Another question.. pls this is my 2nd to last one

Another Question.. Pls This Is My 2nd To Last One

Answers

Answer 1

Answer: Diagram A

Explanation:

Answer 2

Answer:

A, because protons and neutrons are in the center of the atom, electrons are on the valance shell.


Related Questions

What is the best summary for this cartoon?
World War I resulted from a "chain reaction" involving many nations.
An ignoble [not noble] war has been declared to a weak country. The indignation [outrage] in Russia shared fully by me is enormous. I foresee that very soon I shall be overwhelmed by the pressure forced upon me and be forced to take extreme measures which will lead to war. To try and avoid such a calamity as a European war I beg you in the name of our old friendship to do what you can to stop your allies from going too far.
-Telegram from Tsar Nicholas II
to German Kaiser Wilhelm II,
1914
What best describes the tsar's viewpoint?
He worries that Russia will be forced into war by forces outside his control.
Background information: When the war was over, Germany was forced to sign the Treaty of Versailles, and take full responsibility for starting the war. This excerpt is part of Germany's response to that treaty.
It is demanded of us that we shall confess ourselves to be alone guilty of the war. Such a confession from my lips would be a lie. We are far from declining all responsibility for the fact that this great World War took place or that it was fought in the way that it was . . . But we energetically deny that Germany and its people, who were convinced that they fought a war of defense, were alone guilty. No one would want to assert that the disaster began only at that disastrous moment when the successor of Austria-Hungary fell a victim to murderous hands.
In the last fifty years, the imperialism of all European states has chronically poisoned international relations. Policies of retaliation, policies of expansion, and disregard for the right of peoples to determine their own destiny, have contributed to the European malady which came to a crisis in the World War. The mobilization of Russia deprived statesmen of the opportunity of curing the disease, and placed the issue in the hands of the military powers.
-Count Brockdorff-Rantzau,
1919
According to the excerpt, what were the causes of World War I?

Answers

World War I resulted from a "chain reaction" involving many nations. This is the best summary of this cartoon.

He is concerned that outside pressures will compel Russia to enter a conflict. Background: Germany was compelled to sign the Treaty of Versailles after the war and accept full responsibility for starting the conflict.

The passage claims that imperialism and expansion, as well as Russia's mobilizations and the Archduke's murder, were the main causes of World War 1.

There were several factors that led to the outbreak of World War 1 in that troubled part of Europe. The murder of Archduke Franz Ferdinand was undoubtedly one of the most significant since it marked the start of a chain of events that led to World War 1. On July 28, 1914, Austria-Hungary formally declared war on Serbia. Russia then started assembling its military and preparing for battle.

Learn more about Word War I here brainly.com/question/13474840

#SPJ4

In March 1980, a tube race took place at the Sundance Resort
near Thunder Bay, Ontario, during its Spring Carnival, held to
promote the resort. The prize money offered was $200. The race
consisted of

Answers

The tube race held at Sundance Resort in March 1980 was a thrilling competition during the Spring Carnival. Participants slid down a snowy hill on inner tubes, aiming to reach the finish line in the shortest time. The race attracted many participants and spectators, creating an exciting and competitive atmosphere. With a $200 prize, the event provided an extra incentive for participants to give their best and added to the overall excitement. The race not only promoted the resort but also fostered a sense of community and camaraderie. It was a popular attraction that enhanced the visitors' experience and contributed to the festive ambiance of the Spring Carnival at Sundance Resort.

What is Lincoln implying are the reasons for fighting the civil war

Answers

Answer:

all Lincoln really wanted as fairness. He was against slavery and wanted everything to be the same for everyone and no one to have special treatment.

Explanation:

Need help please

Can you explain to me in your own words these two questions

1. What are the three instances of Freud's personality (the ego, the id and the superego) in detail

2. What is the dream for Freud

Answers

In accordance with Freud's psychoanalytic theory, the ego serves as a mediator between the super-ego and id's and id's desires in the mind. The id is the instinctual, primal part of the mind that houses secret memories and  and violent instincts, while the super-ego functions as a moral conscience.

The superego, which makes up the ethical part of personality, gives the ego the moral guidelines by which to conduct itself. The superego's judgments, restrictions, and restraints serve as a person's super-ego conscience,

violent and its lofty goals and ambitions serve as their idealized self-perception, or "ego ideal." Sigmund Freud.

Learn more about super-ego, from :

brainly.com/question/30454054

#SPJ1

what was the purpose of the all-white primary, which was used in texas until the 1944 decision in smith v. allwright?

Answers

The purpose of the all-white primary, which was used in Texas until the 1944 decision in Smith v. Allwright, was to exclude African Americans from participating in primary elections and thus restrict their political power and influence.

The all-white primary was a discriminatory practice that originated in the southern United States, including Texas, during the Jim Crow era. It was a system in which political parties, particularly the Democratic Party, conducted primary elections open only to white voters, effectively barring African Americans from participating in the crucial first stage of the electoral process.

The purpose of the all-white primary was to maintain white supremacy and solidify white control over the political system. By limiting participation to white voters, political parties aimed to prevent African Americans from influencing candidate selection and shaping policy decisions.

This discriminatory practice was part of a broader set of laws and practices implemented to enforce racial segregation and deny African Americans their civil rights.

In 1944, the Supreme Court case Smith v. Allwright challenged the constitutionality of the all-white primary in Texas. The Court ruled that the exclusion of African Americans from primary elections violated the Fifteenth Amendment, which granted African American men the right to vote.

This landmark decision struck down the all-white primary system, marking a significant step towards dismantling racial discrimination in the electoral process.

Smith v. Allwright played a crucial role in the broader civil rights movement, as it challenged the legal framework of racial segregation and laid the groundwork for subsequent legal battles against discriminatory voting practices. It highlighted the importance of protecting voting rights and combating systemic racial discrimination in the United States.

To know more about all-white primary refer here

https://brainly.com/question/5556144#

#SPJ11

WHO EVER ANSWERS FIRST GETS BRAINLY
What is the sum of the measures of the interior angles of an octagon?

Read "Discovering the Unthinkable: The Holocaust." According to the text, the Allies had heard for years that the Nazis were arresting whom? Select all that apply.

Question 1 options:

Slavs


communists


fascists


Jews


people with physical or mental disabilities


Americans

Enter your answer in the box.

Answers

Answer:

i think it's jews and communists

Explanation:

the​ pro-globalization argument from the​ mid-1940s until the early 2000s was based on the idea that free trade and open borders created a benefit for all countries. this argument is based on​ _________.

Answers

From the middle of the early 1900s until the early 2000s, the argument in favor of globalization was predicated on the notion that free commerce and open borders benefited all nations. The theory of comparative advantage forms the foundation of this argument.

Whether any of the following claims concerning modern-day globalization is accurate?

Response and justification The right response is c) It has an impact on the political, social, commercial, and economic environments. The effects of globalization on the world economy are numerous and diverse. By expanding global markets and boosting competitiveness, it alters the business and economic environment.

What claim about globalization and trade would the concept of absolute and comparative support?

Since countries can achieve better material results by manufacturing just the items for that they hold a comparative advantage and exchanging such goods with other nations, its law of wealth creation is frequently employed in international trade to support globalization.

To know more about globalization Visit:

https://brainly.com/question/4001059

#SPJ4

One of the chief obstacles John Kennedy had to overcome to win the election of 1960 was the fact that he was _____________

Answers

One of the chief obstacles John Kennedy had to overcome to win the election of 1960 was the fact that he was a Catholic.

Kennedy faced widespread anti-Catholic sentiment, especially in the South and Midwest, where many voters were conservative Protestants. Kennedy was also considered to be too young and inexperienced compared to his opponent, Vice President Richard Nixon.

Kennedy's Catholicism was a major issue throughout the campaign, and he was forced to address it in a famous speech where he declared that he was not the "Catholic candidate" for president, but the "Democratic Party's candidate for president who happens also to be a Catholic."

Kennedy's handling of the issue was seen as a major success, and it helped him to win the election.

Know more about Catholic here

https://brainly.com/question/31679179#

#SPJ11

C
The 13th Amendment overturned the Dred Scott Supreme Court decision. Which right did this
amendment grant?
A It gave women the right to vote.
B. It gave African Americans the right to vote.
C. It abolished slavery in Northern states.
D. It abolished slavery in all states.
Please select the best answer from the choices provided
O'O OO
MO
Mark this and retum
Save and Exit
Next
Submit

Answers

D
The 13th amendment abolished slavery in all of the US.
The 15th amendment gave African Americans the right to vote.
The 19th amendment granted women suffrage.

Write down a few lines of conversation exactly as you hear them spoken. Please review section 3 of the lesson "Mastering Dialogue." Punctuate and capitalize your quotations appropriately, and remember to start a new paragraph when a different person speaks.

Help, 20 points, mark as Brainly.

Answers

The conversation exactly as I have heard them spoken are enumerated below.

Conversation spoken verbatim

"I can't believe   we're finally here," Sarahexclaimed with excitement.

"I know, it's been a   long journey," replied John,glancing around in awe.

"Look at that view! It's absolutely breathtaking," Sarah gasped.

"I'm glad we made the   trip. This place is truly special,"John said, taking it all in.

"We should take some photos to capture this moment," Sarah suggested, reaching for her camera.

It is to be noted that the conversation provided adheres to the guidelines of proper punctuation and capitalization for dialogue.

Learn more about conversation  at:

https://brainly.com/question/24549573

#SPJ1

 Part I: Merry-Go-Round (MGR), A Clothing Retailer Located Primarily In Shopping Malls, Was Founded In 1968. By The Early 1990s, The Company Had Gone Public And Had Expanded To Approximately 1,500 Stores, 15,000 Employees, And $1 Billion In Annual Sales. The Company’s Locations In Malls Targeted The Youth And Teen Market. The Company Was Listed By Forbes
Part I: Merry-Go-Round (MGR), a clothing retailer located primarily in shopping malls, was founded in 1968. By the early 1990s, the company had gone public and had expanded to approximately 1,500 stores, 15,000 employees, and $1 billion in annual sales. The company’s locations in malls targeted the youth and teen market. The company was listed by Forbes magazine as one of the top 25 companies in the late 1980s. However, in the early 1990s, the company faced many challenges. One of its cofounders died, and the other left to pursue unrelated business interests. The company faced stiff competition from other retailers (e.g., The Gap and Banana Republic), fashion trends changed, and mall traffic declined. Sales fell, and experts speculated that MGR failed to anticipate key industry trends and lost sight of its customer market. To try to regain its strong position, the company acquired Chess King, Incorporated, a struggling chain of men’s clothing stores located in malls, in 1993.
The company’s sales continued to fall, and later in 1993 the company brought back one of its cofounders to manage the company and wrote down a significant amount of inventory. However, this inventory write-down caused the company to violate loan covenants. Facing bankruptcy, the company, based on the advice of its newly hired law firm Swidler and Berlin, hired turnaround specialists from EY to help overcome the financial crisis and develop a long-term business plan. However, the company’s decline continued, and it filed for Chapter 11 reorganization in 1994. In 1996, the remaining assets were sold for pennies on the dollar.
Subsequently, a group of 9,000 creditors (including former employees and stockholders) began litigation against parties it deemed responsible for their losses. These parties included EY, which the creditors sued for $4 billion in punitive and compensatory damages (EY’s fees from MGR totaled $4.5 million).
The lawsuit alleged that EY’s incompetence was the main cause of MGR’s decline and demise. It also alleged the following:
The turnaround team did not act quickly enough.
The leader of the team took an eight-day vacation at a critical point during the engagement.
The cost-cutting strategy called for only $11 million in annual savings, despite the fact that the company was projected to lose up to $200 million in 1994.
While closing unprofitable stores was key to MGR’s survival, by 1995 only 230 of 1,434 stores had been closed and MGR still operated two stores in some malls.
The turnaround team included inexperienced personnel—a retired consultant, a partner with little experience in the United States or with retail firms in general, and two recent college graduates.
EY denied any wrongdoing but in April 1999 agreed to pay $185 million to settle with the injured parties.
Part II: Merry-Go-Round. Additional charges made against EY included the following (recall that MGR hired EY for turnaround consulting services):
EY had a close relationship with Rouse Company, one of MGR’s primary landlords (EY was soliciting business from Rouse and provided significant tax services).
Swidler (the law firm that recommended EY to MGR) and EY had participated in at least 12 different business arrangements, some of which resulted in Swidler receiving significant fees from EY.
EY did not disclose either of these relationships to MGR.
Chapter 02 Discussion Case 2-26 LO 2-2, 2-10, 2-12
Required:
Although this was not an audit engagement for EY, some of the allegations against the firm can be framed in terms of the Principles Underlying an Audit Conducted in Accordance with Generally Accepted Auditing Standards. Which of the Principles do you think EY allegedly violated?
Given that non-CPAs who consult are not subject to formal professional standards, describe the advantages and disadvantages that result from CPAs being subject to such standards.

Answers

Summary for all parts: Some of the allegations against the firm can be framed in terms of the Principles Underlying an Audit Conducted in Accordance with Generally Accepted Auditing Standards.

Part 1: The principle that EY allegedly violated is the Principle of Professional Competence and Due Care. The principle of professional competence and due care requires auditors to maintain professional knowledge and skill at the level required to ensure that clients receive competent professional service. They should take necessary care in the performance of professional services.

Part 2: In this case, EY did not act with professional competence and due care while dealing with Merry-Go-Round (MGR), a clothing retailer located primarily in shopping malls. EY, in this case, is not subject to formal professional standards. However, CPAs who consult are subject to formal professional standards.

These professional standards ensure the following:  Advantages CPAs are required to maintain a certain level of professional knowledge and skills. They are required to take necessary care in the performance of professional services. CPAs have a certain level of accountability. CPAs are required to maintain a certain level of professional knowledge and skills. CPAs are required to take necessary care in the performance of professional services.

To know about more about auditing standards refer here : brainly.com/question/29348547

#SPJ11

helppp
Why was the inspector unable to impose the penalty he asked for? What does the court’s decision suggest about the importance of factory owners and manufacturing?

Answers

It is usually thought that a fine is a payment made to the employer for damage done to him by the worker. That is not true. A fine and compensation for damage are two different things. If a worker does some damage to another worker, the latter may demand compensation for the damage (e.g., for a piece of cloth which has been spoiled), but can not fine him. Similarly, if one factory owner does damage to another (e.g., fails to deliver goods on time), the latter can demand compensation, but he cannot fine the first factory owner.
i hope this helps!!

In what year did Missouri try to become a state?

Answers

1817, but then it become the 24th state in August 10, 1821.

Which fact illustrates China's geographical isolation?
А
Silk manufacture originated in China.
B.
Buddhism spread through China after the fall of the Han.
с
The ancient Chinese referred to their land as the "Middle Kingdom."
D
Qin Shihuangdi built the Great Wall.

Which fact illustrates China's geographical isolation?Silk manufacture originated in China.B.Buddhism

Answers

Answer:

C. The middle kingdom. Everybody wants to be in the middle

Answer:

the answer is D, the building of the Great Wall

PLEASE HELP
What are some short and long term effects of the scientific revolution?

Answers

Answer:

Scientific progress became associated with optimistic ideas about the inevitability of progress and the attainments of a generalized happiness for all mankind.

Who was Jefferson Davis? What was his response toward African American troops?

Answers

Answer:

Jefferson Davis (1808-1889) was a Mexican War hero, U.S. senator from Mississippi, U.S. secretary of war and president of the Confederate States of America for the duration of the American Civil War (1861-1865). Prior to the start of the war, Davis had argued against secession, but when Mississippi seceded he resigned from the U.S. Senate. In February 1861 he was elected president of the Confederacy. Davis faced difficulties throughout the war as he struggled to manage the Southern war effort, maintain control the Confederate economy and keep a new nation united. Davis’ often contentious personality led to conflicts with other politicians as well as his own military officers. In May 1865, several weeks after the Confederate surrender, Davis was captured, imprisoned and charged with treason, but never tried.

2. Discuss in about 3 paragraphs what the Scorpion Mace Head and
the Narmer palette tell us about the origins of the Egyptian
state.

Answers

The Narmer Palette, often referred to as either the Great Hierakonpolis Palette and the Palette of Narmer, is a notable Egyptian archaeological find that dates to around the 31st century BC and, at least ostensibly, falls within the category called cosmetic palettes.

Some in the earliest hieroglyphic writings ever discovered can be found there. Daily-use palettes have only one side that was embellished. The elaborate carvings on the Narmer Palette depict King Narmer's victory in war and the gods' blessing of Egypt's union.

The Scorpion macehead is an decorated ancient Egyptian macehead that was discovered by British archaeologists James E. Quibell as well as Frederick W. Green during the 1897–1898 excavation season at Hierakonpolis.

Learn more about Narmer Palette, here:

https://brainly.com/question/1189781

#SPJ4

"Strike out the term white, and what will be the result? Hordes of Mexican Indians may come in here from the West and may be more formidable than the enemy you have vanquished. Silently they will come moving in; they will come back in thousands to Bexar, in thousands to Goliad, perhaps to Nacogdoches, and what will be the consequence? Ten, twenty, thirty, forty, fifty thousand may come in here and vanquish you at the ballot box though you are invincible in arms . . . "Talk not to me of democracy which brings the mean, grovelling yellow race of Mexico . . . upon an equality of rights and privileges with the freeborn races of Europe. The God of nature has made them inferior; he has made the African and the red man inferior to the white." -Source: Remarks from the Texas Constitutional Convention, as printed in Distant Horizon: Documents from the Nineteenth-Century American West (2000), 1845 The excerpt would be most useful to historians as a source of information about which of the

Answers

Based on the information given, the ideas in the excerpt were directly motivated by the concerns about the legal status of non-white people on acquired territory.

From the information given, in the excerpt, it was stated that Hordes of Mexican Indians may come in here from the West and may be more formidable than the enemy that has vanquished if the term white is struck from Americans.

This was motivated as a result of the concerns about the legal status of non-white people on an acquired territory. The excerpt was that blacks in the country were inferior and giving them equal rights may not be the appropriate thing to do.

Learn more about excerpts on:

https://brainly.com/question/24864502

Was the Enforcement Act of 1870 a valid exercise of Congress's power to enforce the Fifteenth
Amendment?

Answers

Answer:

No. In an 8-1 decision authored by Chief Justice Morrison Waite, the Court concluded that the relevant sections of the Enforcement Act lacked the necessary, limiting language to qualify as enforcement of the Fifteenth Amendment. The Chief Justice first stated that the Fifteenth Amendment "does not confer the right of suffrage upon any one," but "prevents the States, or the United States, however, from giving preference…to one citizen of the United States over another on account of race, color, or previous condition of servitude." In examining the language of the Enforcement Act, the Court noted that, while the first two sections of the act explicitly referred to race in criminalizing interference with the right to vote, the relevant third and fourth sections refer only to the "aforesaid" offense. According to the Court, this language does not sufficiently tailor the law to qualify as "appropriate legislation" under the Enforcement Clause of the Fifteenth Amendment.

Explanation:

What determines the distribution of organisms?

Answers

Explanation:

Species distributions are dependent on interactions with abiotic and biotic factors in the environment. Abiotic factors like temperature, moisture, and soil nutrients, along with biotic interactions within and between species, can all have strong influences on spatial distributions of plants and animals.

How did the animals react towards Mr Jones house what did they do with it?

Answers

The famished animals respond by breaking into the shed for food and causing a commotion.Mr Jones then instructs his men to whip the animals and the animals proceed to attack the humans.The animals successfully rebel against Me Jones and his men by driving them off the farm.

American patriots in Boston joined a group called sons of

Answers

Answer: Sons of Liberty

Explanation:

Answer:

The Bostonian branch of the Sons of Liberty were responsible for organizing and executing the famous Boston Tea Party of 1773 in response to the Tea Act. Early in the American Revolution, the former Sons of Liberty generally joined more formal groups, such as the Committee of Safety.

During the Depression, the U.S. government deported 500,000 Mexican Americans and their American-born children because:

Answers

The U.S. government deported 500,000 Mexican Americans and their American-born children during the Depression as part of its campaign to alleviate economic pressures.

This campaign sought to deport Mexicans and Mexican Americans deemed “surplus population” who were allegedly taking jobs from white American citizens during a time of economic crisis. The campaign was also driven by a belief among some Americans that Mexicans were to blame for the country's economic troubles.

Further, the government believed that deporting Mexicans and Mexican Americans would decrease the strain that the Depression had placed on the country's resources. The deportations were conducted without due process and lasted through the 1930s and into the 1940s. The effects of the deportations were far-reaching, causing social and economic upheaval for thousands of families.

To know more about Mexicans , click here:

https://brainly.com/question/14304703

#SPJ4

How did the 1791 Constitution affect the power of Louis XVI

Answers

Answer:

The constitution retitled Louis XVI as “King of the French”, granted him a reduced civil list, allowed him to select and appoint ministers and gave him suspensive veto power.

Explanation:

Which three rulers were Roman Catholic?

Answers

Answer:

Eugenius, usurper in the West (393–394)

The Theodosian Dynasty Theodosius I (the Great), appointed ruler of the East (379–395) by Gratian; last ruler of united...

Theodosius I (the Great), appointed ruler of the East (379–395) by Gratian; last ruler of united empire (394–395)

Explanation:

World War I and after

What were the main causes of World War I? Let's discuss specifically the roles of nationalism and imperialism.

Then let's discuss the reshaping of the world order that resulted from the war. Discuss the collapse of specific empires and their aftermaths. What happened to the global political balance, and what new challenges arose in global politics?

Answers

The main causes of World War I can be attributed to a combination of factors, including nationalism and imperialism.

Nationalism, the strong belief in one's own nation and its interests, played a significant role as various European powers sought to assert their dominance and protect their national identities. Imperialism, the expansion of empires through colonization and control of territories, led to competition and tensions among nations vying for resources and influence.

The aftermath of World War I witnessed the collapse of several empires, most notably the Austro-Hungarian Empire, the Ottoman Empire, and the Russian Empire. These collapses resulted in the redrawing of national borders and the emergence of new nation-states, leading to political instability and ethnic tensions in regions such as Eastern Europe and the Middle East.

The global political balance was fundamentally altered by the war. The old order based on the dominance of European powers gave way to the rise of the United States as a global superpower. The war also led to the formation of the League of Nations, an international organization aimed at maintaining peace and resolving conflicts. However, the League's effectiveness was limited, and new challenges emerged, including rising tensions between the victors of the war, economic instability, and the emergence of extremist ideologies that would later contribute to World War II.

Learn more about Nationalism

https://brainly.com/question/1018147

#SPJ11

Select the correct answer.
Which European nation colonized India and Australia, in addition to having spheres of influence in China?
A.
Germany
B.
Spain
C.
Great Britain
D.
France

Answers

Answer: the correct answer is (C) Great Britain

Explanation:

which state did not disintegrate as a result of extreme devolution? a yugoslavia b united kingdom c czechoslovakia d ussr e sudan question 5 (1 point)

Answers

The United Kingdom did not disintegrate as a result of extreme devolution.

Extreme devolution refers to the process where a centralized state grants significant political, administrative, and legislative powers to its constituent regions or states. In the case of the options provided, out of Yugoslavia, United Kingdom, Czechoslovakia, USSR, and Sudan, it was the United Kingdom that did not disintegrate despite implementing devolution.

While Yugoslavia, Czechoslovakia, and the USSR all experienced disintegration during the 20th century due to various factors, the United Kingdom managed to maintain its unity. The United Kingdom introduced devolution to address regional demands for more autonomy and to accommodate the unique identities and aspirations of Scotland, Wales, and Northern Ireland. This process led to the establishment of separate parliaments/assemblies in Scotland, Wales, and Northern Ireland, each with varying degrees of legislative power.

Despite devolution, the United Kingdom has retained its political and territorial integrity. The UK Parliament in Westminster still governs certain matters that pertain to the entire country, while devolved administrations handle specific issues in their respective regions.

In summary, while Yugoslavia, Czechoslovakia, and the USSR disintegrated due to extreme devolution and other complex factors, the United Kingdom managed to remain united despite implementing devolution.

Learn more about Yugoslavia.

brainly.com/question/31185817

#SPJ11


What role did Baron Friedrich von Steuben play in the American Revolution?

Answers

Baron Friedrich von Steuben's contributions to the American Revolution were instrumental in transforming the Continental Army into a more disciplined and effective fighting force, ultimately contributing to the success of the American cause for independence.

Baron Friedrich von Steuben played a crucial role in the American Revolution as a military officer and strategist. He is best known for his significant contributions to the training and organization of the Continental Army.

In 1777, von Steuben arrived in America as a volunteer from Prussia. Recognizing his military expertise, General George Washington appointed him as Inspector General of the Continental Army. Von Steuben's primary task was to instill discipline and professionalism within the troops, who had been facing significant challenges due to their lack of training and organization.

Von Steuben developed a comprehensive training program that emphasized drill and discipline. He introduced standardized drills, formations, and maneuvers, ensuring that soldiers could march, maneuver, and fight effectively as a cohesive unit.

Under von Steuben's guidance, the morale and effectiveness of the Continental Army improved significantly. He implemented strict disciplinary measures, emphasized hygiene and sanitation to combat diseases, and trained officers on leadership skills. Von Steuben's efforts played a critical role in transforming the inexperienced and undisciplined Continental Army into a more professional fighting force.

His impact was particularly evident during the winter at Valley Forge in 1777-1778, where von Steuben's training methods and focus on discipline helped to strengthen the army's resilience and prepare them for future military campaigns.

for more questions on Revolution

https://brainly.com/question/16533738

#SPJ8

what did the attack at fort necessity reveal about the french commitment to the ohio territory?

Answers

The attack at Fort Necessity revealed that the French were highly committed to maintaining control over the Ohio territory. This was demonstrated by their willingness to engage in conflict with British forces in order to defend their territorial claims.

In July 1754, a force of French soldiers and Native American allies attacked Fort Necessity, which had been constructed by a young George Washington and his troops. The French victory was a clear indication of their determination to hold onto the Ohio territory, which they saw as essential for the economic and strategic interests of their empire.

Despite the initial success of the French at Fort Necessity, the conflict in the Ohio territory would continue for several years. Ultimately, it would be resolved by the Treaty of Paris in 1763, which saw the French cede much of their North American territory to the British.

Know more about Fort Necessity here:

https://brainly.com/question/14009534


#SPJ11

Other Questions
How many moles of carbon monoxide would be needed to react with 100 g FeO3? the nurse is planning care for a client with aids who has developed chronic severe diarrhea secondary to adverse effects of the antiviral drugs prescribed. what goal should the nurse prioritize during this client's care? Which of the following nucleic acid complexes would undergo correction by the DNA mismatch repair system? UAGUCUUACAUUCCAUAUGG 3' (6%) Antisense 3' _ ATCAGAATGTAAGGTATACC-5' B. GTGCCCACGATTCAGTGGGC 3' (2%) Antisense 3' CACGGGTGCTAAGTCACCCG-5' GCGCCACGATTTAACGTGGC (62%) Anlisense 3' CGCGGTGCTAAGTTGCACCG-5' GGGCCCACGCUACGACGUUC 3' (28%) Anlisonse 3' CCCGAGTGCGATGCTGCAAG X During a short interval of time, the speed v in m/s of an automobile is given by v=at^2+bt^3 where the time t is in seconds. What are the units of a and b respectively? What is the present value of $500 to be received 13 years fromnow discounted back to the present at 11 percent? the nurse completes an admission assessment on a patient with asthma. which information given by patient is indicates a need for a change in therapy? Today, you can take classes online and have live discussion boards from your own home. This type of interaction is similar to that experienced within which of the following is an example of a law that would pass the reasonableness standard, as it's clearly applied on a rational basis that is not arbitrary? group of answer choices laws requiring somebody to be 21 to legally purchase alcohol laws setting different ages at which men and women can legally buy beer. laws barring one religious group from solicitation. state laws setting different ages at which men and women legally become adults. women being barred from jobs by height and weight requirements Which of the following statements is incorrect?Inventories in the balance sheet represent the amount owed by customers who have availed themselves of the firms trade credit facility.All the answers are correct except one.Under the short-term working capital funding strategy, short-term debt to finance all seasonal working capital, a portion of the permanent working capital and fixed assets.Accounts payable (trade credit), bank loans, and commercial paper are common sources of short-term financing.Long-term financing strategy relies on long-term debt to finance both capital assets and working capital. Photosynthesis is a redox reaction. This means that H2O is _____ during the light reactions and CO2 is _____ during the Calvin cycle. See Concept 10.1 (Page 191) A sample of automobiles traversing a certain stretch of highway is selected. Each automobile travels at a roughly constant rate of speed, though speed does vary from auto to auto. Let x = speed and y = time needed to traverse this segment of highway. Would the sample correlation coefficient be closest to 0.9,0.3,-3,or -0.9? Explain.The right answer is -0.9, but I do not know the reason. mary is a real estate broker who is looking to enter into a listing agreement to sell david's house. why would david prefer to enter into an exclusive agency agreement rather than an exclusive right to sell agreement? the exclusive agency agreement will allow david to not pay a commission to mary the genes for mahogany eyes and ebony body are approximately 25 map units apart on chromosome iii in drosophila. (mahogany and ebony body are both the mutant phenotypes) assume that a mahogany-eyed female was mated to an ebony-bodied male and that the resulting f1 phenotypically wild-type females were mated to mahogany, ebony males. of 1000 offspring, approximately how many wildtype flies do you expect? Bakit may history? Explain what is history and its significance. I need in 300 words about natural gas which has played animportant role in the Ukrainian Russian war has one of the mostdebated types of market structures. Explain how natural gas plays astrategic If your equation is not in y=mx + b form can you simplify the equation/formulato graph it? managing diversity is more than hiring women and minorities; it is complex and involves which of the following?Valuing employee differences to build an effective organizationRecognizing the characteristics common to specific groups of employeesManaging a culturally diverse workforce a child goes to the school nurse and reports being unable to hear the teacher. what test could the school nurse perform that would preliminarily indicate hearing loss? A cylinder has radius 4 inches and height 5 inches. A cone has the same radius and height.Round Volume answers to the nearest hundredthCylinderI15Find the volume of the cylinder. V=ConeBFind the volume of the cone. V= A spherical balloon is inflated with gas at a rate of 900 cubic centimeters per minute. (a) Find the rates of change of the radius when r-70 centimeters and r 95 centimeters. r 70 X cm/min r = 95 X cm/min