Changes in ________ structure and function have been demonstrated in adolescents who are either at-risk or have been diagnosed with various mood and/or anxiety disorders.

Answers

Answer 1

Answer:amygdala

Explanation:


Related Questions

A condition that describes an individual that carries two different alleles of a gene.

Answers

Answer:

Het erozygous

Explanation:

People with alleles that are the same are hom ozygous for the physical trait. Ones with two different alleles are het erozygous.

There is no space, just didn't let me spell it correctly.

VALUE BASED QUESTION (Write in about 50-100 words)
Consider the following two cases: (Please give answer ASAP)

(i) A forest that is rich in biodiversity sees a decline in the animal population and clearing of a large
part of the forest. The Government declared it as a biodiversity hotspot and the forest regained its
species richness in few years.

(ii) A lake that is rich in marine fishes sees a decline in its species population due to over harvesting.
The people living in the area made the lake a sacred grove and started worshipping it. The species
population of the lake again became normal.

Answer the following questions based on the above information:

(i) Which values are being promoted in the above cases?
Case 1:-
Case 2:-

(ii) Suggest some ways in which you can contribute to this concern.
Case 1:-
Case 2:-

(iii) What would have been the effect if the forest was not declared a biodiversity
hotspot?

Answers

The value that can be withdrawn from case 1 is the activeness of the government that takes some crucial steps to maintain the biodiversity of the forests. The value that can be withdrawn from case 2 is the sincerity of native people towards nature who make a lake a sacred grove and start worshipping it in order to maintain the biodiversity of that lake.

What is Biodiversity?

Biodiversity may be defined as the sum total of all the living entities living in a particular area at a given time.

For maintaining the biodiversity of the forest as well as a lake, it is required not to deteriorate the natural ecosystem of those regions by human activities like over grazing, forest fires, over harvesting, industrialization, etc.

If the forest has not been declared a biodiversity hotspot, the time will not be far to announce that a forest becomes a bare area, where no species live, survive, and reproduce naturally.

Therefore, it is well described above.

To learn more about Biodiversity, refer to the link:

https://brainly.com/question/11542363

#SPJ1

What are two genotypes that could produce a dominant phenotype?

Answers

Answer:

A homo-zygous dominant genotype and a heterozygous genotype

Explanation:

A homo-zygous dominant genotype refers to a genotype that contains two copies of the dominant gene variant, i.e., two dominant alleles at its locus, thereby individuals carrying this genotype will show a dominant phenotype. Moreover, a heterozygous genotype is a genotype that contains both dominant and recessive alleles at its locus. In a heterozygous genotype, the dominant allele is always expressed and masks the recessive allele, thereby showing a dominant phenotype.

HOW DO THESE MOLECULES COMPARE TO THE ORIGINAL

Answers

Answer:

whats the question here

Which of the following best describes the behavior of nonconservative elements in seawater?
A. Nonconservative elements are reactive in seawater and have a long residence time.
B. Nonconservative elements are reactive in seawater and have a short residence time.
C. Nonconservative elements are non-reactive in seawater and have a short residence time.
D. Nonconservative elements are non-reactive in seawater and have a long residence time.

Answers

Answer: Option C.

Nonconservative elements are non-reactive in seawater and have a short residence time.

Explanation:

Non conservative elements are elements that enter the sea water and have little concentrations in the ocean and show spartial variationns. These elements have short residence time I .e short replacement time and they are non reactive .Constituents such as phosphate, nitrate, and other nutrients, and dissolved oxygen, carbon dioxide, etc. are non-conservative because their concentrations are later changed by chemical reaction in the sea.

this answer i need pls ill mark brainliest

this answer i need pls ill mark brainliest

Answers

All - growth, exchange of gases, excretion, reproduction, and death (option d).

All living organisms undergo various life processes to maintain their existence. Let's analyze each option to determine which life processes are carried out by an organism's cells:

A. Only growth and exchange of gases: While cells are involved in growth and exchange of gases, they also participate in other life processes. This option is incomplete.

B. Only growth, exchange of gases, and reproduction: Cells play a crucial role in reproduction as they are responsible for the production of gametes and the process of cell division. However, there are additional life processes that cells also undertake.

C. Only growth, exchange of gases, excretion, and reproduction: This option includes excretion in addition to growth, exchange of gases, and reproduction. Cells participate in excretion by eliminating waste materials. However, there is one more life process that cells experience.

D. All - growth, exchange of gases, excretion, reproduction, and death: This option encompasses all the mentioned life processes. Cells are involved in growth as they undergo cell division and increase in number. They exchange gases through processes like respiration. Cells excrete waste products. They participate in reproduction through the formation of gametes and cell division. Lastly, cells also experience death as they have a limited lifespan.

Therefore, the correct answer is D. All - growth, exchange of gases, excretion, reproduction, and death.

For more such questions on reproduction, click on:

https://brainly.com/question/461781

#SPJ8

Where is cytoplasm located?
A) within the cell membrane
B) outside the cell membrane
C) inside the nucleus
D) inside the organelles​

Answers

It’s a within the cell membrane.

Rocks in continental crust are as old as ____ years.

A. 200 million
B. 44 million
C. 4.4 billion

Answers

Answer:

4.4 billion

Explanation:

hope this helps

pls give brainliest

Why do modern Psychologists use trait theory as the method of helping individuals understand their personality?

Answers

Trait approach is one of the most vital areas of study in psychology that helps identify a person's personality. Traits can be defined as a stable characteristic that causes a person to depict a response to any situations in certain ways. Trait theory approach focuses on personality differences between individuals.

A bird stalks, kills, and then eats an insect. Based on its behavior, which pair of ecological terms describes the bird?
-herbivore, decomposer
-producer, heterotroph
-carnivore, consumer
-autotroph, herbivore

Answers

Answer:

Carnivore, consumer.

Explanation:

Predators do that, not scavengers or herbivores (or any other category).

Carnivore it’s eating another animal consumer cause it consumed the animal

15. Analyze the graph below and use numerical evidence to support the claim, the
depth of the ocean affects the amount of carbon in the ocean.
Use the following sentence stems and the evidence rubric to guide your writing.
(independent variable).
(increases/decreases) then the
(increases/decreases/stays the same).
If the.
(dependent variable).
For example...(include 2 data points from the graph!).
Amount of Carbon (ppm)
2500
2400
2300
2200
2100
2000
1900
1800
0
Amount of Carbon in the Ocean
1000
2000
3000
Depth (m)
4000
5000

15. Analyze the graph below and use numerical evidence to support the claim, thedepth of the ocean affects

Answers

Answer:

If the depth increases then the amount of carbon increases. For example, the amount of carbon found in 0 meter depth is 2000 ppm, but increases to 2200 ppm at a depth of 1000 meters.

~

Learn more about graphs, here:

https://brainly.com/question/30519536

Answer:

Explanation:

Carbon content increases with depth. For example, the carbon content found at 0 m depth is 2000 ppm, but increases to 2200 ppm at 1000 m depth.

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write

Answers

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

a student completes a pet experiment using chloroplasts from leaves lacking pigments that absorb in the 550 nm to 600 nm wavelength range. which color of light should they avoid in their experiment if they want to measure activity at different wavelengths?

Answers

The student should avoid using yellow light, which has wavelength around 550-580, which will not get absorbed at all since the pigment absorbing this wavelength is missing

Color Wavelength (nm)

Red        650 - 800

Orange   590 - 640

Yellow   550 - 580

Blue   460 - 480

Indigo   440 - 450

Violet   390 - 430

The distance over which a periodic wave's form repeats is known as the wavelength in physics.  It is a property of both traveling waves and standing waves as well as other spatial wave patterns.

It is the distance between two successive corresponding locations of the same phase on the wave, such as two nearby crests, troughs, or zero crossings. The spatial frequency is the reciprocal of wavelength. The Greek letter lambda () is frequently used to represent wavelength.

learn more about wavelengths

https://brainly.com/question/19448078

#SPJ4

Full Question :A student completes a PET experiment using chloroplasts from leaves lacking pigments that absorb in the 550 nm to 600 nm wavelength range. Which color of light should they avoid in their experiment if they want to measure activity at different wavelengths? Absorbance 360 760 460560660 Wavelength (nm)

O Blue

O Orange

O Yellow

O Red

O Violet

Which statement best describes how a major change in the size of one population affects an ecosystem?

a. It will immediately kill every population and the physical conditions.
b. It would not affect the physical conditions nor any populations.
c. It will affect the physical conditions, but not the other populations.
d. It affects every population, not the physical conditions.

Answers

  this a simple question over worded to increase error

A. is obviusly no it

B. is saying nothing will happen which is incorrect

C. is saying like trees would shrink or weather would be bad

D. is correct because if there is more a certain creature it will over eat its prey

The atomic number of krypton is 36. If the mass number of a krypton atom is 84, which table shows the number of subatomic particles inside and outside the nucleus of the krypton atom?

Answers

Answer:

A

Explanation:

In the planetary model, there is a nucleus with protons and neutrons, surrounded by orbits with electrons. In the krypton representation, there are 84 subatomic particles inside the nucleus and 36 outside.

---------------------------------------------------

The representation of an element includes a superior number that indicates the massic number, and an inferior number that indicates the atomic number.

We need to know that every atom is identified by its number of protons and neutrons. So,  

Representation ⇒ ᵃ X ₀

Where  

X is the element  

a is representing the massic number, which is defined as the sum of the number of protons and the number of neutrons.  

z is the atomic number, which is the number of protons ⇒ represented as  0 above

In electrically neutral atoms, the number of protons equals the number of electrons. This means that the atomic number also indicates the number of electrons.

We will call n to the number of neutrons, which equals a - z

So, what you need to know is that  

• Nº of protons = Atomic number → z  

• Nº of neutrons = Massic number - Atomic number → n = a - z  

• Nº of Electrons = Nº of protons = Atomic number → z

When representing these atom structures using the planetary model, there must be a nucleus surrounded by orbits.

In the nucleus there are protons and neutrons. In the orbits, there are electrons in different energetic levels.

• Nucleus → Protons + Neutrons → circle indicating number of P⁺ + N⁰

• Orbits → Around the nucleus → Following the energy levels

The energy levels indicate how many electrons, e⁻, maximum must be placed per level -orbit- → seven levels

In the exposed example, we have,

Element ⇒   KryptonAtomic number, z ⇒ 36 ⇒  Nº of protonsMassic number, a ⇒ 84  ⇒ Nº of neutrons + Nº protons

We know that the atomic number = number of protons = number of electrons, so  

• Nº of neutrons = Massic number - Atomic number → 84 - 36 = 48

• Nº of Electrons = Nº of protons = Atomic number → 36

According to the framework, we might assume that in a planetary model  representation, there are 84 subatomic particles inside the nucleus, and 36 subatomic particles outside.

• Inside the Nucleus → Protons + Neutrons → 48 + 36 = 84

• Outside the nucleus (Orbits) → Electrons → 36

-----------------------------------

Related link: https://brainly.com/question/10114170?referrer=searchResults

When a warm front is approaching, what happens?
A. advancing cold air pushes up and over retreating warm air causing warm temperatures and mild rain
B. advancing cold air pushes up and over retreating warm air causing warm temperatures and mild rain

Answers

Answer:

B?

Explanation:

if warm temp is coming then cold air pushes over warm air causing warm temp

When a warm front is approaching then advancing cold air pushes up and over retreating warm air causing warm temperatures and mild rain. Option A is correct.

A warm front is a boundary between warm and cold air masses. When a warm front approaches, the warm air mass is forced to rise over the cold air mass. This causes the warm air to cool and condense, which produces clouds and rain. The rain is usually light and steady, and the temperatures are mild.

The warm air mass is less dense than the cold air mass, so it rises up over the cold air mass. As the warm air rises, it cools and condenses, forming clouds. The clouds produce light, steady rain as the warm air continues to rise. The temperatures are usually mild during a warm front, as the warm air mass is slowly mixing with the cold air mass. Option A is correct.

To know more about the Warm air, here

https://brainly.com/question/29516275

#SPJ2

¿Qué le pasaría a cualquier especie si no pudiera heredar las características que permiten la supervivencia y adaptación?

Answers

Answer:

It would die ,without the needed skills and characteristics to live in a specific environment


During meiotic cell division,_____daughter cells are produced that are genetically___
their parent cell.

Answers

Answer:

During meiotic cell division, two daughter cells are produced that genetically identical to their parent cell.

Explanation:

I Hope This Is What You Were Looking For!

-Jusitn:)

Answer:

During meiotic cell division, four

daughter cells are produced that are genetically different from

their parent cell.

Explanation:

Why can’t we send cactuses out too mars? It’s has a form of water at night time and the plant doesn’t need that much water and since it’s a plant it can turn the 95% carbon dioxide in to oxygen? Right?

Answers

Answer:

It is very possible for a plant to grow on mars, but you would need better soil, because mars' soil is filled with perchlorate salt which is toxic to plants. You would also need to conceal the plant, because the temperatures on mars are usually freezing. But yes, you could have a cactus on mars, it would just be very difficult to sustain.

Explanation:

Answer:

In response to what another user said, I would suggest bringing fertilized soil to Mars, placing it on the surface of the soil, and planting the cactus.

Formula una hipótesis acerca de las posibles presiones ambientales que han influido en la evolución del frailejón.

Answers

Answer:

''El cambio de presión ambiental es responsable de la evolución del frailejón''.

Explicación:

'' El cambio de presión ambiental es responsable de la evolución del frailejón.'' El frailejón es una planta que se encuentra en peligro por la destrucción del páramo con fines agrícolas. El páramo es un ecosistema único de gran altitud que se encuentra solo en los Andes de Ecuador, Perú, Colombia y América Central. Este tipo de ecosistema se encuentra por encima de los 10,000 pies y por debajo de los 16,000 pies. La presión ambiental sobre el páramo es menor debido a la ausencia de gases.

what state of matter is ice ? A, element B. gas C. liquid D. solid

Answers

Ice is a solid state of matter


5. At one time, interphase was referred to as the
resting phase of the cell cycle. Why do you think
this description is no longer used?

Answers

Answer:

ddddddddddddddddddddddddddddddddd

Explanation:

a neuron membrain potential moves from -90 mvto 80mv in response to a brief stimulation what would we call this change in potential

Answers

Neuron membrane potential moves from -90 mv to -80mv in response to a brief stimulation, we would call this change in potential as:  Depolarization.

What is depolarization of neuron?

A depolarization refers to the movement of resting membrane potential in a more positive direction. In neurons, rapid rise in potential, that is depolarization, is an all-or-nothing event that is initiated by opening of sodium ion channels in the plasma membrane. The subsequent return to resting potential, that is repolarization, is mediated by the opening of potassium ion channels.

In biology, depolarization is a change within a cell, during which a cell undergoes shift in electric charge distribution, resulting in less negative charge inside the cell as compared to the outside.

To know more about depolarization, refer

https://brainly.com/question/14692094

#SPJ4

Note : The question is not complete. here is the complete question.

Question: A neuron membrane potential moves from -90 mv to -80mv in response to a brief stimulation. What would we call this change in potential?

A plant can produce either purple flowers or white flowers. The purple flower color is dominant over the white flower color. What is the ratio of the offspring with purple flowers to the total number of offspring if two plants that are heterozygous for purple flowers are crossed?

Answers

One or two purple alleles in flowering pea plants will result in purple blooms.  so there will be 50 percent ratio. This is because one purple gene causes enough pigment to be synthesized to produce all purple flowers.

What is dominant allele?

A dominant allele is a variant of a gene that causes a specific trait even when other alleles are present. A functional protein is usually encoded by a dominant allele. Because one copy of the allele produces enough enzyme to furnish a cell with plenty of a given product, it is dominant.

As a result, the purple allele has a dominant role, while the white allele has a recessive role.

For more information regarding dominant allele, visit:

https://brainly.com/question/2717245

#SPJ1

In the space below label the part of the flower. Identify if it is male, female or neither.
Anther:
Filament:
Ovary:
Petal:
Pistil:
Stamen:
Stem:
Stigma:
Style:

Answers

Answer:

Anther: Male

Filament: Male

Ovary: Female

Petal: Neither

Pistil: female

Stamen:male

Stem: Neither

Stigma: Female

Style: Female

Explanation:

Hopes this help you

answer pls will give brainlists
Describe the results from the following base mutations; substitution, insertion, and deletion.

Answers

Substitutions are base mutations where occurs replacement, insertion refers to the add bases and deletion is when nucleotide bases are removed.

What is a mutation?

A mutation is the alteration of the linear order of nucleotides in the genome of a given organism. Deletion occurs when nucleotides are eliminated from the chain, insertions refer to the emergence of new nucleotides that enlarges the chain and substitution refers to the replacement of nucleotides such as for example adenine for thymine.

Therefore, with this data, we can see that mutations can produce different phenomena which include insertions, deletions and substitutions.

Learn more about mutations here:

https://brainly.com/question/19982338

#SPJ1

Multiple sequence alignment is a method that can be used to compare three or more biological sequences to determine homology and evolutionary relationships between species. This is done by selecting a target protein or DNA sequence (consensus) and comparing it across other species’ sequences. Conservation is a statistical analysis that describes how much the target sequence is observed across the selected group of species. A higher conservation score indicates that the protein or gene is more ancient or more critical across species.
Construct a cladogram using the multiple alignment of a protein sequence found below.

Multiple sequence alignment is a method that can be used to compare three or more biological sequences

Answers

Answer:

here is the answer key

Explanation:

if lactose is present,would the lac operon in bacterial cell be on or off? Explain

Answers

Explanation:

The lac operon

When lactose is present, bacteria need the enzymes to break it down. But if no lactose is present, bacteria do not need to waste resources making enzymes to break down a sugar that isn't there. Like a switch, the operon is turned on when the enzymes are needed.

Lean tissue contains a greater percentage of fluid compared with fat tissue. True or false

Answers

True. Lean tissue contains a greater percentage of fluid compared to fat tissue.

Lean tissue, which includes muscles, organs, and other non-adipose tissues, contains a higher percentage of fluid compared to fat tissue. This is because lean tissue is composed of cells that are metabolically active and require a higher water content for their proper functioning.

Water is a crucial component of lean tissue as it is involved in various physiological processes, including nutrient transport, waste removal, and temperature regulation. Muscles, in particular, have a high water content, accounting for approximately 75% of their total weight.

In contrast, fat tissue, also known as adipose tissue, contains a lower percentage of fluid. Adipose tissue is primarily composed of adipocytes, which store triglycerides for energy storage. While adipose tissue does contain some water, it has a lower water content compared to lean tissue.

Overall, due to its higher cellular activity and metabolic demands, lean tissue contains a greater percentage of fluid compared to fat tissue.

Learn more about lean tissue here:

https://brainly.com/question/32295405

#SPJ11

Which of the following statements about chemiosmosis is NOT true?

Hydrogen ions move down the concentration gradient.

It is caused by a higher concentration of protons on one side of the membrane.

Energy is used as protons pass through the ATP Synthase.

A net of 38 ATP is produced from each glucose molecule.

Next question-

Cellular respiration

has carbon dioxide and water as waste products

forms glucose and oxygen.

results in the formation of ADP.

occurs in the chloroplast

Answers

Answer:

I don't know the answer to the first one, but I can answer the second question. Cellular respiration has carbon dioxide and water as waste products.

Explanation:

Cellular respiration does not form glucose & oxygen and doesn't occur in the chloroplast, but does form ATP energy, carbon dioxide, & water and the process occurs in mitochondria. Photosynthesis on the other hand forms glucose & oxygen and does occur in the chloroplast.

Other Questions
If the weight of a package is multiplied by 3/4 The result is 69 pounds. Find the weight of the package Solve for c. 3(c + 2) = 9 C= What are the dangers of antibiotic-resistant bacteria to humans? what is happening to our most potent antibiotics?. Identify the y-intercept for the equation: y=2x+50 How many solutions does this equation have?2m 2m = 4m The following data give the total food expenditures (in dollars) for the past one month for a sample of 20 families. 1112 530 1225 583 424 869 1480 682 1282 1197 921 1114 723 1062 922 1630 1043 2165 1353 457 a. Calculate the values of the three quartiles and the interquartile range. Q1 how to use potassium clorate, sulphur ,starch and glue these chemicals You need to borrow 20,000 for a total of 10 years. You have two options. Thefirst option is to use a credit card with interest rate compounded monthly. Thesecond option is a loan with interest rate compounded yearly and APR (annualpercentage rate) equal to 2%. What is the credit card daily interest rate that wouldmake the second option more attractive than the first one How to write a scratch program on asking for favourite colour and print. what type of advertising is considered good at creating awareness and credibility for a business firm at relatively low cost? I need an answer asap!!!!!! What is (4 4/7) divided by 1/2? After 10 years, theprincipal on thismortgage is $87,557.How much of the nextpayment will gotowards interest? In photosynthesis --------- energy is converted into ------------------ energy 2019 2018 2017 2016 2015 Sales $ 672,736 $ 439,697 $ 356,030 $ 248,972 $ 185,800 Cost of goods sold 352,273 230,192 188,636 130,765 96,616 Accounts receivable 32,426 25,722 24,388 14,540 12,746 Compute trend percents for the above accounts, using 2015 as the base year. octopuses and squids are part of the phylum mollusca. they both have a large brain and highly developed eyes. What other characteristic is common to these two animals? Which is a benefit of getting information from a government website? A. The information usually advocates an individual's opinion. B. The information will be reliable. C. The information will be easy to understand. Seeking Ivy Fertilizer, Inc. (SIF, Inc.) anticipates reaching a sales level of $1,460,000 in one year. The company expects earnings after taxes during the next year to equal $359,000. During the past several years, the company has been paying $81,000 in dividends to its stockholders. The company expects to continue this policy for at least the next year. The actual balance sheet and income statement for SIF, Inc. during 2018 are below. Seeking Ivy Fertilizer, Inc. Balance Sheet as of December 31, 2018 (in dollars) Cash 350,000 Accounts payable 350,000 Accounts receivable 220,000 Notes payable 180,000 Inventories 555,000 Long-term debt 480,000 Fixed assets, net 950,000 Stockholders' equity 1,065,000 Total assets 2,075,000 Total liabilities and equity 2,075,000 Income Statement for the Year Ending December 31, 2018 (in dollars) Sales 1,200,000 Expenses, including interest and taxes 900,000 Earnings after taxes 300,000 Using the percentage of sales method, calculate the additional financing that SIF, Inc. will need over the next year to fund sales growth plans. Round your answer to the nearest dollar. a firm that enters foreign markets by exporting goods to another country is at the ________ level of global participation. FILL IN THE BLANK. in 1892, __________ in coeur d'alene, idaho, struck for higher wages. first answer gets brainliest