Both students made a mistake.

Describe the mistake each student made.

Explain what each student needs to do to fix their mistake.

Create your own quadratic equation, and explain how to use the quadratic formula to solve it. Be specific, using a, b, and c of your equation and giving the solutions to the equation you chose.

Both Students Made A Mistake.Describe The Mistake Each Student Made.Explain What Each Student Needs To
Both Students Made A Mistake.Describe The Mistake Each Student Made.Explain What Each Student Needs To

Answers

Answer 1

Answer:

true answer I'm search in Goole

Both Students Made A Mistake.Describe The Mistake Each Student Made.Explain What Each Student Needs To
Both Students Made A Mistake.Describe The Mistake Each Student Made.Explain What Each Student Needs To
Both Students Made A Mistake.Describe The Mistake Each Student Made.Explain What Each Student Needs To
Both Students Made A Mistake.Describe The Mistake Each Student Made.Explain What Each Student Needs To
Both Students Made A Mistake.Describe The Mistake Each Student Made.Explain What Each Student Needs To
Answer 2

The root of the quadratic equation x = -3/4\(\pm\) √-31/ 4.

What is a solution for a quadratic equation?

Suppose that we've a function y = f(x) such that f(x) is quadratic.

When y = 0, then the values of x for which f(x) = 0 is called solution of quadratic equation f(x) = 0

These solution gives values of x, and when we plot x and f(x), we'd see that the graph intersects the x-axis at its solution points.

Then its roots are given as

\(x = \dfrac{-b \pm \sqrt{b^2 - 4ac}}{2a}\)

Given; 2x^2 + 3x + 5 = 0

We know that a=2, b=3, c=5

\(x = \dfrac{-b \pm \sqrt{b^2 - 4ac}}{2a}\)

\(x = \dfrac{-3\pm \sqrt{3^2 - 4(2) ( 5)}}{2(2)}\\\\\\x = \dfrac{-3\pm \sqrt{9 - 40}}{4}\\\\\\x = \dfrac{-3\pm \sqrt{-31}}{4}\\\\\\x = \dfrac{-3}{4}\pm \dfrac {\sqrt{-31}}{4}\)

Learn more about solutions of a quadratic equation here:

https://brainly.com/question/15582302

#SPJ2


Related Questions

Find the surface area of the sphere if its radius is 13 inches. Round your answer to
nearest hundredth (two decimal places). Use 3.14 to approximate pi.

Answers

Formula: (3.14) 13^2
Answer: 530. 66
Formula is A=4 pi r^2
4*3.14*13^2
2122.64

does a piecewise function always have an x and y intercept

Answers

Answer:yes

Step-by-step explanation:

but if the y intercept is 0 then it’ll show like: y= 3x which is equal to y=3x plus or minus 0

No, a piecewise function does not always have an x and y intercept.

A piecewise function is a function that is defined by multiple sub-functions, each of which applies to a certain interval of the main function's domain.

An x-intercept is the point where the function crosses the x-axis, and a y-intercept is the point where the function crosses the y-axis.

It is possible for a piecewise function to not have an x or y intercept if none of the sub-functions cross the x or y axis. For example, the piecewise function f(x) = {2x + 1 for x < 0, -2x + 1 for x > 0} does not have an x or y intercept because neither of the sub-functions cross the x or y axis.

In conclusion, a piecewise function does not always have an x and y intercept. It depends on the sub-functions that make up the piecewise function.

Learn more about Piecewise Function here: brainly.com/question/12561612

#SPJ11

The interquartile range is a. the difference between the third quartile and the first quartile b. another name for the variance c. the difference between the largest and smallest values d. the 50th percentile

Answers

Option A) the difference between the third quartile and the first quartile is the correct answer.

The interquartile range (IQR) is the difference between the first and third quartiles of a dataset. It is a measure of the spread of a dataset's middle 50%.It is calculated as follows:IQR = Q3 − Q1where Q3 is the third quartile and Q1 is the first quartile, respectively.The interquartile range is a. the difference between the third quartile and the first quartile. Thus, Option A is the correct answer.An interquartile range is a statistic that uses two significant points in a dataset to define a spread.

It disregards any values outside of the range. The IQR is useful since it is robust to outliers and gives us an indication of how spread out our data is.

Learn more about interquartile range here,

https://brainly.com/question/4102829

#SPJ11

Test the series below for convergence using the Ratio Test. ( - 1)"62n+1 (2n + 1)! n=0 The limit of the ratio test simplifies to lim \f(n)| where n → f(n) = The limit is:

Answers

The limit is less than 1, the series converges by the Ratio Test.

To apply the Ratio Test, we need to compute the limit of the ratio of successive terms of the series:

\(|((-1)^(n+1) * 6^(2n+3)) / ((2n+3)! * ((2n+1)!))| / |((-1)^n * 6^(2n+1)) / ((2n+1)! * ((2n)!))|\)

We can simplify this expression by canceling out some of the common terms in the numerator and denominator:

\(|((-1)^(n+1) * 6^2) / ((2n+3) * (2n+2))| = 36 / ((2n+3) * (2n+2))\)

Now we can compute the limit of this expression as n approaches infinity:

\(lim n→∞ |f(n)| = lim n→∞ |36 / ((2n+3) * (2n+2))| = 0\)

To know more about Ratio Test, refer here:

https://brainly.com/question/20876952

#SPJ11

If the star Aldebaran rises tonight at 2:00 a.m., when do you expect it to rise next month?
a) 11:00 pm.
b) midnight.
c) 1:00 am. d) 2:00 am. e) 3:00 am

Answers

Your answer is option b)

The time at which a star rises shifts approximately 4 minutes earlier each day, due to Earth's orbit around the Sun. Since there are roughly 30 days in a month, we can calculate the change in the rise time of Aldebaran over the course of a month.

Step 1: Calculate the time change over one month
30 days * 4 minutes per day = 120 minutes

Step 2: Convert minutes to hours
120 minutes ÷ 60 minutes per hour = 2 hours

Step 3: Subtract the time change from the current rise time
2:00 am - 2 hours = 12:00 am (midnight)

Therefore, you can expect Aldebaran to rise next month at midnight. The correct answer is b) midnight.

Learn more about Aldebaran from : brainly.com/question/26969989

#SPJ11

Can you please help me with this. Another tutor was & then my app froze on me.

Can you please help me with this. Another tutor was &amp; then my app froze on me.

Answers

SOLUTION

The given equation is:

\(y=2\sqrt{x-3}+4\)

To graph the equation, calculate a few values of y

When x=3, it follows:

\(\begin{gathered} y=2\sqrt{3-3}+4 \\ y=2\sqrt{0}+4 \\ y=4 \end{gathered}\)

It follows that the point (0,4) is on the graph.

Following the same procdure few other possible points are:

\((8.3,8.6),(9.5,9.099),(19.5,12,12)\)

The graph of the function is shown below:

Can you please help me with this. Another tutor was &amp; then my app froze on me.

what is the explicit formula for this sequence? -7,-3,1,5,…

Answers

Answer:

\(a_n=4n-11\)

Step-by-step explanation:

The common difference is \(d=4\) with the first term being \(a_1=-7\), so we can generate an explicit formula for this arithmetic sequence:

\(a_n=a_1+(n-1)d\\a_n=-7+(n-1)(4)\\a_n=-7+4n-4\\a_n=4n-11\)

the data analysis toolpak in excel and sheets generates random numbers based on what kind of probability distribution:

Answers

The Uniform distribution is chosen by default by Excel's Random Number Generator. The data analysis toolpak in excel and sheets generate random numbers based on the Uniform distribution.

The data analysis toolpak in excel and sheets generate random numbers based on the Uniform distribution.

What is the Data Analysis Toolpak?

The Data Analysis Toolpak is an add-in for Microsoft Excel that adds several analytical tools to Excel. The toolpak assists in performing data analysis, statistical analysis, and complex modeling.

The Excel Data Analysis Toolpak was initially launched as an add-on for Excel 5.0 in 1993 and is still included with current versions of Excel.

It includes a variety of data analysis tools such as histograms, ANOVA (analysis of variance), descriptive statistics, regression, and more.Excel's data analysis toolpak is a statistical analysis tool that aids in the calculation of several statistical metrics and the creation of graphs and charts.

Excel provides several features for data analysis, including calculating descriptive statistics, probability distributions, and hypothesis tests.To make use of the toolpak, go to the File menu, choose Options, choose Add-Ins, and then select Excel Add-ins.

After that, you must check the Analysis Toolpak checkbox. After you've enabled the Analysis Toolpak, the Data Analysis group should appear in the Data tab's Analysis section.Generate random numbers based on the Uniform distribution:

Excel can create random numbers using several probability distributions, including the uniform distribution. Excel's Random Number Generator generates random numbers based on two variables: the range and the interval. The RANGE variable is a collection of numbers between which Excel can choose.

The INTERVAL variable determines how often Excel will generate a new random number.

The syntax for the Excel's Random Number Generator is =RANDBETWEEN (low, high).

The Uniform distribution is chosen by default by Excel's Random Number Generator.

The data analysis toolpak in excel and sheets generate random numbers based on the Uniform distribution.

To know more about Random visit:

https://brainly.com/question/30789758

#SPJ11

16 The perimeter of the pentagon is equal to the perimeter of the square.
Not to scale
5X tỉ 3
2x + 3
11
7x + 4
5x + 8
9x10
Find an expression for the length of one side of the square.
Give your answer in terms of x in its simplest form.

Answers

7x+2

Step-by-step explanation:

add all the sides of the pentagon and make it equal to the perimeter of the square which is 4y

sides of the pentagon are

5x+3

2x+3

7x+4

9x-10

5x+8

28x+8=4y

7x+2 = y

7x+2 = answer

gathmath

gathmathier6961

another way :

in a standardized test you may want to use real numbers

make x equal a prime number like 3

so then the sides are

18

9

25

17

23

=

92

then divide by 4

23

then divide by 3

which is 7 remainder of 2

which is

7x+2

16 The perimeter of the pentagon is equal to the perimeter of the square.Not to scale5X t 32x + 3117x

a musician plans to perform 5 selections for a concert. if he can choose from 9 different selections, how many ways can he arrange his program? a)45. b)15,120. c)59,049. d)126.

Answers

The solution is :

The solution is, 15120 different ways can he arrange his program.

Here, we have,

Given : A musician plans to perform 5 selections for a concert. If he can choose from 9 different selections.

To find : How many ways can he arrange his program?  

Solution :

According to question,

We apply permutation as there are 9 different selections and they plan to perform 5 selections for a concert.

since order of songs matter in a concert as well, every way of the 5 songs being played in different order will be a different way.

so, we will permute 5 from 9.

So, Number of ways are

W = 9P5

   =9!/(9-5)!

   = 9!/4!

   = 15120

15120 different ways

Hence, The solution is, 15120 different ways can he arrange his program.

To learn more on permutation click:

brainly.com/question/10699405

#SPJ1

HELP ME PLEASEEEEEEEEEEEE

HELP ME PLEASEEEEEEEEEEEE

Answers

Answer:

15 x 20 x 4 = 1,200

6 x 4 = 24, 24 divided by 2 ( x 1/2 ) = 12

12(area of 1 triangle) x 12(width) = 144

Formula area of a triangle:

B(base) x H(height) x 1/2(basically just dividing by 2)

Formula volume of a rectangular prism:

L x W x H

Answer:

1) 1200

2) 144

Step-by-step explanation:

1:

Volume Of A Cube: L * W * H

Substitute: 25 * 20 * 4

2:

Volume Of A Triangular Prisism: 0.5 * B * A * H

Substitute: 0.5(6 * 4) * 12

A function f is defined by f(x, y) = 3x2 – 4y. What is the value of
f(3, 2)?

Answers

Assuming the function is \(f(x,y)=3x^2-4y\)

     --> then f(3,2) is: \(f(3,2) = 3(3^2)-4(2)=3*9-8=27-8=19\)

Hope that helps!

a confidence interval for the population mean number of us states americans have visited was found to be 11.4 to 12.5. find the best point estimate of this confidence interval.

Answers

The best point estimate of the confidence interval is the midpoint or the mean of the interval.

The confidence interval is a range of values that we are confident contains the true population mean.

However, to get a single estimate of the population mean, we use the midpoint of the interval as the point estimate.

This is because the midpoint represents the most likely value of the population mean based on the sample data.
Therefore, the best point estimate for this confidence interval would be the average of the two endpoints:
(11.4 + 12.5) / 2 = 11.95

Hence, the best point estimate for the confidence interval 11.4 to 12.5 is 11.95, which represents the most likely value of the population mean based on the sample data.

learn  more about confidence interval click here:

https://brainly.com/question/20309162

#SPJ11

Which of the following rounds most closely to 1?

1/5
4/5
4/8
2/3

Answers

Answer:

B. 4/5

Glad to help :)

a modified roulette wheel has 36 slots. one slot is 0, another is 00, and the others are numbered 1 through 34, respectively. you are placing a bet that the outcome is an odd number. (in roulette, 0 and 00 are neither odd or even.

Answers

To calculate the probability of getting an odd number on a modified roulette wheel, we need to count the total number of possible outcomes and the number of favorable outcomes.

Given that a modified roulette wheel has 36 slots and 2 of them are not odd or even i.e 0 and 00. Thus, the number of favorable outcomes is the number of odd numbers out of the 34 numbered slots. There are 18 odd numbers from 1 to 34 inclusive, so the number of favorable outcomes is 18.

Hence, the probability of getting an odd number on a modified roulette wheel is:P(Odd number) = Number of favorable outcomes / Total number of possible outcomes.

We can calculate the total number of possible outcomes as:Total number of slots = 36P(Odd number)

= 18/36

= 1/2

Therefore, the probability of getting an odd number on a modified roulette wheel is 1/2.

To know more about odd number visit:

https://brainly.com/question/33528684

#SPJ11

draw the a concave hexagon with two pairs of congruent sides

Answers

Concave hexagon with two pairs of congruent sides is:

   /\

   /  \

  /    \

 /      \

/        \

/_____\

\        /

\      /

 \    /

  \  /

   \/

How to draw a concave hexagon with two pairs of congruent sides?

A hexagon is a six-sided polygon. A concave hexagon is a hexagon with at least one interior angle greater than 180 degrees.

We can start with a regular hexagon, which has six congruent sides and six interior angles of 120 degrees each.

We can then extend two opposite sides of the regular hexagon outwards to create two pairs of congruent sides. The extended sides should not be parallel to each other, but rather at an angle, so that the resulting hexagon is concave.

Here is an example of a concave hexagon with two pairs of congruent sides:

   /\

   /  \

  /    \

 /      \

/        \

/_____\

\        /

\      /

 \    /

  \  /

   \/

In this hexagon, sides AB and CD are congruent, and sides EF and GH are also congruent. However, the angles at vertices A and H are greater than 180 degrees, making this a concave hexagon.

Learn more about congruent sides.

brainly.com/question/28911587

#SPJ11

Suppose that the scores of golfers on the PGA tour have a mean of 67.15 and a standard deviation of 3.084. A random sample of 30 is taken from the population. What is the distribution of the sample mean

Answers

The distribution of the sample mean can be represented as: X ~ N(67.15, 3.084/√30)

The distribution of the sample mean is a normal distribution with a mean equal to the population mean µ and a standard deviation equal to the population standard deviation σ divided by the square root of the sample size n.

Therefore, for this problem, the distribution of the sample mean can be represented as:

X ~ N(67.15, 3.084/√30)

where X is the sample mean, N represents a normal distribution, 67.15 is the population mean, 3.084 is the population standard deviation, and √30 is the square root of the sample size.

This distribution assumes that the sample is randomly selected from the population and the sample size is large enough to satisfy the central limit theorem.

To know more about sample mean, refer here:

https://brainly.com/question/31101410#

#SPJ11

a client has orders to receive 3,000 ml of iv fluid at a rate of 150 ml/hr. if the infusion starts at 0800, when would it be finished?

Answers

Step-by-step explanation:

3000  ml   /   150 ml/hr =  20 hrs from 0800   would be 0400 the NEXT day.

A clinical psychologist hypothesizes that petting a live dog will lead one to be in a better mood. To test this, she has 50 people pet a live dog for 15 minutes. Another 50 sit quietly on a couch for 15 minutes. She then has them rate their mood on a 10- point scale. What are the Independent and Dependent variables

Answers

Dependent variable: mood rating;

independent variable: dog petting or couch sitting.

In the given experiment, there are two variables being observed: the independent variable and the dependent variable. The independent variable is the act of petting a live dog or sitting quietly on a couch for 15 minutes.

This variable is experimentally controlled and altered to test its impact on the dependent variable. The researcher changes or controls the independent variable to see how it affects the dependent variable in the experiment. On the other hand, the dependent variable is the participants' rating of their mood on a 10-point scale. It is often referred to as the outcome variable and is the variable being measured in an experiment. The dependent variable is affected by the independent variable, and in this scenario, the mood of the 50 people is the dependent variable. The clinical psychologist measures the outcome or result, which is the mood of the participants, making it the dependent variable.

Know more about dependent variable here:

https://brainly.com/question/1479694

#SPJ11

How do you convert a repeating decimal into a fraction? Because, I was asked this question: Rewrite as a simplified fraction. 3.24=?

Answers

Answer:

3  6/25

Step-by-step explanation:

Rewrite the decimal number as a fraction with 1 in the denominator

3.24=3.24/1

Multiply to remove 2 decimal places. you multiply top and bottom by 10^2 = 100

3.24/1×100/100=324/100

Find the Greatest Common Factor of 324 and 100. reduce the fraction by dividing both numerator and denominator by GCF = 4,

324÷4 over 100÷4=81/25

Simplify the improper fraction

=3 & 6/25

At the beginning of the school year, 396 students attended the first football game. Attendance at the next was 505 students. Estimate the percent of increase.

Answers

Answer:

27.5253% increase

Step-by-step explanation:

i got this answer right on khan academy

Hi I really want to check my answer to this question, so if anyone could give it a try that would be very much appreciated!
Betty’s Bite-Size Candies are packaged in bags. The number of candies per bag is normally distributed, with a mean of 50 candies and a standard deviation of 3. At a quality control checkpoint, a sample of bags is checked, and 4 bags contain fewer than 47 candies. How many bags were probably taken as samples?

Answers

Answer:

Hi I really want to check my answer to this question, so if anyone could give it a try that would be very much appreciated!

Step-by-step explanation:

if this is wrogn sorry

What do I do 900m = 2.700​

Answers

Step-by-step explanation:

given

900m = 2.700

m = 2.700 / 900

m = 0.003

Hope it will help :)

The owner of an art supply store buys tubes of magenta oil paint for $10.80 and marks up the cost by 10% to determine the retail price. The tubes of paint do not sell well, so the owner marks down the retail price by 20%.

To the nearest cent, what is the marked-down price of a tube of magenta oil paint?

Answers

Answer:

The answer is: 9.50

Answer: $18.19

Step-by-step explanation:

Manuel earns 5350 a month. if he worked eight hours a day for 20 days, how much did he make each hour? Express your answer in dollars and cents. (Rounded)

Answers

Answer:

$33.44

Step-by-step explanation:

Working hours:

20 days, 8 hours a day20*8 = 160 hours

Earning in a month = $5350

Hourly earning rate:

5350/160 = 33.4375 = $33.44 rounded

a(-3)=5 What will a equal

Answers

Answer:

a = - 5/3

Step-by-step explanation:

after analyzing the sales data from both curbside pickup and delivery orders, a local pizza joint obtains the following 95% confidence intervals for the mean of pickup orders and delivery orders: pickup orders: between $33 and $51 per order delivery orders: between $21 and $41 per order can you conclude that an average pickup order has higher amount than an average delivery order?

Answers

Based on the information provided, we cannot conclude with certainty that the average pickup order has a higher amount than the average delivery order.

Based on the information given, we can conclude that there is a 95% chance that the true mean for pickup orders falls between $33 and $51, and the true mean for delivery orders falls between $21 and $41. However, we cannot conclude with certainty that the average pickup order has a higher amount than the average delivery order.

To determine if there is a significant difference between the means of the two groups, we need to perform a hypothesis test. We can set up our null hypothesis as "there is no significant difference between the means of the pickup and delivery orders" and our alternative hypothesis as "the average pickup order has a higher amount than the average delivery order."

We can use a two-sample t-test to test this hypothesis. Assuming equal variances, we would calculate the test statistic as

t = (xpickup - xdelivery) / (s / √n)

where xpickup and xdelivery are the sample means for pickup and delivery orders, s is the pooled standard deviation, and n is the sample size for each group.

If our calculated t-value is greater than the critical value at a chosen significance level (e.g. 0.05), we can reject the null hypothesis and conclude that there is a significant difference between the means of the two groups.

Learn more about two-sample t-test here

brainly.com/question/15870238

#SPJ4

​(c) If you are willing to run out of cash for​ 10% of the​ days, how much cash should you put in the ATM each​ day?

the class width is ____

(type a whole number)

Answers

Relative frequency is the ratio of the number of times an event occurs to the total number of events

The amount in cash that should be put  in the ATM each day is $8,400

Question: The dataset in the question are presented as follows;

55, 91, 72, 61, 66, 78, 80, 93, 87, 73, 75, 70, 58, 69, 73, 67, 67, 76, 73, 83, 68, 72, 73, 70, 80, 73, 76, 60, 82, 74

A bank staff is asked to come up with an amount he recommends to be put in the ATM each day so that the ATM will run out of cash 10% of the days

The above data gives the amount of daily withdrawals from the ATM in 100s of dollars

From the above values, we have the following table of values;

\(\begin{array}{|c|c|c|}Class&Frequency&\underline {Relative \ Frequency} \\55 - 60&3&0.1\\60 - 65&1&0.0\overline 3\\65 - 70&7&0.2\overline 3\\70 - 75&9&0.3\\75 - 80&5&0.1\overline 6\\80 - 85&2&0.0\overline 6\\85 - 90&1&0.0\overline 3\\90 - 95&2&0.0\overline 6\end{array}\right]\)

Solution:

The class width in the relative frequency table is 5

10% of the time = 30 days × 10/100 = 3 days

Given that money is to run out of the ATM 10% of the time, the amount to be put should be less than the three largest amount withdrawn within 30 days, which are; 87, 91, and 93

The fourth largest amount withdrawn is $8,300

Therefore, by putting $8,400 in the ATM, the ATM is expected to run out of cash on three of the 30 days of the month, which is 10%

The amount to place in the ATM is $8,400

Learn more about relative frequency here:

https://brainly.com/question/23359601

(c) If you are willing to run out of cash for 10% of the days, how much cash should you put in the ATM

35. The height, h, in metres, of a flare as a function of time, t, in seconds, since the flare was fired from a
boat can be modeled by the equation h=-5.25t² +42t+2
a) What is the initial height of the flare when it is fired?
b) How high is the flare after 1 S?
c) When does the flare reach its maximum height?
d) What is the maximum height of the flare?
e) After how many seconds does the flare hit the water?

Answers

a)The initial height of the flare when it is fired is 2m.

b)The height of the flare after 1 s is 38.75m

c)The flare reaches its maximum height after 2 seconds.

d) The maximum height of the flare is 65m.

e) The flare hits the water after 8 seconds.

The given equation which is h = -5.25t² + 42t + 2, can be used to solve the following questions:

a) To get the initial height of the flare when it is fired, the value of t = 0 must be used in the given equation:

h = -5.25(0)² + 42(0) + 2h

= 0 + 0 + 2h

= 2

Therefore, the initial height of the flare when it is fired is 2m.

b) To get the height of the flare after 1 s, the value of t = 1 must be used in the given equation:

h = -5.25(1)² + 42(1) + 2h

= -5.25 + 42 + 2h

= 38.75

Therefore, the height of the flare after 1 s is 38.75m

c)The maximum height of the flare is reached when the flare is at its peak.

Therefore, the time when the flare reaches its maximum height is found by dividing -b by 2a, where the equation is in the form of y = ax² + bx + c.

The equation h = -5.25t² + 42t + 2 is in the form of y = ax² + bx + c,

where a = -5.25, b = 42, and c = 2.t = -b/2a = -42/2(-5.25)

= -2

Therefore, the flare reaches its maximum height after 2 seconds.

d) To get the maximum height of the flare, the value of t = 2 must be used in the given equation:

h = -5.25(2)² + 42(2) + 2h

= -21 + 84 + 2h

= 65

Therefore, the maximum height of the flare is 65m.

e)When the flare hits the water, the height, h, is 0.

Therefore, the time when the flare hits the water is found by setting h = 0 in the given equation and solving for t:

0 = -5.25t² + 42t + 2

Using the quadratic formula:\($$t = \frac{-b \pm \sqrt{b^2 - 4ac}}{2a} $$\)

where a = -5.25, b = 42, and c = 2.

= \(\frac{-42 \pm \sqrt{42^2 - 4(-5.25)(2)}}{2(-5.25)} $$t\)

= 8.003 or t = 1.331

Since time cannot be negative, the time when the flare hits the water is after 8 seconds. Therefore, the flare hits the water after 8 seconds.

Know more about  height   here:

https://brainly.com/question/28122539

#SPJ8

Consider the inequality −11x≥22 .



Solve the inequality. Explain why or why not the direction of the inequality symbol is reversed.

Input Field 1 of 1

Answers

Answer:

x<-2

Step-by-step explanation:

Other Questions
How can you use forces to affect different objects based on their masses? A baseball is traveling ( 30 m/s) and is hit by a bat. it leaves the bat traveling (40 m/s). what is the change in the velocity? remember that direction is what makes velocity different than speed. responses 10 m/s negative 10 meters per second, 30 m/s negative 30 meters per second, 40 m/s negative 40 meters per second, 70 m/s Write an essay in 100-120 words about how a sport's uniform has changed. Include thefollowing:- a paragraph about how the uniform was.- a paragraph about how the uniform is today.a conclusion Complete the sentences to explain at what p range the ionization state in the previous part exists Match the words in the left column to the appropriate blanks in the sentences on the right. Reset Help 2.10 4.07 7.40 9.47 protonated deprotonated The ionization state will occur at a pH range of to This ionization state occurs in this range because, when the pH is greater than the pKs (by more than one unit), the compound is at that location. When the pH is less than the pKa. the compound is at that location Last one can anyone help me plz what is meaning of volume 5'-CATTTATTTAACTGGGTTCTTGCCCAGCCCATATTTTCACCCTTTAATGG TAATGAAGCTAAAATTTCTTTCCAGTCACTTTGCATATCATTTCCTTTCT CTTTAATTCTCTTTCGAAGTGAGATGATTGATAGATTCTTCTTCAGCAGT CACTTACTTTGGTAGATGATTTTCTTTTTCCTTTGAAGTCGATTTTGAAA GGAGCTCTGTGTGATGAGCTAATTAGCACAAACACACAGAGTATATAACC TTAATTAGGCATGATTATAGGCTCAACGTAATGGGATGTCCTGAAACTGC ACACTATGCAAATATTAGACTTTTCATTCTTCCCATTACATCGGAAACCA TCAAGCAAAGGATGTTTTGCAGTAGGTACCACAGTCAATGCCAGGTGCAA CTCTTTCAATAAAAGGTTGATT-3'1) you want to use PCR to amplify a specific portion. Use the underlined bases as the location of the two primers, what are the two primer sequences that need to be designed and synthesized for PCR? Be sure to indicate the 5 and 3 ends of the primers.2) What is the size of the expected amplified product? CDB stock is currently priced at $61.26. The company will pay a dividend of $3.00 next year and investors require a return of 11.27 percent on similar stocks. What is the dividend growth rate on this stock? write your answer in percentage Which of these is NOT a reason why the current DSM-5 method of categorizing personality disorders has been criticized Hallie and Mattie donated blue jeans to the clothing drive. Hallie donated 3 pairs of blue jeans. Mattie donated 6 pairs of blue jeans. Write a ratio to represent the relationship between Hallie's donation of jeans and Mattie's donation of jeans. 3:15 3 over 9 1:2 6 to 18 Plants are named according to their? How can corporate governance foster ethical decisions and behaviors on the part of managers as agents Explain the closure property for polynomials. Why are fossil fuels considered nonrenewable resources if they are still forming beneath the surface today? Please help me with this quick!the picture is above Ill make you brainly A problem in statistics is given to five students A,B, C, D , D and E. Their chances of solving it are 1/2, 1/3, 1/4,1/5, 1/ is the probability that the problem will besolved? need help ASPA. The question-and-answers are in the picture. T/FA company has issued $5 million worth of bonds at 10 percent interest for 20 years. The economy has changed and now bonds of the same quality only pay 7 percent. If the bonds were convertible, the company could reissue the bonds at the lower rate and save money on interest payouts. Explain the major construction phases of a building project and describe the common tradesmen involved in each phase. h2o is an example of a(n) h2o is an example of a(n) molecular formula. glucose molecule. ionic formula. covalent formula.