Consider the function: f(x) = x^3 - x^2 - 6xDetermine the average rate of change in f(x) for each interval. 1. -4 ≤ x ≤ -22. 0 ≤ x ≤ 1

Answers

Answer 1

Remember that

the average rate of change is equal to

\(\frac{f(b)-f(a)}{b-a}\)

Part 1

we have the interval [-4,-2]

so

a=-4

b=-2

f(a)=f(-2)=(-2)^3-(-2)^2-6(-2)=-8-4+12=0

f(b)=f(-4)=(-4)^3-(-4)^2-6(-4)=-64-16+24=-56

substitute given values

\(\frac{-56-0}{-2-(-4)}=-\frac{56}{2}=-28\)the average rate of change is -28

Part 2

we have the interval [0,1]

a=0

b=1

f(a)=f(0)=(0^3)-(0^2)-6(0)=0

f(b)=f(1)=(1^3)-(1^2)-6(1)=-6

substitute given values

\(\frac{-6-0}{1-0}=-6\)the average rate of change is -6

Related Questions

Click on the picture do number 18 and 19

Click on the picture do number 18 and 19

Answers

Answer:

<1=<2Being vertical angles

<2+<3=90° Being complementary angle

m<3=56

now

<2+<3=90

<2=90-56

<2=34

:.<1=34°

PLEASE HELP ASAP!! (Please do this if ur good at Scientific Notation) please tell me which 4 should I put in the box! (Click picture) ‼️‼️

PLEASE HELP ASAP!! (Please do this if ur good at Scientific Notation) please tell me which 4 should I

Answers

Answer:

1st one is 6.9 X 10^6

2nd one is 2 x 10^5

Step-by-step explanation:

Which of the following triangles are impossible to draw? Choose all that apply.

A. a triangle with angles of 30°, 45°, and 115°
B. a triangle with two right angles
C. a triangle with sides of 2 units, 3 units, and 4 units
D. a triangle with sides of 3 inches, 4 inches, and 8 inches
E. an obtuse equilateral triangle
F. a right scalene triangle

Answers

Answer:

Impossible: A, B, D, E

Step-by-step explanation:

A. 30 + 45 + 115 = 190; sum is more than 180°.    IMPOSSIBLE

B. 90 + 90 + x = 180; x = 0; third angle has 0° measure.       IMPOSSIBLE

C. Each side length is between the sum and difference of the other two sides' lengths.    POSSIBLE

D. 3 + 4 < 8.      IMPOSSIBLE

E. An equilateral triangle has 3 congruent angles measuring 60° each.   IMPOSSIBLE

F. For example, a triangle with lengths 3, 4, 5.      POSSIBLE

A ball pit contains 190 balls.
50 are orange, 100 are purple and 40 are yellow.
What is the ratio of yellow to purple balls in its simplest form?

Answers

Step-by-step explanation:

40 :100        yellow to purple,  divide both sides by 20

2:5

Answer:

the ratio of yellow to purple is 40:100 that is 2:5 in the simplest form.

Step-by-step explanation:

Hope it helps.

help asap i need this tomorrow thanks!:)

help asap i need this tomorrow thanks!:)

Answers

a) The algebraic fraction \(\frac{{x + 2}}{{(x - 1)^2}}\) is proper. b) The algebraic fraction \(\frac{{4x^2 - 31x + 59}}{{(x - 4)^2}}\) can be expressed as \(-\frac{{31}}{{x - 4}} - \frac{{25}}{{(x - 4)^2}}\).

Let's solve each part step by step and determine whether the fraction is proper or improper, and then express it accordingly.

a) \(\frac{{x + 2}}{{(x - 1)^2}}\):

Step 1: Determine the degree of the numerator and the denominator:

  - Degree of the numerator = 1 (linear term)

  - Degree of the denominator = 2 (quadratic term)

Since the degree of the numerator is less than the degree of the denominator, the fraction is proper.

Step 2: Express the proper fraction in partial fractions:

\(\frac{{x + 2}}{{(x - 1)^2}} = \frac{A}{{x - 1}} + \frac{B}{{(x - 1)^2}}\).

Step 3: Find the values of A and B:

Multiply both sides of the equation by \(((x - 1)^2)\) to eliminate the denominators:

  (x + 2) = A(x - 1) + B.

Expand the equation and collect like terms:

  x + 2 = Ax - A + B.

Equate the coefficients of like terms:

  Coefficient of x: 1 = A.

  Constant term: 2 = -A + B.

Solve the system of equations to find the values of A and B:

From the coefficient of x, A = 1.

Substituting A = 1 into the constant term equation: 2 = -1 + B, we find B = 3.

Therefore, the partial fraction decomposition is:

  \(\frac{{x + 2}}{{(x - 1)^2}} = \frac{1}{{x - 1}} + \frac{3}{{(x - 1)^2}}\).

b) \(\frac{{4x^2 - 31x + 59}}{{(x - 4)^2}}\):

Step 1: Determine the degree of the numerator and the denominator:

  - Degree of the numerator = 2 (quadratic term)

  - Degree of the denominator = 2 (quadratic term)

Since the degree of the numerator is equal to the degree of the denominator, the fraction is proper.

Step 2: Express the proper fraction in partial fractions:

  \(\frac{{4x^2 - 31x + 59}}{{(x - 4)^2}} = \frac{A}{{x - 4}} + \frac{B}{{(x - 4)^2}}\).

Step 3: Find the values of A and B:

Multiply both sides of the equation by \(((x - 4)^2)\) to eliminate the denominators:

  (4x^2 - 31x + 59) = A(x - 4) + B.

Expand the equation and collect like terms:

  4x^2 - 31x + 59 = Ax - 4A + B.

Equate the coefficients of like terms:

Coefficient of \(x^2\): 4 = 0 (No \(x^2\) term on the right side).

Coefficient of x: -31 = A.

Constant term: 59 = -4A + B.

Solve the system of equations to find the values of A and B:

From the coefficient of x, A = -31.

Substituting A = -31 into the constant term equation: 59 = 4(31) + B, we find B = -25.

Therefore, the partial fraction decomposition is:

  \(\frac{{4x^2 - 31x + 59}}{{(x - 4)^2}} = -\frac{{31}}{{x - 4}} - \frac{{25}}{{(x - 4)^2}}\).

The above steps provide the solution for each part, including determining if the fraction is proper or improper and expressing it in partial fractions.

For more questions on algebraic fraction:

https://brainly.com/question/11875858

#SPJ8

Please explain step by step I dont get it.

Please explain step by step I dont get it.

Answers

Answer:

B

Step-by-step explanation:

minus 3 twice

 -3 times 2

Answer:

B (-3 x 2)

Step-by-step explanation:

Think about it like simple multiplication. On the number line, there are two groups of 3, except the integer is actually negative. It's about the same though.

WILL GIVE 5 STARS

Angela plays soccer and golf for a total of 125 minutes every day. She plays soccer 45 minutes more than she plays golf.


Part A: Write a pair of linear equations to show the relationship between the number of minutes Angela plays soccer (x) and the number of minutes she plays golf (y) every day. (5 points)


Part B: How much time does Angela spend playing golf every day? (3 points)


Part C: Is it possible for Angela to have spent 80 minutes playing soccer every day? Explain your reasoning.

Answers

A: The linear equations are x + y = 125 and x = y + 45.

B: Everyday Angela spends 40 minutes in playing golf.

C: No, it is not possible for Angela to spend 80 minutes playing soccer every day.

What is a linear equation?

A linear equation is one that has a degree of 1 as its maximum value. No variable in a linear equation, thus, has an exponent greater than 1. A linear equation's graph will always be a straight line.

Part A:

Let x be the number of minutes Angela plays soccer every day

Let y be the number of minutes Angela plays golf every day

According to the problem statement the linear equations are -

x + y = 125 (total time playing both sports is 125 minutes)

x = y + 45 (Angela plays 45 more minutes of soccer than golf)

Part B:

Substitute x = y + 45 into the first equation -

(y + 45) + y = 125

Use the addition operation -

2y + 45 = 125

2y = 80

y = 40

Angela spends 40 minutes playing golf every day.

Part C:

If Angela spends 80 minutes playing soccer every day, then

x = 80

y + 45 = 80 (using the equation x = y + 45)

y = 35

But this would mean that she plays golf for 35 minutes and soccer for 80 minutes, which adds up to a total of 115 minutes.

This is not possible since the problem states that Angela plays both sports for a total of 125 minutes every day.

Therefore, it is not possible for Angela to have spent 80 minutes playing soccer every day.

To learn more about linear equation from the given link

https://brainly.com/question/2226590

#SPJ1

Solve -|x| + 9 ≥ -15.

Answers

Answer:

Step-by-step explanation:

-24<=x<=24

I'm on my phone and can't access the less than equal to sign.

Monica's college runs on a trimester schedule, so she receives a bill 3 times a year for tuition. Each trimester costs $2,350, and Monica must complete 4 years of college to receive her degree. The average cost for books each trimester is $425. Approximately what will be the total cost for Monica to get her degree?

Answers

Answer:

The Answer is 33,300$ Hope This Helps!

Step-by-step explanation:

i know this because a trimester is 3 times a year and if she is paying 2,350$ a trimester i know she is paying 7,050$ a year so multiply that by 4 and you get 28,200$ so do the same thing I just explained with the books and you get 33,300$ Have a great day!

how do i do a problem with y-x in it

Answers

Answer:

It depends on the question as x and y are variables. so they can be any number

Step-by-step explanation:

Solve the two simultaneous equations.
You must show all your working.
3t+2p=15.5
5t+4p=28.5

Answers

Answer:

Given equations are,

5x+2y=−2        (1)

3x−5y=17.4      (2)

Multiply equation (1) by 5 and equation (2) by 2, we get,

5(5x+2y)=5×−2

∴25x+10y=−10          (3)

2(3x−5y)=2×17.4

∴6x−10y=34.8          (4)

Adding equations (3) and (4), we get,

31x=24.8

∴x=

31

24.8

Put this value in equation (1), we get,

5(

31

24.8

)+2y=−2

31

124

+2y=−2

∴2y=−2−

31

124

∴2y=

31

−186

∴y=

31

−93

Step-by-step explanation:

Form a polynomial whose real zeros and degree are given.
Zeros: – 4, 0, 6;
degree: 3

Answers

Answer:

?

Step-by-step explanation:

PLEASE HELP ME SOLVE THIS QUESTION
ln(x^3 / (1 + x))

Answers

Answer:

  3·ln(x) -ln(1+x)

Step-by-step explanation:

You want to "solve" the expression ln(x³/(1+x)).

Rules of logarithms

The relevant rules of logarithms are ...

  ln(a^b) = b·ln(a)

  ln(a/b) = ln(a) -ln(b)

Application

The given log expression can be expanded as ...

  \(\ln{\left(\dfrac{x^3}{1+x}\right)}=\ln(x^3)-\ln(1+x)=\boxed{3\ln(x)-\ln(1+x)}\)

Please help if you can thanks

Please help if you can thanks

Answers

The probability that:

(a) 47 or more products fail is approximately 0.9525.(b) 58 or fewer products fail is approximately 0.5250.(c) 5 or more products succeed is approximately 0.7151.(d) 10 products succeed is approximately 0.3522.

How to find probability?

First, check if it is appropriate to use the normal approximation to the binomial distribution. The rule of thumb is that this approximation is reasonable if both np and n(1-p) are greater than 5. In this case, p = 0.83 (probability of failure), n = 70 (number of trials).

So,

np = 700.83 = 58.1,

n(1-p) = 700.17 = 11.9.

Both quantities are larger than 5, so use the normal approximation.

Convert this to a problem involving a normal distribution. The mean of this distribution is np = 58.1 and the standard deviation is √(np(1-p)) = √(700.830.17) = 6.35.

(a) within 2 years 47 or more fall:

This corresponds to a Z-score of (47.5 - 58.1) / 6.35 = -1.67. The probability that a standard normal variable is greater than -1.67 is 0.9525.

So the probability that 47 or more products fail is approximately 0.9525.

(b) within 2 years 58 or fewer fail:

This corresponds to a Z-score of (58.5 - 58.1) / 6.35 = 0.063. The probability that a standard normal variable is less than 0.063 is 0.5250.

So the probability that 58 or fewer products fail is approximately 0.5250.

(c) within 2 years 15 or more succeed:

Since the probability of success is 1-p, this is equivalent to fewer than (70 - 15 = 55) failing. This corresponds to a Z-score of (54.5 - 58.1) / 6.35 = -0.567.

The probability that a standard normal variable is greater than -0.567 is 0.7151.

So the probability that 15 or more products succeed is approximately 0.7151.

(d) within 2 years fewer than 10 succeed:

This is equivalent to more than (70 - 10 = 60) failing. This corresponds to a Z-score of (60.5 - 58.1) / 6.35 = 0.377.

The probability that a standard normal variable is less than 0.377 is 0.6478.

However, since we want more than 60 failing, the probability that the variable is greater than 0.377, which is 1 - 0.6478 = 0.3522.

So the probability that fewer than 10 products succeed is approximately 0.3522.

Find out more on binomial distribution here: https://brainly.com/question/30049535

#SPJ1

Which multiplication equation best represents the figure?

Which multiplication equation best represents the figure?

Answers

The multiplication equation best represents the figure will be 6 x 0.32 = 1.92. Then the correct option is B.

What is Algebra?

Algebra is the examination of ideational signs while reasoning the manipulation of all those thoughts.

The big square block represents the 1 unit. And each small block represents 0.01 units.

The number of small blocks which are marked by the color in one shot is 32 which means 0.32 units.

And these processes are done six times, then the expression that represents the condition is given as,

6 x 0.32 = 1.92

The multiplication equation best represents the figure will be 6 x 0.32 = 1.92. Then the correct option is B.

More about the Algebra link is given below.

https://brainly.com/question/953809

#SPJ9

The distance in New York is 3 hours ahead of the distance in LA. The miles between the cities is 7,120. A plane left New York at 6:25a.m. and arrived at 8:25a.m. local time. At what speed did the plane travel?

Answers

It prolly took like 60 min away who knows but 60 or 5 mins

A sight-seeing tour bus can carry 68 people. If 330 people want to go sight-seeing on the bus, what is the minimum number of trips the bus will have to make to accommodate everyone?

Answers

The minimum number of trips the bus will have to make to accommodate everyone is 5.

To find the minimum number of trips the bus needs to make, we divide the total number of people by the capacity of the bus.

1. Divide the total number of people (330) by the capacity of the bus (68):

  330 / 68 = 4.85 (rounded to the nearest whole number)

2. The result is approximately 4.85, which means that 4 trips will not be enough to accommodate everyone.

3. Since we can't have a fraction of a trip, we need to round up to the nearest whole number to ensure that everyone is accommodated.

4. Therefore, the minimum number of trips the bus will have to make is 5, as it will require 5 full trips to transport all 330 people.

It's important to note that on the fifth trip, the bus will not be completely full, as only 10 people will be left to transport. However, this is the minimum number of trips needed to ensure that everyone can go sight-seeing on the bus.

For more such questions on number, click on:

https://brainly.com/question/24644930

#SPJ8

In the following diagram, ABCDABCD is a square. The coordinates of the vertices A,B,CA,B,C and DD are (3,3),(8,3),(8,8)(3,3),(8,3),(8,8) and (3,8)(3,8) respectively.

The square is dilated from the origin by a factor of 1111 to give A′B′C′D′A′B′C′D′.

What are the coordinates of point C′C′? (NEED THIS ASAP)

Answers

Answer:

Step-by-step explanation:

To dilate the square by a factor of 1111 from the origin, we need to multiply each coordinate by 1111.

The coordinates of point C are (8,8). So, to find the coordinates of point C' after dilation, we can simply multiply each coordinate by 1111:

x-coordinate of C' = 1111 * 8 = 8888

y-coordinate of C' = 1111 * 8 = 8888

Therefore, the coordinates of point C' are (8888, 8888).

Write an equation of the line given with the following information

Use y=mx+b

The slope is 6

The line passes through (-5,-6)

Answers

Answer:

y=6x-24

Step-by-step explanation:

I put it into point slope form first.

y--6=6(x--5)

y+6=6(x+5)

y+6=6x+30

y=6x-24

13 A young girl standing on a cliff is throwing stones up into the air so that they land in the ocean below. The height h, in meters, of each stone above the ocean is related to the
time 1, in seconds, after it has been thrown by the function
h = -21? + 21 + 40. What is the maximum height reached by
each stone?

Answers

The maximum height reached by each stone is 40.5 meters.

The height of each stone above the ocean is given by the function:

h = -2t² + 2t + 40

This is a quadratic function in standard form, with a = -2, b = 2, and c = 40.

The maximum height reached by the stone occurs at the vertex of the parabolic curve described by this function.

The t-coordinate of the vertex is given as:

t = -b / 2a

Substitute the values of a and b,

t = -2 / (2×(-2)) = 0.5

So the maximum height is reached 0.5 seconds after the stone is thrown.

To find the maximum height, substitute the value of t into the function:

h = -2(0.5)² + 2(0.5) + 40 = 40.5 meters

Therefore, the maximum height reached by each stone is 40.5 meters.

Learn more about the maximum height here:

https://brainly.com/question/15025354

#SPJ1

Use square roots to solve the equation x^2=-64

Answers

Answer:

x equals 8 due to 8^2 being 8x8=64

Step-by-step explanation:

Consider a tree T with n vertices, where n is an odd integer greater than or equal to 3. Let v be a vertex of T. Prove that there exists a vertex u in T such that the distance between u and v is at most (n-1)/2

Answers

There must exist a vertex u in T such that the distance between u and v is at most (n-1)/2.

To prove the existence of a vertex u in tree T such that the distance between u and v is at most (n-1)/2, we can employ a contradiction argument. Assume that such a vertex u does not exist.

Since the number of vertices in T is odd, there must be at least one path from v to another vertex w such that the distance between v and w is greater than (n-1)/2.

Denote this path as P. Let x be the vertex on path P that is closest to v.

By assumption, the distance from x to v is greater than (n-1)/2. However, the remaining vertices on path P, excluding x, must have distances at least (n+1)/2 from v.

Therefore, the total number of vertices in T would be at least n + (n+1)/2 > n, which is a contradiction.

Hence, there must exist a vertex u in T such that the distance between u and v is at most (n-1)/2.

For more such questions on vertex

https://brainly.com/question/25651698

#SPJ8

Your hourly salary increased from $13 to $20. What is the percent increase in your salary?

Answers

The percent increase in your salary is 53.8%

What is the percent increase in your salary?

The given parameters are:

Initial = $13

Final = $20

The percent increase in your salary is calculated as:

Percent Increase = (Final - Initial)/Initial * 100%

So, we have:

Percent Increase = (20- 13)/13* 100%

Evaluate

Percent Increase = 53.8%

Hence, the percent increase in your salary is 53.8%

Read more about percent increase at

https://brainly.com/question/11360390

#SPJ1

For F(x)=x^2+8 and g(x)=x^2-8 , find
( f o g) (x)

(g o f) (x),

(f o g)(2)


thanks!!

Answers

The final answer is (f o g)(x) = x^4 - 16x^2 + 72

(g o f)(x) = x^4 + 16x^2 + 56

(f o g)(2) = 24

To find the composite functions (f o g)(x) and (g o f)(x), we need to substitute one function into the other.

(f o g)(x):

To find (f o g)(x), we substitute g(x) into f(x):

(f o g)(x) = f(g(x))

Let's substitute g(x) = x^2 - 8 into f(x) = x^2 + 8:

(f o g)(x) = f(g(x)) = f(x^2 - 8)

Now we replace x in f(x^2 - 8) with x^2 - 8:

(f o g)(x) = (x^2 - 8)^2 + 8

Simplifying further:

(f o g)(x) = x^4 - 16x^2 + 64 + 8

(f o g)(x) = x^4 - 16x^2 + 72

Therefore, (f o g)(x) = x^4 - 16x^2 + 72.

(g o f)(x):

To find (g o f)(x), we substitute f(x) into g(x):

(g o f)(x) = g(f(x))

Let's substitute f(x) = x^2 + 8 into g(x) = x^2 - 8:

(g o f)(x) = g(f(x)) = g(x^2 + 8)

Now we replace x in g(x^2 + 8) with x^2 + 8:

(g o f)(x) = (x^2 + 8)^2 - 8

Simplifying further:

(g o f)(x) = x^4 + 16x^2 + 64 - 8

(g o f)(x) = x^4 + 16x^2 + 56

Therefore, (g o f)(x) = x^4 + 16x^2 + 56.

(f o g)(2):

To find (f o g)(2), we substitute x = 2 into the expression (f o g)(x) = x^4 - 16x^2 + 72:

(f o g)(2) = 2^4 - 16(2)^2 + 72

(f o g)(2) = 16 - 64 + 72

(f o g)(2) = 24

Therefore, (f o g)(2) = 24.

In summary:

(f o g)(x) = x^4 - 16x^2 + 72

(g o f)(x) = x^4 + 16x^2 + 56

(f o g)(2) = 24

for such more question on composite functions

https://brainly.com/question/10687170

#SPJ8

pls help with this. just the answer

pls help with this. just the answer

Answers

The answer is B which is Y

Answer:

Step-by-step explanation:

“y” should be the first step of the system.

First correct answer gets brainliest

Given a line with slope = -4 and y-int= (0, 5), write the equation of the line.
Writing the equation algebraically.

Answers

Answer:

\(y=-4x+5\)

Step-by-step explanation:

The equation of a line with slope \(m\) and \(y\)-intercept \((0,b)\) is \(y=mx+b\).

The equation below expresses the approximate
height h, in meters, of a ball t seconds after it is
launched vertically upward from the ground.
h(t) = –16t2 + 25t. At how many different times will the ball be 7 ft. High?

Answers

Answer:

The ball will be the 7 ft high at 2 different times.

Step-by-step explanation:

The height in meters of the ball is given by the following equation:

\(h(t) = -16t^2 + 25t\)

7 feet high

The height, by the equation, is given in meters, so we have to work in meters. Since each feet has 0,3048 meters, 7 feet have have 2.1336 meters. So, we have to solve the following equation

\(2,1336 = -16t^2 + 25t\)

\(16t^2 - 25t + 2,1336 = 0\)

At how many different times will the ball be 7 ft. High?

We have to find the number of solutions for the equation above.

It is given according to the value of \(\Delta = b^2 - 4ac\). If it is positive, there are two solutions, zero one solution and negative no solutions.

In this equation \(a = 16, b = -25, c = 2.1336\). So

\(\Delta = b^2 - 4ac = (-25)^2 - 4*16*2.1336 = 488\)

Since the coefficient is positive, the ball will be the 7 ft high at 2 different times.

138.4 minus 48.732 help

Answers

The correct answer is 89.700

If FGH ~ KJH, find FH.

If FGH ~ KJH, find FH.

Answers

The required length of FH is obtained as 64.68.

What is the criteria for similarity of two triangles?

Two triangles are said to be similar when either the ratio of their corresponding sides are equal or all the corresponding angles are equal.

Two similar triangles are the same in shape but not in size.

The given diagram shows two similar triangles as ΔFGH and ΔKJH.

Since the ratios of the corresponding sides of the two triangles are equal, the following equation can be written for the given case as,

(x + 8)/32 = (4x - 25)/52

=> 52(x + 8) = 32(4x - 25)

=> 52x - 128x = -32 × 25 - 52 × 8

=> -76x = -1716

=> x = 22.42

Thus FH = 4x - 25 = 4 × 22.42 - 25 = 64.68

Hence, the length of FH for the given case is 64.68.

To know more about similar triangles click on,

https://brainly.com/question/25882965

#SPJ5

Chairs need to be set up for the audience members. You want to use. the fewest number of chairs and still meet these three additional condions.
• There are 23 rows of chairs.
• There are the same number of chairs in esch row.
• There are an even number of chairs in cads rom.
Based on the number of students expected to attend, design a plan to set up the chairs. State how many total chairs there are, and explain why your plan meets these conditions.

Answers

There must be 46 chairs in each row and total number of chairs are 1058

To meet the given conditions, we need to find a number that has the following properties:

It should be divisible by 2, as there are an even number of chairs in each row.

It should be divisible by 23, as there are 23 rows of chairs.

It should be the same number in each row.

The smallest number that satisfies these conditions is 46, which is the least common multiple of 2 and 23.

So, we need to set up 46 chairs in each row.

The total number of chairs required will be:

Total number of chairs = 23 rows x 46 chairs per row = 1058 chairs

Hence, the total number of chairs are 1058

To learn more on Equation:

https://brainly.com/question/10413253

#SPJ1

Other Questions
Projects A and B are mutually exclusive and have normal cash flows. Project A has an IRR of 15% and B's IRR is 20%. The companys WACC is 12%, and at that rate Project A has the higher NPV. Which of the following statements is CORRECT?A) The crossover rate for the two projects must be less than 12%.B) Assuming the timing pattern of the two projects cash flows is the same, Project B probably has a higher cost (and larger scale).C) Assuming the two projects have the same scale, Project B probably has a faster payback than Project A.D) The crossover rate for the two projects must be 12%.E) Since B has the higher IRR, then it must also have the higher NPV if the crossover rate is less than the WACC of 12%. (3 points) Two manufacturers supply blankets to emergency relief organizations. Manufacturer A supplies 3300 blankets, and 9 percent are irregular in workmanship. Manufacturer B supplies 3500 blankets Kayla likes to mic 6 cups of water to 1 cup of lemonade. How much lemonade mix would she need if she uses a gallon of water? raphael was just outside the parking garage of the building when his building was bombed and there was a huge explosion. at the time he was terrified and had visions of the building falling on him. over the past six weeks, since the time of the bombing, he has had periods of anxiety and sleeplessness. this is an example of a: Most animals produce offspring through mating, but some organisms reproduce by cloning. What is cloning?o The energy requirement of two different parentso The growth and development of bacteriao The process of producing an organism that is genetically identical to the organism from which it was produced.o The process that allows an organism to maintain a stable internal environment changing external conditions.Please help!!! Brennan ordered a set of beads. He received 100 beads, and 57% of them were brown. Howmany brown beads did Brennan receive?beadsSubmitWork it out How are proteins built using the information provided by a molecule of RNA prediction? methrotrexate a. take the medication three times a week at the same time b. report any incidence of increased fatigue and weakness c. take the medication an hour before you eat three times a week d. you should not lay down for two hours after taking the medication e. take the medication with food if you get nauseous An intern at an IT company provisioned a Linux based On-demand EC2 instance with per-second billing but terminated it within 30 seconds as he wanted to provision another instance type. What is the duration for which the instance would be charged For this problem, you may use Desmos to get approximations for your values)A water balloon is tossed vertically with an initial height of 7ft from the ground.An observer sees that the balloon reaches its maximum height of 23ft 1 second after being launched.What is the height of the balloon after 2 seconds? How do you know?What model best describes the height of the balloon after t seconds?When does the balloon hit the ground? How many moles of ideal gas are in a 325 mL container that has a pressure of695 torr at 19 C?A. 1.24 102 molB. 1.48 102 molC. 9.42 molD. 12.4 molE. 80.6 mol help plz i'll give braineys In addition to quilting, Faith Ringgold's Dancing at the Louvre demonstrates a continuity with which other textile tradition?- Tie-dyeing- Crocheting- Weaving- Batiking A regular hexagon has a radius of 3. What is the area of the hexagon? Round your answer to the nearest tenth. What was General Washington strategy for the Revolutionary war Imagine Scotland voted to become independent from the rest of the UK but continued to use Sterling as its currency (against the wishes of the Bank of England and Treasury). This arrangement would best be described as Select one: a. a de facto currency union b. a currency union c. a currency board d. dollarization Which of the following represents secondary succession? aPlants growing in a forest that was destroyed by fire. bPlants growing on sand dunes. cPlants growing on a new volcanic island that formed in the ocean. dMoss growing on top of rocks. if thier first two children have normal pigmentaiotn, what is the probiablity that their third child will be an Alfarsi Industries uses the net present value method to make investment decisions and requires a 15% annual return on all investments. The company is considering two different investments. Each require an initial investment of $15,600 and will produce cash flows as follows: can you please compare the DNA sequences in thisimage, mark any insertion, deletion, polymorphism, and addition.Discuss about the yellow region in sequences and the nucleotides.discuss all the simi>M12-LCMT-F_D02.ab1TAAAGCCATTTACCGTACATAGCAC >M13-LCMT-F E02.ab1TAAAGCCATTTACCGTACATAGCAC >M14-LCMT-F_F02.ab1TAAAGCCATTTACCGTACATAGCAC325 >M15-LCMT-F_G02.ab1TAAAGCCATTTACCGTACATAGCAC >M16-LCMT-F_H02.ab1TAAAGCCATTTACCGTACATAGCAC>M12-LCMT-F_D02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M13-LCMT-F_E02.ab1ATTACAGTCAAATCCCTTCTCGTCC >M14-LCMT-F F02.ab1ATTACAGTCAAATCCCTTCTCGTCC350>M15-LCMT-F G02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M16-LCMT-F_H02.ab1ATTACAGTCAAATCCCTTCTCGTCC w >M12-LCMT-F_D02.ab1CCATGGATGACCCCCCTCAGATAGG>M13-LCMT-F_E02.ab1CCATGGATGACCCCCCTCAGATAGG >M14-LCMT-F_F02.ab1CCATGGATGACCCCCCTCAGATAGG375 >M15-LCMT-F_G02.ab1CCATGGATGACCCCCCTCAGATAGG>M16-LCMT-F_H02.ab1CCATGGATGACCCCCCTCAGATAGG>M12-LCMT-F_D02.ab1GGTCCCTTGACCAC>M13-LCMT-F_E02.ab1GGTCCCTTGACCAC >M14-LCMT-F_F02.ab1AGTCCCTTGACCAC >M15-LCMT-F_G02.ab1GGTCCCTTGACCAC>M16-LCMT-F H02.ab1GGTCCCTTGACCAC 400