Complete the following sentence.
A qualified landscape architect will usually hold a college degree, may hold an advanced degree, and will often hold a ________ bestowed by a state board.

Answers

Answer 1

Answer:

bachelor's degree : ) it says my answer needs to be longer for some reason so here you go I guess lol


Related Questions

Hail starts as liquid water and then is swept up and down in the clouds, building
many solid layers before it falls to Earth.
True
False

Answers

Answer:

It will be true.

Explanation:

N/A

Answer:

true

Explanation:

hail is a firm if solid precipitation.

What is the relationship between amino acid sequences in proteins and nucleotide sequences in DNA?

Answers

The nucleotide sequence of a gene is transcribed into a nucleotide sequence of mRNA which is a template of DNA, which is read during translation in groups of three nucleotides that specify each amino acid.

The process through which a gene's information is utilized to create proteins is known as gene expression. Transcription and translation are two mechanisms involved in gene expression.

DNA is utilized as a template during transcription to create the sequence of mRNA.

A specific amino acid is designated by a codon, which is a group of three nucleotide bases that are read from the mRNA sequence during translation.

The nucleotide sequence of a gene is translated into a nucleotide sequence of messenger RNA (mRNA), which is read during translation in groups of three nucleotides that determine each amino acid. This is the link between a gene and a protein.

To learn more about gene expression please click on the given link: https://brainly.com/question/3533860

#SPJ4

I'm pretty sure its D but just to be sure-

Weddell seals live in the hard, cold environment of Antarctica.
Which result is a goal of homeostasis in Weddell seals?
A successful reproduction
B camouflage from predators
C successful hunting of fish
D constant body temperature​

Answers

D is the correct answer

Answer:

D

Explanation:

I took the quiz.

What is the relationship between an individual and a community?
What characteristics define a population?
Why is the distinction between a community and an ecosystem important to ecologists?

Review
Define species.
What is an ecosystem?
Define population. How is a population different from a community?

Answers

Answer:

A population is a group of organisms belonging to the same species that live in the same area and interact with one another. A community is all of the populations of different species that live in the same area and interact with one another.

A typical leaf is composed of multiple layers of specialized cells. What is the correct order of layers starting on the upper surface of the leaf and progressing to the lower surface?

Answers

Answer: cuticle - epidermis - palisade mesophyll - spongy mesophyll- epidermis - cuticle

Explanation:

Which two processes are the primary sources of genetic variation?
mitosis and fertilization
synapsis and disjunction
mutation and recombination
overpopulation and reproduction

Answers

Answer:

mutation and recombination

Explanation:

Genetic variation can be caused by mutation (which can create entirely new alleles in a population), random mating, random fertilization, and recombination between homologous chromosomes during meiosis (which reshuffles alleles within an organism's offspring).

20. Which macromolecule is structure A composed of and what is its function?

A.) Carbohydrates - makes quick energy

B.) Lipid - makos fats

C.) Nucleic acid - makes genetic material

D.) Protein- facilitates diffusion

20. Which macromolecule is structure A composed of and what is its function?A.) Carbohydrates - makes

Answers

The awnser is D... I hope this helps

The structure A is a PROTEIN, it is composed of amino acids and its function is to facilitate diffusion (option D).

Channels and/or carriers are specific membrane proteins that enable the movement of molecules across biological membranes.

In facilitated diffusion, specific carriers enable the passage of molecules across biological membranes in favor of a concentration gradient, ie., from a region of high concentration to a region of low concentration.

For example, aquaporins are membrane proteins (carriers) used by cells to allow the passage of water molecules across biological membranes.

In conclusion, structure A is a PROTEIN, it is composed of amino acids and its function is to facilitate diffusion (option D).

Learn more in:

https://brainly.com/question/1242765

Which of the following pairs of reproductive strategies is consistent with energetic trade-off and reproductive success?
A) Pioneer species of plants produce many very small, highly airborne seeds, whereas large elephants that are very good parents produce many offspring.
B) Female rabbits that suffer high predation rates may produce several litters per breeding season, and coconuts produce few fruits, but most survive when they encounter proper growing conditions.
C) Species that have to broadcast to distant habitats tend to produce seeds with heavy protective seed coats, and animals that are caring parents produce fewer offspring with lower infant mortality.
D) Free-living insects lay thousands of eggs and provide no parental care, whereas flowers take good care of their seeds until they are ready to germinate.
E) Some mammals will not reproduce when environmental resources are low so they can survive until conditions get better, and plants that produce many small seeds are likely found in stable environments.

Answers

The reproductive strategy that is consistent with energetic trade-off and reproductive success is C) species that have to broadcast to distant habitats tend to produce seeds with heavy protective seed coats, and animals that are caring parents produce fewer offspring with lower infant mortality.

This strategy involves a trade-off between the amount and quality of offspring. In this strategy, species with protective seed coats invest more energy in protecting their offspring from harsh environments while reducing the number of offspring.

On the other hand, species that are caring parents invest more energy in nurturing their offspring, thereby increasing the chances of survival, but reducing the number of offspring they produce.

Both strategies are consistent with energetic trade-offs and reproductive success because they balance investment in offspring quantity and quality.

This ensures that the species has a good chance of producing viable offspring that will survive to reproductive age and pass on their genes to the next generation. Therefore, the correct answer is C.

For more such answers on  reproductive strategy

https://brainly.com/question/12935418

#SPJ11

in contrast to natural ecosystems, the flow of materials in human-engineered ecosystems, like universities, is mostly _______.

Answers

In contrast to natural ecosystems, the flow of materials in human-engineered ecosystems, like universities, is mostly linear.

In a natural ecosystem, waste products are used as resources by other organisms or activities in a circular or cyclical pattern. Consequently, a stable and balanced system is produced. However, the material flow is primarily linear in ecosystems that have been built by humans, such as colleges.

Without a major feedback loop for recycling or reusing, resources are frequently collected, processed, consumed, and then thrown as trash. This linear flow causes a higher use of resources, more waste to be produced, and more environmental stress. In these human-engineered ecosystems, efforts are being made to transition toward more sustainable practices and circular economy concepts in order to reduce environmental effect.

To know more about ecosystems here https://brainly.com/question/30187156

#SPJ4

The digestion of food molecules is a what type of process?

Answers

Answer:

Explanation:

Catabolic

Answer: Digestive Processes

Explanation: The processes of digestion incorporate six activities: ingestion, propulsion, mechanical or physical digestion, chemical digestion, assimilation, and defecation. The primary of these forms, ingestion, alludes to the passage of food into the nutritious canal through the mouth.

Question 22 of 34
How does a fetus receive nutrients before birth?
A. Directly from the mother's digestive system
OB. Through the umbilical cord
OC. The fetus doesn't need any nutrients until birth.
OD. By drinking amniotic fluid

Answers

Answer:0B

Explanation:it receives it through the umbilical cord

The division of the autonomic nervous system that is short‐lived and very localized is.

Answers

The division of the autonomic nervous that is short-lived and very localized is parasympathetic system.

What is nervous system?
The nervous system includes the brain, spinal cord, and a complex network of nerves. This system sends messages back and forth between the brain and the body. The brain is what controls all the body's functions. The spinal cord runs from the brain down through the back. The parasympathetic nervous system predominates in quiet “rest and digest” conditions while the sympathetic nervous system drives the “fight or flight” response in stressful situations.

The main purpose of the PNS is to conserve energy to be used later and to regulate bodily functions like digestion and urination.

To learn more nervous system, click the link below:
https://brainly.com/question/12961611
#SPJ4

A current-carrying wire is positioned vertically. The current in the wire is moving upward. If you move a compass slowly around the wire, how would the direction of the compass needle change?

A.
The compass always points in the same direction.
B.
The compass needle would rotate clockwise.
C.
The compass needle would rotate counterclockwise.
D.
The compass needle would spin erratically.

Answers

im pretty sure its D

PLS help me ill give you brainliest!!!!
Which statement would be used in an argument against the use of human embryonic stem cells for therapy?

A.Obtaining embryonic stem cells for use in therapy requires the destruction of embryos.

B.Embryonic stem cells are limited in their ability to become different types of cells.

C.It is difficult to grow embryonic stem cells in laboratory cultures, so they are not a practical choice for stem cell therapy.

D.Embryonic stem cells originate in plants, so the likelihood of rejection by a patient’s body is high.

Answers

Answer:

A. Obtaining embryonic stem cells for use in therapy requires the destruction of embryos.

Explanation:

What describes the action of an endocrine disruptor?

Answers

An endocrine disruptor is a substance that interferes with the normal functioning of the endocrine system.

The endocrine system is the system of glands that produce and secrete hormones that regulate various bodily functions, including growth, metabolism, and sexual function. Endocrine disruptors can mimic natural hormones or interfere with the production, transport, or breakdown of hormones, leading to an imbalance in the body's hormone levels, resulting in a variety of health effects, including developmental and reproductive problems, cancer, and immune and neurological disorders. Examples of endocrine disruptors include certain chemicals found in plastics, pesticides, and personal care products, as well as environmental pollutants.

To learn more about endocrine disruptor visit: https://brainly.com/question/15832364

#SPJ4

If a rock was determined to be around 3.9 billion years old how much Potassium 40 would be left in that rock sample? (Percentage of Potassium 40)

Answers

What percent of potassium-40 remains undecayed in a rock that is 3.9 billion years old? The 3.9 billion year old rock has undergone three half-lives (3.9 divided by 1.3 = 3). After 3 half-lives, 12.5% of the potassium-40 remains undecayed.

Which of the following is a problem faced by the global economy? A. Decreasing cost of renewable resources O B. Increasing greenhouse gas emissions C. Increasing environmental awareness D. Decreasing human population​

Answers

Answer:

B. Increasing greenhouse gas emissions

Explanation:

Increasing greenhouse gas emission leads to the global warming which is not only harmful for environment but also harmful for global economy.

Increasing emission of greenhouse gases rises the CO2 levels in the atmosphere which lowers the nutritional value of crops and highly affects the agricultural economy of the globally.

Greenhouse gases increases demand of space cooling which eventually decrease the demand for space heating, which is very costly.

Increasing emission of greenhouse gases has direct impact on climate change and climate change has indirect impact on several sectors which affect economy globally such as mining, manufacturing, trade, and finance.

Hence, the correct answer is "B. Increasing greenhouse gas emissions".

What occurs when an asexual growth of a clonal individual begins to grow directly from a parent?A) Binary fissionB) FragmentationC) BuddingD) Regeneration

Answers

The correct answer is C) Budding. This process refers to the development of biological mass, that later

The presence of branchial clefts in a human embryo suggests

Answers

Humans, as an embryo, temporarily have gills.

Branchial clefts are often a common birth defect and are actually looked at as “human gills” for a small period of time until they develop further into the jaw and inner ear bones. If they do not change into those two structures, the lesions can take the form of cysts and form in the neck or just below the collarbone, causing infection that could soon seep out of the skin.

1. What part of science do you think the young woman in the picture is involved in? Why?

1. What part of science do you think the young woman in the picture is involved in? Why?

Answers

The woman is observing the trees

In sexual reproduction, will an offspring show a recessive trait if just one of its parents has recessive alleles for that trait? Explain your answer.

Answers

Answer:

No, they will not

Explanation:

In this question, we assume that the parents have genotypes of rr and RR (I use "r" out of convenience). If we cross both of these parents, it is impossible for any of the offspring to be rr like the one parent. They would all be heterozygous. If the other parent had a single recessive allele, then it would be possible.  

Hope this helps!

You notice that some squirrels in your neighborhood have a much darker coat color than most of the other squirrels. Is this darker color an adaptation

Answers

Answer:

Yes, it is an adaptation.

Explanation:

The squirrels with the darker coat color may have adapted to fit in with the surroundings, like if your neighborhood had darker colored tree bark. There is also the possibility that they adapted to avoid predators, such as stray cats and dogs (which would mean that they adapted to become less visible to their attacker).

the scientific study of organisms with the ultimate goal of characterizing and arranging them in an orderly manner is

Answers

The scientific study of organisms with the ultimate goal of characterizing and arranging them in an orderly manner is systematics.

In the field of biology, systematics can be described as the study of the different forms of organisms, present both in the past and present, and their relationships with each other.

The organisms are characterized based on the similarities and differences that are present in them over time and arranged accordingly. The organisms that have more similar characteristics are arranged closer in order than organisms that do not have many similar characteristics.

Systematics helps to make it possible to study the various similarities and differences that exist between different organisms. It also helps in determining the evolutionary relationships between organisms.

To learn more about systematics, click here:

https://brainly.com/question/1358940

#SPJ4

1.)What is wave?
2.)What is medium?
3.)What do waves transport from one location to another without actually displacing matter from one
location to another?
4.) What are some mediums sound waves can travel through?
5.) What kind of wave does not require a medium to transport energy from one location to another?
6.) Describe how you think a sound wave propagates (travels) through air.
7.) Why is there no sound in space?

Answers

1) A transfer of energy
2) A substance that a wave travels through
3) Energy
4) Water,air,a wall
5) Light wave
6) It vibrates the air particles and sends a sound wave in that general direction
7) Because there is no medium for the sound waves to vibrate

Hope this helps! :)

Explain how a population of insects could become resistant to a pesticide.

Answers

Answer:

adaptation

Explanation:

A population of insects could adapt and evolve to be resistant to a pesticide.

Adaption- survival of the fittest those that do not die from the pesticide are resistant so when they reproduce their offspring will carry the resistance gene and more reproduction will occur allowing the whole population of insects to be resistant.

Chemosynthetic
bacteria
Symbiotic
bacteria
Which organisms are both secondary and tertiary consumers in this food web?
A Chemosynthetic bacteria and amphipods
B Zooplankton and mussels
C Ratfish and octopuses
D Galatheid crabs and zoarcid fish
D
B
O

Answers

Answer:

C. Ratfish and octopuses

Explanation:

Ratfish and octopuses are the organisms which are considered as secondary and tertiary consumers in this food web because Ratfish is a secondary consumer that feeds on primary consumer while on the other hand, octopuses is considered a tertiary consumer that feeds on secondary consumers so that's why both  organisms which are considered as secondary and tertiary consumers in this food web.

which cell parts are responsible for moving proteins?

Answers

Endoplasmic Reticulum aka the ER :)

Create a third column in your spreadsheet labeled, "Actual Temperature. " Creat a formula that’s will fill the third column with actually temperature data for each month. Double check your formula and data analysis by completing the modified table in the answer space

Answers

The formula used to calculate the actual temperature for each month is the anomaly value plus the average temperature from the year 1880.

13.8°C is the average temperature from 1880. Hence, "Anomaly Value + 13.8°C" is the formula used to determine the actual temperature.

The third column in the spreadsheet marked "Actual Temperature" was filled using this formula.

For example, in the example table provided, the actual temperature for 1880 is 13.82°C (13.8°C + -0.08°C), for 1900 is 13.51°C (13.8°C + -0.39°C), for 1940 is 14.13°C (13.8°C + 0.23°C), and for 2000 is 14.22°C (13.8°C + 0.33°C).

By populating the amended database with the accurate real temperature values, this formula was verified twice.

Complete Question:

Create a third column in your spreadsheet labelled, "Actual Temperature. " Create a formula that will fill the third column with actually temperature data for each month. Double check your formula and data analysis by completing the modified table in the answer space

Year                       Anomaly Value                          Actual temperature

1880                       -0.08                                                                 13.82

1900                        0.03

                              -0.39                                                                   13.51

1940                                            

1960                        0.23                                                                  14.13

2000                       0.33                                                                  14.22

To learn more about temperature visit:

https://brainly.com/question/1311968

#SPJ4

As a result of the development shown on this graph, prices should.

Answers

Answer:

The full question please? I'll answer it

Answer:

fall

Explanation:

edge

Question 4
Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has a
traditional start codon.
How many amino acids long is the peptide if we assume traditional start and traditional stop
codon?
5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
3
5
6
9

Answers

Transcription is mRNA synthesis, which occurs by complementing a segment of the DNA template strand. The translation is the protein growth, which occurs by adding amino acids coded by mRNA codons. C) the polypeptide is 6 amino acids long.  

What are transcription and translation?

The whole process of protein synthesis includes Transcription and translation.

TRANSCRIPTION

Transcription is the mRNA synthesis process and occurs in the nucleus.

The DNA template strand is read in direction 3'→ 5' to build the mRNA molecule in direction 5'→ 3'. The template strand is the one that is going to be complemented by the mRNA.

mRNA molecule has the same sequence as the DNA coding strand, but it carries uracil instead of thymine.

TRANSLATION

Translation is the process through which polypeptide grows. It occurs in the cytoplasm.

rRNA and tRNA read mRNA in the direction 5'→ 3' and add the correct amino acids to build the new protein.

Amino acids are coded by mRNA codons. Protein synthesis initiates in the AUG start codon -Metionin- and ends when reaching either of the stop codons UAA, UAG, or UGA.

In the exposed example, we have a DNA strand. We know that it is the coding strand, so it has the same sequence as mRNA molecule.

DNA coding strand

5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'

mRNA molecule

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

Kowing mRNA sequence, we can grow the protein.

So first, we need to find the initiation codon (AUG), begining from the mRNA 5' extreme. Then we need to find a stop codon (UAA, UAG, or UGA).

mRNA start codon

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

mRNA stop codon

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

So this protein begins in AUG and ends in UAA.

To grow the protein, we need to separate mRNA codons and find the corresponding amino acids.

mRNA codons ⇒ AUG   ACC   GUU   UGG   AAA   CAC   UAA     amino acids ⇒  Met    Thr      Val     Trp      Lys      His    Stop               Protein ⇒ Met-Thr-Val-Trp-Lys-His

According to this reasoning, the polypeptide is 6 amino acids long. Option C) is correct.

You can learn more about protein synthesis at

https://brainly.com/question/16305501

#SPJ1

Other Questions
Convert 46.1031 to 4 significant figures CA SE on warranty: John sold a pair of skis to Bob, making no specific warranties or promises of any kind other than letting Bob examine and try them. In fact, John did not own the skis; he had only rented them. When the true owner claimed them, Bob demanded his money back. John defended his actions by stating that he had made no warranty of any kind. There was no paper with authorized signature. a) Demonstrate your knowledge about implied warranty of title from the above case? b) Suggest a solution to make express warranty clearer. Write the equation of a line that passes through the points ( 2 , - 5 ) and ( 8 , - 2 ). Why important to be knowledgeable of the concept and importance of public information Badri makes the table below to review the factors that affect the electric force between objects. a 2-column table with 2 rows. the first column labeled factor has entries distance, mass. the second column labeled relationship to strength of electric force has entries indirect, direct. which change will correct the error in badris table? changing "direct" to "indirect" changing "indirect" to "direct" changing "distance" to "amount of electric charge" changing "mass" to "amount of electric charge" Angel and Jaden were at track practice. The track is 2/5 kilometers around.Angel ran 1 lap in 2 minutes.Jayden ran 3 laps in 5 minutesHow many minutes does it take Jayden to run 1 kilometer? competitive click-fraud is a computer crime where a competitor or disgruntled employee increases a companys search advertising costs by repeatedly clicking on the advertisers link. what type of fossilization preserves the greatest amount ofspecimen and its history (hair, soft tissue, stomach contents,pollen)?A.FreezingB. BurialC. PetrificationD. Dessication HELP PLEASE points Savanah is shopping for planters for her new plants. Which measurement should she use to determine how much soil each planter will hold?A. AreaB. DepthC. PerimeterD. Volume What does it mean to contain a full second energy level?Why?Example Which two reasons did the senate cite when rejecting the treaty of versailles? homer's parenting style is very relaxed; he just lets his kids do whatever they want. according to the textbook, which parenting style is homer using? A company pays $5,000 for equipment. Annual depreciation on the equipment is $500. What is the book value of the equipment at the end of Year 2?a. $4,000b. $5,000c. $6,000d. $3,000 144. Sustainability programs often find their success beyond company boundaries, thus ______ systems and _____ metrics cannot capture all of the relevant numbers.A. external; bioB. internal; processC. external; externalD. internal; internal 18 students each collected the same number of Cans for a project. If the students collected a total of 306 cans, how many cans did each student Collect? A large multiplex movie house has many theaters. The largest theater has 35 rows. There are 13 seats in the first row. Each row has two seats more than theprevious row. How many total seats are there in this theater?There areseats in the theater Find slope and y-InterceptWrite equationHelp please!! Domain and range of this graph What is the partial fraction decomposition, I know D is wrong 7. HCIO (aq) + NO (g) C1 (aq) + HNO2 (aq) (acidic solution)