are brainiest if u get the right answer no internet please or no brainiest.




How big is an atom?

Answers

Answer 1

Answer:

I think it's 100 picometers because atoms are super small

Answer 2

Answer:

atoms are usually around 100 picometers across.

Explanation:

:)


Related Questions

1. What kinds of pollution do you know? Which is the worst? Discuss in group.

2. What are fossil fuels? Give examples. Where are they used? Can they be replaced?

3. Some factories dump waste water in rivers and ocean. How can we prevent this?

4. People throw away tons of garbage everyday. How can we reduce the amount of garbage?

5. Do you drink bottled water? Why or why not? What is its effect on the environment?​

pls 3-5 sentence and then explain briefly the answer. ty

Answers

Answer:

1. There's air pollution, water pollution, noise pollution, and light pollution. The worst pollution is air pollution because it can cause severe health problems like respiratory diseases or even cancer.

2. Fossil fuels are resources that are formed from the remains of dead plants and animals. An example would be coal, oil, and natural gas. These fuels are used to generate electricity, power vehicles, heat homes and buildings. Yes, there many other energy sources that can replace fossil fuels.

3. One way to prevent factories from dumping waste water in rivers and oceans is to implement stricter regulations and penalties for those who violate them.

4. One of the best ways to reduce the amount of garbage is to reduce, reuse, and recycle.

5. Yes, I drink bottled water because it's more water to drink from a bottle and its effect on the environment is recycling and being reused.

Answer
1. Pollution can be of many types such as air pollution, water pollution, noise pollution, and land pollution. In my opinion, air pollution is the worst because it affects people's health and can cause breathing problems, heart diseases, and even cancer. Discussing this issue in a group can help us understand different perspectives and find solutions to reduce pollution.

2. Fossil fuels are non-renewable sources of energy that are formed from the remains of dead plants and animals. Examples of fossil fuels include coal, oil, and natural gas. They are used to generate electricity, fuel vehicles, and heat homes. However, they are a major contributor to air pollution and climate change. Fossil fuels can be replaced by renewable sources of energy such as solar, wind, and hydro power.

3. Factories dumping waste water in rivers and oceans can have a negative impact on aquatic life and the environment. To prevent this, factories can treat their waste water before discharging it into the environment. Governments can also enforce strict regulations and penalties for factories that violate environmental laws.

4. To reduce the amount of garbage, we can follow the three R's - reduce, reuse, and recycle. We can reduce the amount of waste we generate by using reusable bags, bottles, and containers. We can also compost organic waste such as food scraps and yard waste. Recycling can also help reduce the amount of garbage by turning waste into new products.

5. I try to avoid drinking bottled water because it generates a lot of plastic waste that can take hundreds of years to decompose. Plastic waste can also harm wildlife and pollute the oceans. Instead, I use a refillable water bottle and fill it with tap water. Tap water is safe to drink in most developed countries and can be a more sustainable choice.

Match the term to its definition (Hint: Look at the bottom of the article)

Column A
1.
Winter Storm Watch:
Winter Storm Watch
2.
Winter Storm Warning:
Winter Storm Warning
3.
Frost/Freeze Warning:
Frost/Freeze Warning
4.
Ice Storm Warning:
Ice Storm Warning
5.
Blizzard Warning:
Blizzard Warning
6.
Winter Weather Advisory:
Winter Weather Advisory
7.
Heavy Snow Warning:
Heavy Snow Warning
Column B
a.Conditions from recent winter weather can be hazardous (especially for drivers).
b.A combination of snow and wind will create limited visibility, drifting snow, and dangerous wind chills
c.There will be more than four inches in 12 hours or six inches in 24 hours.
d.A winter storm is likely. The storm may include sleet, snow, ice, or a combination of them.
e.There will be dangerous accumulations of ice
f.The winter storm is expected to enter the area
g.The temperature will dip below freezing

Answers

Answer:

1)f

2)d

3)g

4)e

5)b

6)c

7)a

Hey! Who wants some riddles??? OCEAN ANIMALS WORD SCRAMBLES
BRAINLIEST ON THE LINE! Just for fun

Answers

Answer:

what gas a neck but no head?

Explanation:

a bottle

Answer:

Can I have brainliest?

Explanation:

In exactly 15 words can you explain how the arm bends and straightens?

Answers

The biceps and triceps act against one another to bend and straighten the elbow joint

When did people begin to notice that coastlines of continents fit together like puzzle pieces?
when satellites began taking pictures of Earth from space
when Alfred Wegener proposed the idea of continental drift
when early explorers traveled from Europe and Asia to the Americas
when geologists first started examining the fossil record of South America

Answers

Answer:

The 1500s

Explanation:

the1500s

As early as the1500s map makers were beginning to notice that the individual continents fit together like pieces of a jigsaw puzzle. It wasn't until 1912 that Alfred Wegener first proposed an acceptable hypothesis (continental drift) as an explanation

it would be in the 1500s!! hope this helps if correct please mark brainiest

The diagram to the left shows a food web in a large park. Each circle represents a different species in the food web. Which of the organisms in the food web could be referred to as primary consumers?
( Picture below)

The diagram to the left shows a food web in a large park. Each circle represents a different species

Answers

Answer:

2 , 3 and 4  only

Explanation:

I need this for something sorry I hope the other answer helped

Why do they call aries an aries if its not an air sign but a fire sign instead-

Answers

Answer:

Beginning with the first sign Aries which is a Fire sign, the next in line Taurus is Earth, then to Gemini which is Air, and finally to Cancer which is Water. This cycle continues on twice more and ends with the twelfth and final astrological sign, Pisces.

not sure if this helps

Because it doesn’t work like that

Nguyen uses a triple beam balance to measure the mass of each rock. Read the values on the balance for rocks X, Y, and Z.

Nguyen uses a triple beam balance to measure the mass of each rock. Read the values on the balance for

Answers

Answer:

X = 120

Y=  710

Z=   620

Explanation:

The Density of Rocks Part A Nguyen uses a triple beam balance to measure the mass of each rock. Read the values on the balance for rocks X, Y, and Z. Rock Balance Reading of Rock Mass (g) X triple beam part of mass balance with top beam with pointer at 20, middle beam with pointer at 0, and lowest beam with pointer at 1 Y triple beam part of mass balance with top beam with pointer at 10, middle beam with pointer at 0, and lowest beam with pointer at 7 Z triple beam part of mass balance with top beam with pointer at 20, middle beam with pointer at 0, and lowest beam with pointer at 6

x = 120
y = 710
z = 620

Write a small essay about the five senses

Answers

The five senses are eyesight, hearing, taste, touch and smell. We all use those five senses just about everyday. We use are eyesight to see around us. We use are hearing to hear any noise that is near us. We use are taste everyday normally also and we use it to eat or drink and when we do we can feel how it taste and sense how it taste. We use and touch to feel things around or near us. We touch things all the time, not just with are hands. We smell things all the time also it never stops, we can smell food, flowers anything that has a sent.

Answer:

Those senses are sight, smell, hearing, taste, and touch. We see with our eyes, we smell with our noses, we listen with our ears, we taste with our tongue, and we touch with our skin. Our brain receives signals from each of these organs, and interprets them to give us a sense of what's happening around us.

Explanation:

Please Mark Brainliest, Have a good Day!

Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below.

AUGCCACAGGUUCAUCCGAA…

To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

A. Calculate the frequencies of each letter.
B. Count the number of letters in the list.
C. Separate the list into three-letter "words."
D. Separate the list into two-, three- and four-letter "words."

Answers

Answer:

C.) Separate the list into three-letter

Explanation:

I agree I think it is C

Which of the following minerals is the hardest and is a 10 on Mohs scale?

a
Topaz
b
Talc
c
Quartz
d
Diamond

Answers

Answer is diamond I just did the quiz

What best describes ribosomes?

Answers

Ribosomes are cellular structures that synthesize proteins from amino acids. They are composed of ribosomal RNA and proteins and are found in both prokaryotic and eukaryotic cells.

Ribosomes are essential for gene expression and cell growth. They can be free in the cytoplasm or bound to the endoplasmic reticulum or the nuclear envelope.

An example of a ribosome function is the translation of a messenger RNA (mRNA) sequence into a polypeptide chain. The ribosome reads the mRNA codons and matchesthem with the corresponding transfer RNA (tRNA) anticodons that carry the amino acids. The ribosome then forms a peptide bond between the amino acids and releases the tRNA. This process continues until the ribosome reaches a stop codon on the mRNA and terminates the protein synthesis.

Answer:

A ribosome is a  intercellular  structure made of RNA and protein

Explanation:

The type of heat transfer responsible for distributing most of the heat throughout Earth's atmosphere is

A.radiation

B.convection

C.conduction

Answers

Answer:

B. convection

Goodluck!

The answer is B.convection

Based on these images, what can you say about the tentacles of an octopus and the limbs of a lizard?

Based on these images, what can you say about the tentacles of an octopus and the limbs of a lizard?

Answers

I think is the fourth one but I’m not 100% sure-

Answer: 4

Explanation:

Several species of wasp kill other organisms to lay their eggs in but are not considered true parasites. Why do you think an organism like this isn't considered a true parasite?

Answers

Answer:

This is because parasites do not actually kill their hosts, which makes them not a true parasite even if they benefit while the host is harmed.

Summarize photosynthesis and describe how it is part of the carbon cycle

Answers

Photosynthesis is when plants take in carbon dioxide and create glucose and oxygen. It is apart of the carbon cycle because it removes carbon from the air and turns it into oxygen.
Photosynthesis is the action of plants taking in sunlight to make their food. Just like us humanos make our own food they do the same thing when they get sunlight. This is part of the carbon cycle because during photosynthesis plants absorb sunlight and Carbon dioxide and in the end and let out oxygen.

How does the orientation of the North Pole change during the year?

Drag and drop the months to correctly match the descriptions.

points away from the sun, so the Northern Hemisphere gets its least sunlight

points neither toward nor away from the sun, and the days in the Northern Hemisphere are getting longer

points neither toward nor away from the sun, and the days in the Northern Hemisphere are getting shorter

points toward the sun, so the Northern Hemisphere gets its most sunlight
December,March,June, or September
(THIS IS SCIENCE NOT BIOLOGY)

Answers

The orientation of the North Pole changes as follows during the year:

December: points away from the sun, so the Northern Hemisphere gets its least sunlight.March: points neither toward nor away from the sun, and the days in the Northern Hemisphere are getting longer.June: points toward the sun, so the Northern Hemisphere gets its most sunlight.September: points neither toward nor away from the sun, and the days in the Northern Hemisphere are getting shorter.

How does the orientation of the North Pole change during the year?

The orientation of the North Pole remains relatively fixed throughout the year. It does not change its position or direction.

The North Pole always points in the same direction in the northern sky, which is towards the North Star or Polaris.

However, the tilt of the Earth's axis in relation to its orbit around the Sun causes the amount of sunlight received by different parts of the Earth to vary throughout the year.

Learn more about the North Pole at: https://brainly.com/question/29026330

#SPJ1

Does not change during the year

HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP

HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP

Answers

Answer:

50%

Explanation:

There is 50% chance that there will be a rr (recessive) trait passed on and 50% a heterozygous dominant trait

There is a 50% chance that the kitten will have long hair. If you fill out the punnet square, you will end up with two Hh, which shows the 50% of long hair kittens. The other 50% chance will be for short hair kittens.

A heterozygous for height pea plant is crossed with a homozygous recessive for height pea plant. What is the punnet square?? Please answer quickly!!!

A heterozygous for height pea plant is crossed with a homozygous recessive for height pea plant. What

Answers

between two heterozygous tall plants results in 25% homozygous tall, 50% heterozygous tall and 25% dwarf plants. Thus the correct answer is option 25%.
Heterozygous = Bb
Homozygous recessive = bb

Punnet = Bb Bb bb bb

Phenotype is 50%

50 POINTS!

Energy is transferred into the ecosystem when

1.when bacteria absorbs nitrogen from other organisms

2. dead organisms decay and form organic matter

3. rodent prey on invertebrates

4.plants grow from the soil

Answers

Answer:

2

Explanation:

Energy is transferred between organisms in food webs from producers to consumers.

The energy is used by organisms to carry out complex tasks. The vast majority of energy that exists in food webs originates from the sun and is converted (transformed) into chemical energy by the process of photosynthesis in plants.

Answer: between organisms in food webs from producers to consumers.

Explanation:

Suppose you were asked to research information about a potentially dangerous synthetic food product. How would you evaluate the credibility of the sources you found?

Answers

Look at the studies cited in the source and the credentials of the scientists, if there are no studies cited it’s not a good source. Look at whether the ending of the link is .gov/.edu, any other ending is less credible. Check and see if the FDA has approved these food products or denied them. And finally look at the author and the authors credentials.
A good way to tell whether or not a website is reliable is the ending of the link (.com, .net, etc). Websites with .gov are more reliable because it is a government site. Websites with .com or .net can be reliable however it is always good to check the author of the website to make sure they know what they're talking about.

using the pedigree label the genotype of the first generation carrier

using the pedigree label the genotype of the first generation carrier

Answers

Answer:

Aa (can be replaced with another letter, as long as one is capital and the other is lower case). If it's sex-linked then it would be XAXa (A and a should be superscript)

Sometimes a population cannot grow to its biotic potential due to environmental conditions called ____________.
a. extinction
b. carrying capacities
c. limiting factors
d. emigration

Answers

C because limiting factor can’t grow to it’s biotic!





C because of those environmental conditions this answer would be the word used in that sentence when you look at it it makes more sense that the rest especially the definition of the word

how are osmosis and facilitated diffusion alike?

Answers

They are related processes that display similarities. Both osmosis and diffusion equalize the concentration of two solutions. They are both passive transport processes, and they don’t require any input of extra energy to occur.

They both use passive transport. they don't need energy to move molecules through the plasma membrane.

1. Describe what bacteria are - their parts, how they can be good, how they can be bad, and the different types.
Pls help will mark Brainlyest or whatever

Answers

Answer:

Many human illnesses are caused by infection with either bacteria or viruses. Most bacterial diseases can be treated but some can’t be. Some viruses give a challenge to the body’s immune system because they hid in the cells

Explanation:

How does the formation of coal relate to the rock cycle

Answers

Answer:

Coal is a non-renewable source of energy that takes many years to produce. - Metamorphic rocks are formed during intense heat and pressure to: Igneous rocks, sedimentary rocks and other metamorphic rocks. They can also be formed when lava so hot it changes the minerals flows over rocks.

Explanation:

coal is formed within the earth , and can take millions of years to form. it is a non-renewable resource meaning it can run out since it takes so long to renew (make more)

The weather forecast says a high temperature was to be 24°F and the relative humidity was at 93 percent. A fast-moving cold front was moving in her direction. What type of weather should we expect? Explain why you choose that specific storm.

Answers

Answer: a tornado or a snow storm

fast moving cold front was moving in her direction

And usually when the high temperature for the day is 24

°F and the relative humidity is at 93 percent, a snowstorm happens

A snow storm or tornado due to the cold front coming in

During which process is DNA transferred from one bacterium to another
bacterium by a virus?
A. Transduction
B. Binary fission
C. Transformation
D. Conjugation

Answers

Answer:

d conjugation

Explanation:

conjugation is the process by which one bacteria is transferred genetic material to another through direct contact .

conjugation

conjugation is the process by which one baterium traffered genetic materal to another through Direct contact

pls help me will mark brainlyest :) :

Internal and External Structures

You are now going to construct an argument that plants have internal and external structures that support growth and reproduction.

Choose the internal and external structures you want to gather evidence and create a statement about.

subject: sciences

Answers

Explanation:

Some structures are internal, like the lungs, brain, or heart. Other structures are external, like skin, eyes, and claws. Some structures are unique, like the long neck of a giraffe. Other structures are more common, like a heartStructure and Function: Plants and animals have both internal and external structures that serve various functions in growth, survival, behavior, and reproduction.

Plants have internal and external structures just like us humans do. While humans internally have lungs, a heart, and intestines Plants have that to. Plants have different fibers that allow the it to move water, make food, do photosynthesis, etc. So for this you could pick a couple different plant fibers such as the sclerenchyma fiber and the parenchyma fiber. The sclerenchyma fiber allows the plant to come out of the ground. This fiber is essentially its bones. The parenchyma fiber allows photosynthesis to occur. It moves water creates food etc.

I hope this helps! Good Luck!

There are 100s of different dog breeds. How did humans develop all of these different dog breeds ? Rewind the video if you are not sure. (pick one)
a. breeding dogs with traits that are similar and specialized for what humans wanted.
b. natural evolution
c. random chance

Answers

Answer:

a

Explanation:

A. The dogs didn’t evolve on their own and dog breeders don’t randomize dog breeds
Other Questions
solve 5! how do i solve 5 with legit 0 context?all that's there on my Acellus is "Solve 5!"how do i? Why is the law of conversation of matter important A 63kg sprinter, starting from rest, runs 43m in 7.0 s at constant acceleration. What is the magnitude of the horizontal force acting on the sprinter? What is the sprinter's power output at 2.0s, 4.0s, and 6.0s? HELP ME QUICK!!!!! i don't understand2x+5=13-21=7-4ym/6-3=8-4=d+3/5 Consider the curve given by the equation y^2-2x^2y=3. a) Find dy/dx . b) Write an equation for the line tangent to the curve at the point (1, 1). c) Find the coordinates of all points on the curve at which the line tangent to the curve at that point is horizontal. d) Evaluate d^2y/dx^2 at the point (1, 1) A body weighs 10N in air and 8N when immersed completely in a liquid of density 0.86g\cm^ 3.Find the volume of the body (gravity=10m\s^2) A widows peak hairline is dominant to straight hairline. Cross a heterozygous widows peak hairline person to a straight hairline person. Paula is scuba diving her elevation changes by -37 4/5m in 4.5 min. what rational number represents the average change in paulas elevation each minute SHOW YOUR WORK! Question 3Non-response bias occurs in ad-hoc mail surveys with which group of people?O those with interest in the topicO those with less educationO studentsO men Suppose that the maximum speed of mopeds follows a normal distribution with a mean of 46.8 km/h and a standard deviation of 1.75 km/h. What is the probability that a randomly selected moped will have maximum speed greater than 51.3 km/h? Daniel is writing about emergency steps to take if a fire breaks out in school. Which organizational aid would be most useful?a sequence charta timelinea Venn diagrama web diagram Why might members of the National Assembly support abolishing the feudal system? Write the stander from for (6 times 1000) + (4 times 100) Where can I get bass pro shop online? what stage in the model of consumer buyer behavior takes into account time constraints or economic issues that may be influencing the consumer? Reactions that use energy to drive the synthesis of molecules inside the cell are most specifically considered. The Yarn Barn is operating in a purely competitive market. They are operating at an output of 1,000 skeins of yarn. The price of a skein of yarn is $12. The firm's costs are the following, marginal cost is $12, average total cost is $11 and average variable cost is $10. 1. Is the firm producing at its optimal level of output? Why or Why not? Explain 2. Should the Yarn Barn continue to produce in the short run or should they shut down? How do you know? Explain and be sure to include a graph in your answer. 3. Should the Yarn Barn continue to produce in the long run? How do you know? Explain and be sure to include a graph in your answer. A series of n jobs arrive at a multiprocessor computer with n processors. Assume that each of the n^n possible assignment vectors (processor for job 1, ..., processor for job n) is equally likely. Find the probability that exactly one processor will not be assigned a job Please help!what building did julia de burgos write her books in? i mean like did she write her books at home or where? TRUE / FALSE. tony bought a text book for $100. he offers to give it to ruby if ruby helps him move into his new dorm room.