundredth if necessary.

Answer: 1.13

Step-by-step explanation:

Rounded to nearest hundredth it is 1.13

17gal/1h ?qt/min

convert gal to quarts and hours to mins to get same units

17 gallons = 68 quarts

1 hour = 60 mins

68/60=x/1

solve as normal..

true/false: monte carlo techniques use random samples for evaluating the integrals and compute average.

Answers

The given statement "Monte Carlo techniques use random samples for evaluating the integrals and compute the average" is true.

Monte Carlo simulation is a technique that uses random samples to evaluate integrals and compute averages. It is used in numerous fields, including physics, engineering, and finance, to produce a wide range of potential outcomes based on probabilistic modeling. The Monte Carlo approach is based on the principle of generating random samples from a given probability distribution and then calculating the averages of a function of these samples to approximate the integral.

The technique is commonly used to compute multidimensional integrals that are too difficult to calculate analytically. Therefore, the given statement is true because Monte Carlo techniques use random samples to evaluate integrals and compute averages.

To know more about integrals visit:

https://brainly.com/question/31433890

#SPJ11

How much is 111 kilograms in pounds ?

Answers

243.28 pounds are equal to 111 kilogram. Take the quantity of kilos and multiply it by 2.20462 to convert it to pounds.

2.20462 pounds make up a kilogram.

243.28 pounds are equal to 111 kilogram(111 x 2.20462).

243.28 pounds are equal to 111 kilos. There is an easy formula that can be used to compute this. Take the quantity of kilos and multiply it by 2.20462 to convert it to pounds. For instance, multiplying 111 by 2.20462 would result in converting 111 kilos to pounds. They would receive 243.28 as a result, which is 111 kg in pounds. With this formula, you can easily change kilos into pounds. Any amount of kilos can be swiftly and precisely converted to pounds using this method.

Learn more about kilogram here

https://brainly.com/question/28844288

#SPJ4

5(x-4)+?=+12x-21 what is the answer?

Answers

5(x-4) + ? = 12x - 21

5x - 20 + ? = 12x - 21

? = 7x -1  

ok done. Thank to me :>

Give the following non-linear equation: z = x² + 4xy + 6xy² 1.1. Linearize the following equation in the region defined by 8 ≤x≤10,2 ≤y ≤4. (8) 1.2. Find the error if the linearized equation is used to calculate the value of z when x = 8, y = 2.

Answers

The linearized equation for the non-linear equation z = x² + 4xy + 6xy² in the region defined by 8 ≤ x ≤ 10, 2 ≤ y ≤ 4 is given by :

z ≈ 244 + 20(x - 8) + 128(y - 2).

When using the linearized equation to calculate the value of z at x = 8, y = 2, the error is 0.

1.1. To linearize the equation in the given region, we need to find the partial derivatives of z with respect to x and y:

∂z/∂x = 2x + 4y

∂z/∂y = 4x + 6xy

At the point (x₀, y₀) = (8, 2), we substitute these values:

∂z/∂x = 2(8) + 4(2) = 16 + 8 = 24

∂z/∂y = 4(8) + 6(8)(2) = 32 + 96 = 128

The linearized equation is given by:

z ≈ z₀ + ∂z/∂x * (x - x₀) + ∂z/∂y * (y - y₀)

Substituting the values, we get:

z ≈ z₀ + 24 * (x - 8) + 128 * (y - 2)

1.2. To find the error when using the linearized equation to calculate the value of z at x = 8, y = 2, we substitute these values:

z ≈ z₀ + 24 * (8 - 8) + 128 * (2 - 2)

= z₀

Therefore, the linearized equation gives the exact value of z at x = 8, y = 2, and the error is 0.

To learn more about linearized equation visit : https://brainly.com/question/2030026

#SPJ11

You are walking to the park and see several children and dogs running around. You count 19
heads and 52 legs. How many children did you see? How many dogs did you see?

Answers

MINECRAFT > FORTNITE
You are walking to the park and see several children and dogs running around. You count 19heads and 52

Answer:

13 dog's and 6 children

Step-by-step explanation:

Suppose IQ scores were obtained for randomly selected sets of . The pairs of measurements yield , , r , P-value 0.000, and , where x represents the IQ score of the . Find the best predicted value of given that the has an IQ of ?

Use a significance level of 0.05. 20 siblings 20 x=99.42 y=97.2 =0.867 = = −21.33+1.19x y older child y older child 97 Click the icon to view the critical values of the Pearson correlation coefficient r.1 The best predicted value of is . y (Round to two decimal places as needed.) Critical Values of the Pearson Correlation Coefficient r n 0.05 α = 0.01 α = NOTE: To test H0 : 0 against H1: 0, reject H0 if the absolute value of r is greater than the critical value in the table. rho= rho≠4 0.950 0.990 5 0.878 0.959 6 0.811 0.917

Answers

The best predicted value given that a person has an IQ of 91 is 94.03.

Here, we are given that-

sample size n = 20

sample mean for the independent value x = 100.39

sample mean for the dependent value y = 103.6

coefficient of correlation r = 0.925

The general expression for representing a linear model is given by-

y = β₀ + β₁x

where β₀ is the intercept and β₁ is the slope

For the above given case, the linear model will be given as-

y = -3.34 + 1.07x

where -3.34 is the intercept and 1.07 the slope.

To find the best predicted value when X = 91, we substitute the value of x as 91 in the equation as follows-

y = -3.34 + 1.07(91)

y = 94.03

Thus, the best predicted value given that a person has an IQ of 91 is 94.03.

Learn more about estimation here-

https://brainly.com/question/15712887

#SPJ4

There are 30 singers in a show. The ratio of singers to dancers is 5:6. How many dancers are there?

Answers

Answer:

36 dancers

Step-by-step explanation:

There are 36 dancers because if you notice that the 30 was simplified to 5 so you divided and 30 + 6 would give you 36

Evaluate the integral: S1 0 (-x³ - 2x² - x + 3)dx

Answers

The integral: S1 0 (-x³ - 2x² - x + 3)dx is -1/12

An integral is a mathematical operation that calculates the area under a curve or the value of a function at a specific point. It is denoted by the symbol ∫ and is used in calculus to find the total amount of change over an interval.

To evaluate the integral:

\($ \int_0^1 (-x^3 - 2x^2 - x + 3)dx $\)

We can integrate each term of the polynomial separately using the power rule of integration, which states that:

\($ \int x^n dx = \frac{x^{n+1}}{n+1} + C $\)

where C is the constant of integration.

So, we have:

\($ \int_0^1 (-x^3 - 2x^2 - x + 3)dx = \left[-\frac{x^4}{4} - \frac{2x^3}{3} - \frac{x^2}{2} + 3x\right]_0^1 $\)

Now we can substitute the upper limit of integration (1) into the expression, and then subtract the result of substituting the lower limit of integration (0):

\($ \left[-\frac{1^4}{4} - \frac{2(1^3)}{3} - \frac{1^2}{2} + 3(1)\right] - \left[-\frac{0^4}{4} - \frac{2(0^3)}{3} - \frac{0^2}{2} + 3(0)\right] $\)

Simplifying:

\($ = \left[-\frac{1}{4} - \frac{2}{3} - \frac{1}{2} + 3\right] - \left[0\right] $\)

\($ = -\frac{1}{12} $\)

Therefore,

\($ \int_0^1 (-x^3 - 2x^2 - x + 3)dx = -\frac{1}{12} $\)

To learn more about substituting visit:

https://brainly.com/question/10423146

#SPJ11

A circular grassy area of(172 square
feet is being watered by a sprinkler
set in the middle. How far does the
water spray from the sprinkler as it
rotates? Round your answer to the
nearest foot.

Answers

The distance the water sprays as the sprinkler rotates is 7.34 ft

Since the grassy area is circular, its area is the area of a circle.

Area of a circle

So, A = πr² where r = radius of circle = distance sprinkler sprays

The distance the water sprays

Making r subject of the formula, we have

r = √(A/π)

Since A = 172 ft², substituting the values of the variables into the equation, we have

r = √(A/π)

r = √(172 ft²/π)

r = √(172 ft²/3.142)

r = √(54.749 ft²)

r = 7.34 ft

So, the distance the water sprays as the sprinkler rotates is 7.34 ft

Learn more about area of a circle here:

https://brainly.com/question/12269818

On a coordinate plane, a curved line labeled f of x with a minimum value of (1.9, negative 5.7) and a maximum value of (0, 2), crosses the x-axis at (negative 0.7, 0), (0.76, 0), and (2.5, 0), and crosses the y-axis at (0, 2).
Which statement is true about the graphed function?

F(x) < 0 over the intervals (-∞, -0.7) and (0.76, 2.5).
F(x) > 0 over the intervals (-∞, -0.7) and (0.76, 2.5).
F(x) < 0 over the intervals (-0.7, 0.76) and (2.5, ∞).
F(x) > 0 over the intervals (-0.7, 0.76) and (0.76, ∞)

Answers

The correct statement is that F(x) < 0 over the intervals (-0.7, 0.76) and (2.5, ∞).

What is value?

Value of subjective concept that refers to the word of important that an individual group of people places on the something it is often associated with principal beliefs and the standard that are accepted by society when you can be seen as a matter of how important something is true person of organization it is often seen as a reflection of funds for view and can help to save decision.

This can be seen by looking at the function's minimum and maximum values and its points of intersection with the x- and y-axes. The minimum value of (1.9, negative 5.7) is to the left of the x-axis, indicating that the function is negative over the interval (-0.7, 0.76). The maximum value of (0, 2) is above the x-axis, indicating that the function is negative over the interval (2.5, ∞).

To know more about value click-
https://brainly.com/question/25184007
#SPJ1

1089
141°
Next Question
Check Answer

1089141Next QuestionCheck Answer

Answers

Answer:

The answer is that x is equal to 33⁰

Solve the system: x + 3y - 2z = 1 2x + y + 3z = 20 2x - 2y + z = 6 Write the values for x, y, and z as a three-digit number without spacing for your answer.

Answers

The values for x, y, and z are 95, -9, and -21, respectively, resulting in a three-digit number: 95-9-21 = 95921.

To solve the system of equations:

x + 3y - 2z = 1

2x + y + 3z = 20

2x - 2y + z = 6

By the use of the method of Gaussian elimination or matrix algebra. Here, the Gaussian elimination:

1. Multiply equation 1 by 2 and subtract equation 3:

2(x + 3y - 2z) - (2x - 2y + z) = 2 - 6

2x + 6y - 4z - 2x + 2y - z = -4

8y - 5z = -4

2. Multiply equation 1 by 2 and subtract equation 2:

2(x + 3y - 2z) - (2x + y + 3z) = 2 - 20

2x + 6y - 4z - 2x - y - 3z = -18

5y + z = -18

3. Rearrange equation 2:

2x + y + 3z = 20

2x + 2y + 6z = 40

4. Subtract equation 3 from equation 2:

(2x + 2y + 6z) - (5y + z) = 40 - (-18)

2x + y + 5y + 6z - z = 58

2x + 6y + 5z = 58

Now we have a new system of equations:

8y - 5z = -4

5y + z = -18

2x + 6y + 5z = 58

We can solve this system using any method of our choice. In this case, solving the system yields:

x = 95

y = -9

z = -21

Therefore, the values for x, y, and z are 95, -9, and -21, respectively, resulting in a three-digit number: 95-9-21 = 95921.

To learn more about Gaussian elimination from the given link

https://brainly.com/question/30528045

#SPJ4

Make and test a conjecture about the quotient of a number and its reciprocal the quotient of a number and its reciprocal is?

Answers

We conclude that the conjecture that the quotient of a number and its reciprocal is always equal to 1 is not correct.

How to determine if the conjecture that the quotient of a number and its reciprocal is always equal to 1

Conjecture: The quotient of a number and its reciprocal is always equal to 1.

To test this conjecture, let's consider a specific number, x, and its reciprocal, 1/x.

According to the conjecture, the quotient of x and its reciprocal should be 1.

Let's perform the calculation:

\(x / (1/x) = x * x/1 = x^2\)

Based on the calculation, we see that the quotient of x and its reciprocal simplifies to x^2, not necessarily equal to 1. Therefore, the conjecture is not true in general.

Hence, we conclude that the conjecture that the quotient of a number and its reciprocal is always equal to 1 is not correct.

Learn more about conjecture at https://brainly.com/question/14392383

#SPJ4

8 (3f - g) when f = 9 and g = -3​

Answers

Answer:

168

Step-by-step explanation:

Given Information

f = 9

g = -3

__________________

Substitute 9 and -3 with f and g

= 8 (3*9 - -3)

= 8 (18 - -3)

= 8 x 21

= 168

Divide.
30)1777 30)1777

Answers

Answer:

434433444444444446666%$"$$$

777776657838737262$&&$

A shopper pays $1,014 for a $975 carousel horse after sales tax is added. What is the sales
tax percentage?
Write your answer using a percent sign (%).
Vic

Answers

Answer:

4%

Step-by-step explanation:

Final Price = 1014

Initial Price = 975

SALES TAX FORMULA: (Final/Initial Price - 1) * 100 = ANSWER

(1014/975 - 1)* 100 = 4%

An island has three villages and the total number of males is 75. The first village has 20 males and 25 females. The second village has 50 people of whom 30 are males. The third village has 30 females.

Answers

There are 25 males in village 3

The number of males in the third village?

The given parameters are:

Total males = 75

                 Male     Female   Total

Village 1   20              25

Village 2  30                            50

Village 3                     30

Total         75

The number of male in village 3 is calculated using:

Male = Total Male - Male in villages 1 and 2

So, we have:

Male = 75- (20 + 30)

Evaluate

Male = 25

Hence, there are 25 males in village 3

Read more about equations at:

https://brainly.com/question/2972832

#SPJ1

Complete question

An island has three villages and the total number of males is 75. The first village has 20 males and 25 females. The second village has 50 people of whom 30 are males. The third village has 30 females.

Calculate the number of male in third village

What are the missing segment lengths shown in the image?

What are the missing segment lengths shown in the image?

Answers

The length of the missing ,line segments show in the image are AC = CD =  10√2  and AB = BC = 10  .

In the question ,

a figure is given , we have to find the length of the missing line segments .

From the given figure

the Δ ACD is a right triangle ,

given that ∠A and ∠D are equal

so ,  their corresponding length AC and CD will be equal , that is AC = CD

So , By Pythagoras Theorem

AC² + CD² = AD²

2*AC² = AD²

2*AC² = (20)²

2*AC² = 400

AC² = 400/2 = 200

AC = √200

AC = CD = 10√2

The triangle ABC is also right triangle

and ∠A and ∠C are equal

so , their corresponding length AB and BC will be equal , that is AB = BC

So , By Pythagoras Theorem

AB + BC = AC

2*AB² = AC²

2*AB² = (10√2)²

2*AB² = 200

AB² = 200/2 = 100

AB = √100

AB = 10 = BC

Therefore , The length of the missing line segments show in the image are AC = CD =  10√2  and AB = BC = 10  .

Learn more about Triangles here

https://brainly.com/question/21926466

#SPJ1

Lamont has purchased 20 trading cards and wants to have at least 50 trading cards. Write and solve an inequality to nd the number of trading cards Lamont needs. Select all of the true statements.

Answers

Given:

Lamont has purchased 20 trading cards.

He wants to have at least 50 trading cards.

To find:

The inequality for the number of trading cards Lamont needs and solve it.

Solution:

Let x be the number of trading cards Lamont needs.

He has 20 trading cards. So,

Total cards = x + 20

It is given that, he wants to have at least 50 trading cards. It means, total card must be greater than or equal to 50.

\(x+20\geq 50\)

Subtract 20 from both sides.

\(x+20-20\geq 50-20\)

\(x\geq 30\)

Therefore, the required inequality is \(x+20\geq 50\) and solution is \(x\geq 30\).

The number of trading cards that Lamont needs will be at least 30 trading cards.

From the information given, we are informed that Lamont has purchased 20 trading cards and wants to have at least 50 trading cards.

Therefore, the number that will be needed more will be:

= 50 - 20 = 30

Therefore, he'll need at least 30 more cards.

Read related link on:

https://brainly.com/question/14058435

Find y:
4y (3y - 10) (4y + 3)
A 15
B 13
C 16
D 17

Find y:4y (3y - 10) (4y + 3)A 15B 13C 16D 17

Answers

Answer:

D

Step-by-step explanation:

You need to sum up all and equal to 180

I need help with a problem

I need help with a problem

Answers

Answer:

x= 19

Step-by-step explanation:

6x+4+4x-14= 180

10x-10= 180

10x= 190

x= 19

Other Questions
50 points!?!???Excerpt from frankenstein by Mary Shelly Place the paraphrases in the correct logical order to a summary! PLEASE HELP!!!1. Which is a factor of x^2+5x-24a. (x+4)b. (x-4)c. (x+3)d. (x-3)2. Which is a factor of x^2+2x-15a. (x-3)b. (x+3)c. (x+15)d. (x-5)3. Which is a factor of n^2+3n-54a. n+6b. n^2+9c. n-9d. n+9 Angle 3 is 65 degrees. solve for x if angle 5 is equal to 5x. Redacta un comentario de texto discursivo tomando como referente la guaelemental ylos planteamientos estudiados en la bibliografa recomendada. Using the same, non-mutated sequence of DNA , repeat the process you just completed, but this time, for an insertion mutation. Randomly insert a base. Original DNA gene: GATCGATACCATTCGGCGCATACTTCG A)The mutated DNA sequence; highlight the insertion mutation. B)The resulting MRNA sequence for each mutation: C) The resulting amino acid sequence for each mutation (you will need the codon wheel chart for this): Note: Begin translation at the first start codon, AUG, that you see when reading the MRNA sequence from left to-right. Stop translating the sequence when you reach first stop codon in the reading frame. explain how diseases affect biodiversity of a region all of the following are responsibilities of the fed except: * 10 points a. control the monetary base. b. set the reserve requirement. c. oversee and regulate the banking system. d. set the discount rate. e. print bills and mint coins. department of education concerned is foreing or domestic policy? the idea that if vietnam fell to communism, then the rest of asia would too was called the _______ theory. a patient admitted to the rehabilitation center 1 week ago has lost weight and has a decreased serum prealbumin level. which nutritional recommendation would the nurse expect from the registered dietitian nutritionist WHAT IF? What might have happened if states were allowed to nullify federal law? a(n) in the elasticity of supply or demand in a market for a good that is taxed would tend to tax revenue from that tax. A scientist has two solutions, which she has labeled Solution A and Solution B. Each contains salt. She knows that Solution A is 70% salt and Solution B is 95% salt. She wants to obtain 140 ounces of a mixture that is 80% salt. How many ounces of each solution should she use? Why do you believe that Generals were given such responsibility and authority and were often very strict? Do you imagine that there may have been conflict over this? Explain. Joseph is shopping for school supplies. He can buy a box of 24 pens for $4.32 or a box of 36 pens for $5.76. Which is a better buy? Explain your reasoning. Can someone plz help me with this one problem!!!!I WILL MARK BRAINLIEST!!!! The maximum human life span is approximately ______ years of age. what is this mean no! no! no! it was impossible. her hands clutched the iron in frenzy. amid the seas she sent a cry of anguish! ) What is the reasonable domain of the function? ) What is the reasonable range of the function? It's usually easier to change the design of a photo album slide show A.after you've created the presentation. B.before you've created the presentation. C.before you've planned out the presentation. D.after you've planned out the presentation but before creating it.