Consider the following production economy. There are two consumers and one producer. Consumer's consumption sets are R
+
2

. The production possibility set Y is described by Y={y∣max(2y
1

+y
2

,y
1

+2y
2

)≤0}. Consumers have an equal share of the firm, and have endowments of e
1

=(2,1)=e
2

. Consumer 1's preferences are described by u
1

(x
11

,x
12

)=x
11

−x
12

and consumer 2 's preferences are described by u
2

(x
21

,x
22

)= x
21

−x
22

. Does this economy satisfy the conditions for existence of a Walrasian equilibrium that we discussed in the class? If there exists an equilibrium, identify it. If not, argue that one does not exist.

Answers

Answer 1

This economy does not satisfy the conditions for the existence of a Walrasian equilibrium due to the violation of convexity in the production possibility set.

The conditions for the existence of a Walrasian equilibrium include non-satiation, convexity of preferences, local nonsatiation, and Pareto efficiency. While consumers' preferences in this economy satisfy the necessary conditions, the production possibility set Y violates convexity. The set is defined as Y = {y | max(2y1 + y2, y1 + 2y2) ≤ 0}, which is non-convex. This means that it does not exhibit a diminishing marginal rate of substitution between the two goods. As a result, the economy fails to meet the convexity condition required for the existence of a Walrasian equilibrium. Therefore, a Walrasian equilibrium does not exist in this particular production economy.

Learn more about production here;

https://brainly.com/question/31859289

#SPJ11


Related Questions

ASAP I WILL GIVE BRAINLEST AND ILL PAY YOU

In 2016, Maria travels to Italy and exchanges $1000 for 800 euros, the next year she returns and exchanges $1000 for 750 euros. She concludes that...

the euro has depreciated relative to the dollar.

the dollar had depreciated relative to the euro.

the dollar has appreciated relative to the euro.

Answers

Answer:

The dollar has depreciated relative to the euro

Explanation:

If I exchange you a lesser amount of money in U.S. currency for a bigger amount in Euros when trading money, that means the value of my money is more. So if I were to exchange $1000 for 750 euros instead of 800 euros, the value of a euro eithed went up or the value of a U.S. dollar went down

What are federal income taxes?

Answers

Answer:

Federal tax is the money used by the government of a country to pay for the growth and upkeep of the country. Some look at federal tax as "rent"

Explanation:

Income taxes im the United States are imposed by the federal government and most states

Income taxes are determined by applying a tax rate, which may increases, to texable income, which is the total income less allowable deductions.

In the course of a telephone conversation on May1, Ed tells Ida he will sell his car to her for $400. Ida says: "I need some time to think it over" and Ed says "sure, let me know by May 10"
a. Ed can revoke this offer prior to January 10.
b. Ed cannot revoke this offer.
c. An offer has not been made because the terms were orally stated over the telephone.
d. None of the above.

Answers

The correct answer is (b) Ed cannot revoke this offer.

When Ed made the offer to sell his car to Ida for $400 during their telephone conversation, he created a legally binding offer. By stating a specific price and giving Ida a deadline to respond by May 10, Ed demonstrated his intention to enter into a contract with Ida.

In this case, Ida's response of needing time to think it over does not constitute a rejection of the offer but rather a request for further consideration. Since Ed did not specify that the offer could be revoked before May 10, he is legally bound to keep the offer open until that date. Therefore, Ed cannot revoke the offer prior to May 10.

To know more about ED :

brainly.com/question/15795080

#SPJ11

co. uses the high-low method to derive a total cost formula. using a range of units produced from to , and a range of total costs from to , producing units will cost :

Answers

Producing 1,600 units will cost SR $34,500 (option B).

To use the high-low method, we need to determine the variable cost per unit and the fixed cost component of the total cost formula.

First, let's calculate the variable cost per unit:

Variable Cost per Unit = (High Total Cost - Low Total Cost) / (High Units Produced - Low Units Produced)

Variable Cost per Unit = ($43,500 - $33,000) / (3,400 - 1,300)

Variable Cost per Unit = $10,500 / 2,100

Variable Cost per Unit = $5

Next, we can calculate the fixed cost component by using one of the data points. Let's use the high point:

Fixed Cost = High Total Cost - (Variable Cost per Unit * High Units Produced)

Fixed Cost = $43,500 - ($5 * 3,400)

Fixed Cost = $43,500 - $17,000

Fixed Cost = $26,500

Now, we can calculate the cost for producing 1,600 units:

Total Cost = Fixed Cost + (Variable Cost per Unit * Units Produced)

Total Cost = $26,500 + ($5 * 1,600)

Total Cost = $26,500 + $8,000

Total Cost = $34,500

The correct option is B.

The complete question is:

Co. uses the high-low method to derive a total cost formula. Using a range of units produced from 1,300 to 3,400, and a range of total costs from $33,000 to $43,500, producing 1,600 units will cost Co:

A. $8,000

B. $34,500

C. $40,615

D. $67,115

For more about cost:

https://brainly.com/question/31260269


#SPJ4

What is one counter-argument to the premise that the wealth gap is a serious problem which needs to be addressed? the lower classes have the opportunity to invest. poor people can easily move into the middle class. investments by the upper class create lower-class jobs. buying power sharply increases for the working class.

Answers

The investments by the upper class that creates lower-class jobs is the counter-argument on wealth gap that needs to be addressed.

What is a wealth gap?

This refers to the gap that classifies the group of people based on their earned income and wealth.

The statement that "Investments by the upper class create lower-class jobs" need to be addressed because it is a true statement about the condition of every economy.

Therefore, the Option C is correct.

Read more about wealth gap

brainly.com/question/2987205

#SPJ4

Answer:

C

Explanation:

A friend of yours would like to invest in your business and would like to know more

about strategic management. Briefly discuss the strategic management process

Answers

The strategic management process is a systematic approach that organizations use to develop and implement strategies to achieve their long-term goals and objectives.

The strategic management process begins with environmental analysis, where organizations assess internal and external factors impacting their performance. This includes analyzing industry dynamics, market trends, and internal strengths and weaknesses. Based on this analysis, organizations move to strategy formulation, setting their mission, vision, and goals, and selecting suitable strategies.

The next step is strategy implementation, where plans are put into action through resource allocation, defining structure, and developing action plans. Evaluation and control monitor performance against goals, and adjustments are made as needed. Finally, strategic renewal ensures strategies stay relevant by reviewing, updating, and embracing innovation.

By following the strategic management process, organizations can make informed decisions, adapt to changing environments, and achieve sustainable success. It is a dynamic and iterative approach that guides strategic decision-making throughout the organization.

learn more about "organization":- https://brainly.com/question/19334871

#SPJ11

Which of the following is one of the seven website design elements that marketers can use to produce an effective customer experience online?A. consistencyB. collaborationC. commercializationD. commerceE. creativity

Answers

Explanation:

The answer is D

Commerce

hope this helps

craig, a marketing manager at helizone inc., rarely takes initiative or suggests new ideas during project meetings. he does his work half-heartedly and needs to be guided by his manager on a regular basis. according to robert kelley's basic styles of followership, craig most likely is a(n)

Answers

According to Robert Kelley's basic styles of followership, Carig most likely is a passive follower.

Robert Kelley categorized fellowship style into five styles. Based on Robers Kelley's basic styles of fellowship these are five styles of fellowship:Exemplary: they are independent, innovative, and willing to stand up to superiors. Conformists: they are very active in doing their organization's work they used to be called "yes people". Passive; they rarely take initiative or suggest new ideas during a project meeting. Alienated: They are highly independent critical thinkers but low in engagement. Pragmatic: they are rarely committed to their group's work goals.

Learn more about fellowship styles at: https://brainly.com/question/7539317

#SPJ4

I don't have moey. What is the best job to get when you're in middle school?

Answers

Answer:

You can work at publix as a cashier. They acept 14 year olds. And ur in 8th grade as 14 which is in middle school.

Explanation:

This is the best job u can get as a kid

also brainlist me pls

You can make a lot of money by selling this in your house on Craigslist or eBay. Also if you know a lot of people you can sell snacks at school that’s what I did in 6th grade and I make like $50 a day

Which is a good rule to follow when sending business emails? (1 point)

Answers

Answer:

Avoid forwarding spam and unnecessary messages such as chain letters.

Explanation: did the test

The good rule that must follow at the time of sending business emails is to avoid forwarding spam and unwanted texts like chain letters.

What is email?

An email, is also called as the electronic mail. It is one of the most extensively employed features of the Internet, that is mostly used in the formal business organizations.

It allows a person to transport and acquire messages from nay person in the globe that has an email account. Within the TCP/IP suite, email uses a variety of protocols.

When sending business emails, a good tip to follow is to avoid forwarding spam and undesirable texts like chain letters.

Therefore, the use of formal languages and proper formats made the emails more accurate.

Learn more about the emails, refer to:

https://brainly.com/question/14666241

#SPJ2

I am 15 I’m I able to work at a haunted house or something like that?

Answers

Answer:

If you want to You can, if you don't want to work at haunted house then Don't..

I'm not angry UwU

Yes you can, there is a lot of other jobs you can apply for at the age of 15

What does indigenous technology mean?​

Answers

Answer: I hope this is helpful mark brainlist if right then no if wrong

Explanation:

Indigenous technology is used by the native inhabitants of a country or region and it constitutes an important part of its cultural heritage. Characteristically, indigenous technologies: Are recognized as animate, imbued with the breath of life and they live in form and function.Technologies employed by the native inhabitants of a country and which constitute an important part of its cultural heritage and should therefore be protected against exploitation by industrialized countries; the problem of indigenous knowledge has been discussed during the Rio Conference but it does not receive much ...Types of indigenous technology in India are; (i) Generic Drugs. (ii) Thorium based Nuclear Reactors. (iii) Plastic RoadsIndigenous Technology is created within a sensory environment that builds on our sense of relationship, meaning, balance, feeling, memory and place as well as sight, sound, smell, taste and touchIndigenization is the process by which Indigenous ways of knowing, being, doing and relating are incorporated into educational, organizational, cultural and social structures of the institution.One example of Indigenous Technologies in action today can be witnessed in differential approaches to medicine. Medical technologies in the Western Scientific sense of the term might conjure images of biomedical research labs, electromagnetic monitors or imaging systems such as CT or MRI scans.Indigenous technology is used by the native inhabitants of a country or region and it constitutes an important part of its cultural heritage. Characteristically, indigenous technologies: Are recognized as animate, imbued with the breath of life and they live in form and function.

How did some of your initial decisions (job, health insurance, where to live) impact the rest of your month in ways you did not expect?

Answers

          Our initial decisions in the job, health insurance, or where to live either have a positive impact or negative impact on our overall health status to the rest of the months in a way we did not expect.

What are Decisions?

Decision-making is defined in psychology as the intellectual and mental process that leads to the choosing of a belief or a plan of action from among multiple available alternatives.

However, our initial decision, i.e. our first decision in deciding

The kind of job we chose, Our health insurance,Where to live,

Has either a positive or negative impact on our overall health and mental status for the rest of the months in a way we did not expect.

This is because if we engage in a job we did not like to do or the gross income is low, it will affect the rest of our natural life negatively.

Similarly, if the place we chose to reside is far away from our workplace, the stress might be too much during the process of getting down to the workplace.

Learn more about decision-making here:

https://brainly.com/question/796795

Answer:

it impact cause it will be frustraded and sometimes proud.

Explanation:

a corporation sold a building for $130,000 cash and purchased new machinery for $68,000 cash. how would this be reported in a statement of cash flows

Answers

The net cash used in investing activities would be added to the net cash provided by operating activities and the net cash provided by financing activities to determine the net change in cash for the period.

The sale of the building would be reported as a cash inflow from investing activities in the statement of cash flows. The purchase of the machinery would be reported as a cash outflow from investing activities.

The following is how the transaction would be reported in the statement of cash flows:

Cash flows from investing activities:

 Sale of building $130,000

 Purchase of machinery $68,000

 Net cash used in investing activities $62,000

The net cash used in investing activities would be added to the net cash provided by operating activities and the net cash provided by financing activities to determine the net change in cash for the period.

Here is a breakdown of how the individual transactions would be reported in the statement of cash flows:

Sale of building:

Cash inflow from investing activities: $130,000

This would be the proceeds from the sale of the building, net of any selling expenses.

Purchase of machinery:

Cash outflow from investing activities: $68,000

This would be the cost of the machinery, net of any discounts or rebates.

Learn more about investing with the given link,

https://brainly.com/question/29547577

#SPJ11

to make sure people think about your brand in decision-making moments, what marketing objective should you use for your video campaign?

Answers

marketing goal should you choose for your video campaign Organizations need a video marketing plan to ensure that people think about their brand at decision-making times.

What exactly do we mean by decision-making?

Making decisions involves identifying a course of action, acquiring data, and weighing potential answers. By gathering pertinent data and outlining options, a walk decision-making process can assist you in making more careful, considered decisions.

Why is making decisions crucial?

Making decisions is crucial to achieving the corporate goals and objectives within the allotted time and money. It looks for the best option, makes good use of the available resources, and is well-liked by the workers. As a result, it is possible to accomplish organization goals or objectives in accordance with the desired outcome.

To know more about  decision-making visit:

https://brainly.com/question/13129093

#SPJ4

workflow structures processes so work proceeds in the most __________ order.

Answers

Workflow structures processes so work proceeds in the most efficient order.

The activities in the process and the transitions between them determine the structure of a workflow process. As a result, a workflow is a Graph with activities as vertices. Arcs serve as transitions (the graph that is formed by a workflow can be viewed by using the Visualize Workflow Process feature in the Process Definition Tool).

The graph formed by a process must meet certain criteria in order for the workflow engine to successfully interpret and run it. These criteria are presented in the section under two main headings: Graph Structure and Block Structure.

When creating process definitions, workflow designers should be aware of certain structural rules. When a Cram workflow process is validated, the validations determine whether the process structure conforms to these rules.

To know more about workflow:

https://brainly.com/question/11939249

#SPJ4

from a marginal analysis perspective, what is the inventory carry cost for andrews if the company carries one additional unit of ant in inventory at the end?

Answers

Inventory carrying cost means total expenses incurred while storing an unsold good.

What is Inventory carry cost?

Basically, an Inventory carry cost means the total holding cost for holding an inventory which includes the cost of capital, warehousing, depreciation, insurance, taxation, obsolescence, opportunity cost.

In other word, the Inventory carrying cost means the total expenses incurred while storing an unsold good.

Read more about Inventory carrying cost

brainly.com/question/25817334

If an Oregon licensee commonly uses a name other than their legally given name, what must
the licensee do to use this name in advertisements?
The licensee must register the alternative name with the agency.

Answers

In Oregon, if a licensee commonly uses a name other than their legal name in their profession and wants to use it in advertisements, they are required to register this alternative name with the relevant agency governing their profession.

The process of registration may involve filling out a registration form or providing necessary documentation to verify their identity and the use of the alternative name.

Once registered, the licensee can use the alternative name in their professional practice and advertising without any violation of the rules or regulations.

It is crucial for licensees to adhere to the guidelines and requirements of their profession's governing agency to avoid potential disciplinary actions and remain compliant.

Learn more about Oregon licensee.

https://brainly.com/question/29222940

#SPJ11

The general ledger is comprised of numerous individual asset, liability, equity, revenue, and expense ____________.

Answers

The general ledger is comprised of numerous individual asset, liability, equity, revenue, and expense accounts. These accounts serve as the building blocks of the general ledger and help track the financial transactions of a business.



1. Assets: These are economic resources owned by a company, such as cash, inventory, or equipment. They are recorded on the left side of the accounting equation and can be tangible (physical items) or intangible (such as patents or copyrights).

2. Liabilities: These represent the obligations of a company, such as loans, accounts payable, or salaries payable. Liabilities are recorded on the right side of the accounting equation and reflect the amount owed to external parties.

3. Equity: Also known as the owner's equity or shareholders' equity, this represents the residual interest in the assets of a company after deducting liabilities. Equity includes the initial investment by owners and retained earnings.

4. Revenue: This refers to the income earned by a company through its primary business activities. Examples of revenue accounts include sales revenue, service revenue, or rental revenue.

5. Expenses: These are the costs incurred by a company to generate revenue. Expenses include items like salaries, rent, utilities, and advertising expenses.

In conclusion, the general ledger consists of various asset, liability, equity, revenue, and expense accounts that help track a company's financial transactions. Each account has its unique purpose in recording and classifying these transactions accurately.

To learn more about liabilities visit:

brainly.com/question/30805836

#SPJ11

When we purchase certificates of deposit or bonds, we forgo ________ in exchange for interest.

A) Liquidity

B) Purchasing Power

C) Tax Payments

Answers

Answer:

A

Explanation:

Certificate of deposit is a form of deposit where money is deposited in a financial institution for a defined period of time in order to earn a return.

It has advantages in paying higher returns than some other form of savings and is even more secured , however liquidity is forgone for the interest.

This means that you can not withdraw your money before the defined time unless you  are willing to forgo some accumulated interest and also pay early withdrawal penalty.

As cash is tied up , other investment opportunity that could bring a higher investment might be missed.

How do long-term goals differ from short-term goals?
Long-term goals require more money than short-term goals do.
Long-term goals require more planning than short-term goals do.
Long-term goals are less attainable than short-term goals are.
Long-term goals involve less planning than short-term goals do.

Answers

Long-term goals require more planning than short-term goals do.

Planning what to do to get a car would take more planning than choosing breakfast. Therefore the second option is correct.

The correct answer is B. Long-term goals require more planning than short-term goals do.

Hope this helps

:)

apple assigns the same contract rights to enzo, and then to sam. sam immediately notifies the obligor of the assignment to him; enzo never notifies the obligor. when sam notified the obligor, he did not know about the earlier assignment to enzo. sam will have the better right under the:

Answers

Sam will be in a better position to benefit from (B) English rule.

What is the English rule?According to English law, the losing party is responsible for the opposing party's legal fees. The American norm, in contrast to the English rule, requires that each party pay its own legal fees unless legislation or contract specifically allows for such assessment.The English rule is a rule that governs the calculation of attorneys' fees resulting from litigation in the fields of law and economics. According to English law, the losing party is responsible for the opposing party's legal fees.

So, in the given situation, Sam will have a better right under English rule.

Therefore, Sam will be in a better position to benefit from (B) English rule.

Know more about the English rule here:

https://brainly.com/question/820417

#SPJ4

The complete question is given below:
Apple assigns the same contract rights to Enzo, and then to Sam. Sam immediately notifies the obligor of the assignment to him; Enzo never notifies the obligor. When Sam notified the obligor, he did not know about the earlier assignment to Enzo. Sam will have the better right under the:

A. "American rule."

B. "English rule."

C. Restatement (Second) of Contracts.

D. common law.

Billkin Company Income Statement For the year ended December 31, Year1 & 2 (dollars in thousands) Year 1 Net sales Less: Cost of goods sold Gross Margin Less: Operating expenses Operating Income Less: Interest expense Income before taxes Less: Income taxes (50%) Net income 75,000.00 52,500.00 22,500.00 11,452.00 11,048.00 400.00 10,648.00 5,324.00 5,324.00 Year 2 50,000.00 35,000.00 15,000.00 10,000.00 5,000.00 400.00 4,600.00 2,300.00 2,300.00 Billkin Company Statement of Retained Earnings For the year ended December 31, Year1 & 2 (dollars in thousands) Year 1 Balance, beginning of period Net income Total Less:Preferred dividends Dividends to common stockholders Balance, ending of period 5,324.00 5,324.00 5,324.00 Year 2 5,324.00 2,300.00 7,624.00 224.00 1,000.00 6,400.00 Billkin Company Comparative balance sheets For the year ended December 31, Year1 & 2 (dollars in thousands) Current Assets Cash Marketable securities Accounts Receivable Inventories Other Total Current Assets Property and equipment Land Buildning and equipment Total long-term assets Total Assets Current Liabilities Notes payable, short term Accounts payable Current maturity of long term debt Accrued payables Total current liabilities Long term liabilities Bonds payable, 10% Total liabilities Stockholder's equity Preferred stock, $25 par, 7% Common stock, $2 par Additional paid in capital Retained earnings Total Equity Total liabilities and stockholder's equity Assets Year 0 Year 1 6,000.00 2,500.00 500.00 2,000.00 5,000.00 10,000.00 3,000.00 800.00 1,500.00 12,300.00 19,000.00 6,000.00 6,000.00 5,000.00 5,000.00 11,000.00 11,000.00 23,300.00 30,000.00 Liabilities and Stockholder's Equity 2,800.00 3,000.00 5,000.00 5,800.00 400.00 400.00 1,500.00 1,876.00 9,700.00 11,076.00 4,000.00 4,000.00 13,700.00 15,076.00 3,200.00 3,200.00 1,600.00 1,600.00 4,800.00 4,800.00 5,324.00 9,600.00 14,924.00 23,300.00 30,000.00 Year 2 1,600.00 1,600.00 8,000.00 10,000.00 800.00 22,000.00 4,000.00 6,000.00 10,000.00 32,000.00 3,200.00 6,400.00 400.00 2,000.00 12,000.00 4,000.00 16,000.00 3,200.00 1,600.00 4,800.00 6,400.00 16,000.00 32,000.00 Instruction: 1 Compute all ratios for YEAR 1 AND YEAR 2 that are found in Liquidity Leverage Profitability ratios 2 Create an overall analysis of the company's performance based on the ratios computed. Make sure analysis is holistic, meaning encompassing the whole company and the relationship of the accounts and their movements. This should help you understand why the company performed such way.

Answers

The analysis of Billkin Company performance shows that the company's liquidity deteriorated in year 2, and profitability also declined. However, the company's leverage position improved, and it was efficiently using its assets and equity to generate income.

The following are the calculations of different ratios for the given years,Year 1 ratios:

1. Liquidity Ratios

Current Ratio= Current Assets/Current Liabilities= 10,000/9,700= 1.03

Acid-test Ratio= (Cash+ Marketable Securities +Accounts Receivable)/Current Liabilities

= (6,000+2,500+500)/9,700= 0.91

Inventory Turnover= Cost of Goods Sold/ Inventory= 52,500/2,000= 26.25 times

2. Leverage Ratios

Debt-to-Equity Ratio= Total Debt/ Total Equity= (9,700+4,000)/14,924

= 1.10

Interest Coverage Ratio= Earnings before Interest and Taxes/ Interest Expense= 11,048/400= 27.62 times

3. Profitability Ratios

Net Profit Margin= Net Income/ Net Sales= 5,324/75,000= 0.07

Return on Total Assets= Net Income/Total Assets= 5,324/23,300= 0.23

Return on Equity= Net Income/Total Equity= 5,324/14,924= 0.36Year 2 ratios:

1. Liquidity Ratios

Current Ratio= Current Assets/Current Liabilities= 1,600/12,000=

0.13

Acid-test Ratio= (Cash+ Marketable Securities +Accounts Receivable)/Current Liabilities

= (1,600+8,000+10,000)/12,000

= 1.58

Inventory Turnover= Cost of Goods Sold/ Inventory

= 35,000/800

= 43.75 times

2. Leverage Ratios

Debt-to-Equity Ratio= Total Debt/ Total Equity= (12,000+4,000)/16,000= 0.875

Interest Coverage Ratio= Earnings before Interest and Taxes/ Interest Expense

= 5,000/400= 12.5 times

3. Profitability Ratios

Net Profit Margin= Net Income/ Net Sales= 2,300/50,000

= 0.046

Return on Total Assets= Net Income/Total Assets

= 2,300/32,000

= 0.072

Return on Equity= Net Income/Total Equity

= 2,300/16,000

= 0.144

To know more about leverage visit :

brainly.com/question/31315958

#SPJ11

ACTUAL EXPLANATIONS ONLY PLEASE // You project revenue to start at $5,000 for the first month and grow by $200 each month thereafter. You project expenses
to begin at $7,000 per month and grow by $50 per month. In what month will you break even (revenue equal to expenses)?

Answers

Answer:

13.33

Explanation:

We have to write 2 equations to set equal to each other.

The first one will look like this:

200x + 5,000

The x will go with the 200 because the project revenue grows by $200 each month thereafter the start of $5,000.

The second equation will look like this:

50x + 7,000

The project begins at $7,000 and grows by $50 every month so the x will go with the 50.

Now, set them equal to each other

200x + 5,000 = 50x + 7,000

Solve

150x + 5,000 = 7,000

150x = 2,000

x = 13.333

Therefore, in the thirteenth month the project will breakeven.

Hope this helps!!

- Kay :)

Florence deposited ₱ 14,800 in a bank that gives 4.35% simple interest. after 2years 4months, she went back to the bank to check her balance. how much was available in her account?​

Answers

Answer:

₱ 16,300.054

Explanation:

The formula for calculating simple interest is as below.

I= p x r x t

In this case, p= 14,800, r = 4.35% and t is 2 years and 4 months

the interest rate is in years; we need to convert two years and four months to years.

=4 months = 4/12 of one year = 0.33

2 years 4 months = 2.33 year

I= 14,800 x 4.35/100 x 2.33

I= 14,800 x 0.0435 x 2.33

I=1,500.054

the amount in the bank will be principal plus interest

=14,800 + 1500

=16,300.054

Question 6 of 10
The optional feature in a business letter is the:
A. date.
B. inside address.
C. closing.
D. reference.

Answers

Answer:

D would be the correct answer

Explanation:

Answer: reference

Explanation: ape x

You are thinking about buying a bond that offers an annual coupon rate of 6%, with exactly 8 years remaining to maturity. The face value of the bond is $1,000. Your required return is 5% per year. How much should you be willing to pay for this bond?.

Answers

The annual income an investor might anticipate while owning a specific bond is known as the coupon rate. The amount that I would be willing to pay for this bond will be 1064.6321.

It is determined at the time the bond is issued and is calculated by dividing the sum of the annual coupon payments by the par value. At the time of purchase, a bond's yield to maturity and coupon rate are equal.

Yield to Maturity is calculated as [Annual Interest + (FV-Price)/Maturity]. (FV + Price)/2

Annual Interest is equal to the bond's yearly interest payment.

FV is the bond's face value.

Price = The Bond's Current Market Price.

Maturity equals Time to Maturity, or the number of years before the bond's maturity.

To know more about coupon rate refer:

https://brainly.com/question/16913107

#SPJ4

ruler of the market in determining goods and services producedA) regulatorB) entrepreneurC) mixed economyD) catalystE) consumer

Answers

Ruler of the market in determining goods and services produced Consumer i.e. Option E.

A consumer is an individual or a gathering who expects to request or uses bought merchandise, items, or administrations basically for individual, social, family, family and comparative requirements, who isn't straightforwardly connected with innovative or business exercises. The term most usually alludes to an individual who buys labour and products for individual use. In an economy, a customer purchases labor and products fundamentally for utilization and not so much for resale or for business purposes. Shoppers pay some measure of cash (or same) for labor and products.) then, at that point, consume (go through). In that capacity, buyers assume an essential part in the financial arrangement of an entrepreneur framework and structure a major piece of any economy. Without customer interest, consumers would need one of the vital inspirations to deliver: to offer to purchasers. The consumer additionally shapes one finish of the chain of dispersion.

Know more about Consumers - https://brainly.com/question/27773546

#SPJ4

One to two sentences, explain what happens to a production possibilities curve if a natural disaster creates a scarcity of a key resource needed to make a product. Explain why this happens.

Answers

A natural disaster causing a scarcity of a key resource necessary for production will result in a shift inward or to the left of the production possibilities curve.

This occurs because the reduced availability of the key resource limits the economy's ability to produce the affected product, leading to a decrease in overall production capacity.

As a result, the economy's production possibilities are constrained, and it is forced to operate at a suboptimal level.

The scarcity of the key resource disrupts the balance between the production of different goods, leading to a decrease in potential output.

The economy will need to allocate its limited resources and adjust its production mix accordingly, potentially focusing on alternative products or finding substitutes for the scarce resource in order to maximize production under the new constraints imposed by natural disaster-induced scarcity.

For more questions on: production possibilities curve.

https://brainly.com/question/26460726

#SPJ8

10)
How might a mission statement help Donna with her new
business?

Answers

A mission statement can help Donna with her new business by providing clarity and direction for her venture. It serves as a guiding statement that outlines the purpose, values, and goals of the business.

It helps Donna align her decisions, actions, and strategies with the overall mission, facilitating focus and consistency in her business operations. A mission statement is a concise statement that articulates the purpose and core values of a business. It outlines what the business aims to achieve and how it intends to operate. For Donna, having a mission statement for her new business can provide several benefits.

Firstly, it helps Donna define the purpose and direction of her business. It clarifies the reason for starting the business and what it aims to accomplish, providing a sense of focus and clarity.

Secondly, a mission statement helps Donna communicate her business's values and principles to stakeholders, including employees, customers, and investors. It sets the foundation for building a strong company culture and aligning everyone's efforts toward a common goal.

Lastly, a mission statement can serve as a guide for decision-making and strategy development. When faced with choices or challenges, Donna can refer to her mission statement to ensure that her actions align with the overall purpose and values of her business.

A mission statement plays a crucial role in helping Donna with her new business by providing clarity, guiding decision-making, and aligning stakeholders toward a common vision.

In conclusion, a mission statement can significantly benefit Donna in her new business. It provides clarity and direction, communicates values to stakeholders, and guides decision-making and strategy development. By establishing a mission statement, Donna can effectively define her business's purpose and goals, foster a strong company culture, and make informed decisions that align with her business's overall mission. This helps create a solid foundation for success and growth in her new venture.

To know more about goals, visit:

https://brainly.com/question/25534066

#SPJ11

Other Questions
Figurative Language finder Sets A and X are defined as:A = { a, b, c, d }X = { 1, 2, 3, 4 }A function f: A X is defined to bef = { (a, 3), (b, 1), (c, 4), (d, 1) }a. What is the target (or co-domain) of function f?b. What is the range of function f?c. What is f(c)?d. What is the domain of function f? URGENT I I WILL GIVE BRAINLIEST TO WHOEVER ANSWERS CORRECTLY AND QUICKWhat does microbacteria in soil do?produces inorganic materialbreaks down mineralsprotects the soil from predators Without photosynthesis life as we know it would not exist on Earth. True or False Help with this! Tyy How do I do74p(5)? The west coast of Canada has ________________a Maritime climatea Tundra climatea Humid climateNone of the abo What type of number is this?0.707070...A. Rational and terminatingB. IrrationalC. Rational and repeating decimal a theater has 20 rows with 28 seats in the first row, 33 in the second row, 38 in the third row, and so forth. how many seats are in the theater? based on scientific research, which statement best describes mutations? For a serve to be considered legal, the birdie must: the colors of red and white vegetables are enhanced by being cooked in a(n) _____ solution what is 2y > 4 simplified In a guinea pigs, the allele for short hair H is dominat to long hair h 1. The base pairing model of DNA replication predicts the complementary DNA strand after replication. Which of the following is a limitation of the model?Question 1 options:The model is limited to only human DNA.The model doesn't predict the proteins that are transcribed.The model is limited to DNA and doesn't account for RNA.The model is limited by not accounting for natural errors during DNA replication.Question 2 A Biology student is investigating DNA replication in peony flowers; which of the following is a specific and testable question that could guide their research?Question 2 options:What is the error rate in complementary DNA strand sequences of peony flower after replication?What is the DNA sequence of a peony flower?What is the rate of error in DNA replication?What is the complementary DNA strand sequence of a peony flower?Question 3 You are studying DNA replication; using the base pairing model of DNA replication, which of the following would you predict is the complementary DNA sequence for the parent DNA strand AGTCCATG?Question 3 options:AGTCCATGTCAGGTACGATTACAAGACTTGCAQuestion 4You are investigating the genetics of pink and white peony flowers; what is a specific and testable question you could ask about the flowers?(WILL MARK BRAINLIEST!!!) what is a key factor (or factors) for a promoter in selecting an opening act to perform before a headliner? GIVING BRAINLIEST!!! what is 56/53 = I'm so confused I used my calculator but i don't know whats accurate QuestionCalculate the arc length for a circle whose radius is 6 with a central angle =135. S= Any help is apprenticed!