Answer:
A deciduous tree leaf because it basically means fruit tree
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?
a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.
However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).
Therefore, the sequence o mRNA read in the 5' to 3' direction is:
5' CUAUGGAAACACAUCAGUAGAA 3'
b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.
The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.
The codons, then will be:
AUG GAA ACA CAU CAG UAG
Then, we can say that the amino acids translated will be:
Met Glu Thr His Gln
(Methionine - Glutamine - Threonine - Histidine - Glutamine
c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.
why is electricity considered a source of energy.
The deer, snakes, and frogs represented in the food web are all types of
1 consumers
2 prey.
3 herbivores
4 predators
Describe the events that occur from the time a motor neuron releases acetylcholine at the neuromuscular junction until a muscle until a muscle cell contraction occurs and is ready to fire again
Muscle cell contraction is a complex process that involves several steps, from the release of acetylcholine by a motor neuron to the contraction of a muscle fiber.
The following are the events that occur from the time a motor neuron releases acetylcholine at the neuromuscular junction until a muscle cell contraction occurs and is ready to fire again:
Step 1: A motor neuron releases acetylcholine (ACh) at the neuromuscular junction, which is the point where a motor neuron and a muscle fiber meet.
Step 2: Acetylcholine binds to receptors on the muscle fiber, which leads to the opening of ion channels in the muscle fiber membrane. This allows for the flow of sodium ions (Na⁺) into the muscle fiber and the flow of potassium ions (K⁺) out of the muscle fiber. This results in a change in the electrical charge across the muscle fiber membrane.
Step 3: The change in electrical charge across the muscle fiber membrane triggers the release of calcium ions (Ca²⁺) from the sarcoplasmic reticulum (SR) in the muscle fiber. Ca²⁺ binds to troponin, a protein that is part of the thin filaments in the muscle fiber.
Step 4: Binding of Ca²⁺ to troponin leads to a shift in the position of tropomyosin, another protein that is part of the thin filaments in the muscle fiber. This shift exposes myosin binding sites on actin, another protein that is part of the thin filaments in the muscle fiber.
Step 5: Myosin, a protein that is part of the thick filaments in the muscle fiber, binds to actin at the exposed myosin binding sites. This binding is the start of the contraction cycle.
Step 6: ATP hydrolysis by myosin provides the energy for myosin to pull actin towards the center of the sarcomere, which is the basic unit of a muscle fiber. This is known as the power stroke.
Step 7: The binding of a new ATP molecule to myosin causes myosin to detach from actin. The cycle then repeats, with myosin binding to actin at a new site and the power stroke occurring again. This cycle continues as long as Ca²⁺ is present and ATP is available.
In summary, the events that occur from the time a motor neuron releases acetylcholine at the neuromuscular junction until a muscle cell contraction occurs and is ready to fire again are as follows:1. Motor neuron releases acetylcholine (ACh) at the neuromuscular junction.2. ACh binds to receptors on the muscle fiber, leading to the opening of ion channels and a change in the electrical charge across the muscle fiber membrane.3. Change in electrical charge triggers the release of calcium ions (Ca²⁺) from the sarcoplasmic reticulum (SR) in the muscle fiber.4. Ca²⁺ binds to troponin, leading to a shift in the position of tropomyosin and exposing myosin binding sites on actin.5. Myosin binds to actin at the exposed myosin binding sites, starting the contraction cycle.6. ATP hydrolysis by myosin provides the energy for myosin to pull actin towards the center of the sarcomere, known as the power stroke.7. Binding of a new ATP molecule to myosin causes myosin to detach from actin and the cycle repeats as long as Ca²⁺ is present and ATP is available.
The events that occur from the time a motor neuron releases acetylcholine at the neuromuscular junction until a muscle cell contraction occurs and is ready to fire again involve a complex series of steps that involve the opening of ion channels, the release of calcium ions, and the binding of myosin to actin. The cycle of myosin binding to actin and pulling actin towards the center of the sarcomere, known as the power stroke, continues as long as Ca²⁺ is present and ATP is available.
To know more about acetylcholine, visit:
https://brainly.com/question/29855206
#SPJ11
Increasing the rate of an impulse is the function of the __________. A. Myelin sheath B. Axon terminals C. Cell body D. Axon Please select the best answer from the choices provided A B C D.
From what we know, we can confirm that Increasing the rate of an impulse is the function of the Myelin sheath.
What is the Myelin sheath?This can be considered as a protective layer that can be found around the axons of nerve cells. This is the case will neurons throughout the brain and spinal cord. This sheath allows electrical impulses to be conducted faster and more frequently.
Therefore, given its function, we can confirm that increasing the rate of an impulse is the function of the Myelin sheath.
To learn more about neurons visit:
https://brainly.com/question/9401108?referrer=searchResults
N20 can be removed from the atmosphere through the nitrogen cycle true or false?
Answer:
The answer is False
Explanation:
Nitrous oxide is removed from the atmosphere when it is absorbed by certain types of bacteria or destroyed by ultraviolet radiation or chemical reactions.10. is it possible for a person consuming adequate amounts of milk and egg sources of protein to be deficient in niacin? why or why not?
It is unlikely for a person consuming adequate amounts of milk and egg sources of protein to be deficient in niacin. Milk and eggs are considered good sources of niacin, also known as vitamin B3. They contain appreciable amounts of niacin in the form of nicotinamide and nicotinic acid.
Niacin is an essential nutrient involved in various metabolic processes in the body. It plays a crucial role in energy production, DNA repair, and the functioning of the nervous system. While other dietary factors and individual variations can affect niacin requirements, a balanced diet that includes sources of niacin, such as milk and eggs, can typically provide adequate levels of this nutrient.
Learn more about Niacin: https://brainly.com/question/28347414
#SPJ11
Which statement best describes why invasive species often thrive in foreign lands?
a. They always have more food to eat in the new habitat.
b They are free from the predators of their native habitats.
с They are transported by humans.
d The climate is always better in the new habitat.
Answer:
They are free from the predators of their native habitats.
Explanation:
the enzyme(s) called __________ break(s) down the substrate called __________.
The enzyme(s) called peptidases break(s) down the substrate called proteins.
Peptidases are the digestive enzymes that can break down the large proteins into smaller peptides or even single amino acids. This process is known as proteolysis. The enzyme is produced in the small intestine of the digestive system.
Proteins are the biomolecules made up of amino acid as the monomers. These are the functional forms of genes that are involved in every function of the body. The proteins are synthesized in the cytoplasm of the cell where ribosomes are present. Proteins are involved in functions like signaling, enzymatic, transport, etc.
To know more about peptidases, here
brainly.com/question/1685816
#SPJ4
why does the rate of heat loss decrease as the average body length of an animal increases?
Answer:
Convective heat loss is the transfer of heat from a body to moving ... air layer is increased, or the free air velocity decreased, heat loss is reduced.
Explanation:
hope it helps you friend ☺️
First To Answer Correctly, Gets Brainliest!!!! Connective tissue is present in bones, and blank, muscle tissue makes up muscle, nerve tissue transmits blank and forms nerves, and blank tissue lines organs and covers the body.
Answer:
what
Explanation:
Answer: uh I'm going to say B).
Explanation: Hope this helps? .-.
Peptidoglycan is present in the cell walls of which of the following groups of organisms? you can select more than one if more than one applies)
-plants -archaea
-protists
-eubacteria
Peptidoglycan is present in the cell walls of eubacteria. Peptidoglycan is a polymer that forms the major component of bacterial cell walls in eubacteria, as well as in some archaea.
Here, the correct answer is "eubacteria.
Peptidoglycan is a network of polysaccharide chains that are cross-linked by short peptide fragments. It is a polymer that forms the major component of bacterial cell walls in eubacteria and some archaea. These chains are primarily composed of two alternating amino sugars, namely N-acetylglucosamine (GlcNAc) and N-acetylmuramic acid (MurNAc), which are linked by β(1→4) glycosidic bonds.
Peptidoglycan is a major constituent of bacterial cell walls and is responsible for their rigidity. It is critical for the survival of the bacteria because it protects them from changes in osmotic pressure, maintains their shape and structural integrity, and mediates interactions with other microorganisms and their hosts.
Therefore, correct option is eubacteria.
know more about eubacteria here
https://brainly.com/question/5186929#
#SPJ11
Biomagnification is... concentration of a contaminant stays the same as you move to higher trophic concentration of a contaminant increases as you move to higher trophic level concentration of a contaminant increases as an individual grows concentration of a contaminant stays the same as an individual grows
Answer: Biomagnification refers to the process by which the concentration of a contaminant increases as you move to higher trophic levels in a food chain or food web. In other words, as organisms consume other organisms, the contaminants present in the prey accumulate and become more concentrated in the bodies of the predators.
To understand this process, let's consider an example involving a water ecosystem. Suppose a pollutant is released into the water, such as a pesticide or heavy metal. The primary producers, such as algae or aquatic plants, absorb small amounts of the contaminant from the water. As herbivorous organisms consume these primary producers, they ingest the contaminants along with their food.
Since the contaminant is not easily broken down or eliminated from the organisms' bodies, it accumulates over time. As a result, the concentration of the contaminant becomes higher in the herbivores than in the primary producers. Now, when carnivorous organisms consume the herbivores, they not only accumulate the contaminant from their own food but also from all the prey they have consumed. This leads to an even higher concentration of the contaminant in the carnivores.
Therefore, biomagnification describes the phenomenon where the concentration of a contaminant increases significantly as you move up the food chain or trophic levels. The highest concentration of contaminants is often found in top predators, such as large fish, birds of prey, or mammals, which can have adverse effects on their health and reproductive capabilities.
It's important to note that biomagnification primarily occurs for persistent and non-biodegradable contaminants that cannot be easily metabolized or excreted by organisms. These contaminants are often lipophilic (fat-soluble), which allows them to accumulate in fatty tissues and remain in the organism's body for long periods, leading to biomagnification.
Explanation:
FILL IN THE BLANK. the best point estimate of the population variance sigmasquared is the _____________.
The sample variance, s-squared, provides the most accurate point estimate of the population variance, sigma squared.
Sample variance is used to calculate the variability in a particular sample. A sample is a group of observations drawn from a population that can serve as a representative sample of the full population. Calculating the sample variance in proportion to the data set mean. Alternatively known as the estimated variance.
There are two formulas available to compute the sample variance because data can be clustered or ungrouped. Taking the sample variance's square root yields the sample standard deviation as well. In this post, we will delve into greater detail about sample variance, its computations, and numerous examples.
know more about population here
https://brainly.com/question/27991860#
#SPJ4
Describe the following types of cell signaling:
Autocrine:
Juxtacrine:
Endocrine:
Paracrine:
Answer:
Autocrine:Autocrine signaling means the production and secretion of an extracellular mediator by a cell followed by the binding of that mediator to receptors on the same cell to initiate signal transduction. A well-characterized form of autocrine signaling is the secretion of IL-1 by macrophages.
Juxtacrine:In biology, juxtacrine signalling (or contact-dependent signalling) is a type of cell–cell or cell–extracellular matrix signalling in multicellular organisms that requires close contact. ... A membrane ligand (protein, oligosaccharide, lipid) and a membrane protein of two adjacent cells interact.
Endocrine:The endocrine system is the collection of glands that produce hormones that regulate metabolism, growth and development, tissue function, sexual function, reproduction, sleep, and mood, among other things.
Paracrine:Paracrine signaling is a form of cell signaling or cell-to-cell communication in which a cell produces a signal to induce changes in nearby cells, altering the behaviour of those cells. ... However, the exact distance that paracrine factors can travel is not certain.
Explanation:
Hope this helps you
Crown me as brainliest:)
biological magnification is a natural process when a persistent material is taken-up by primary producers because:
The process of some chemicals building up in living things to a concentration that is higher than what occurs in the inorganic, non-living world is known as "biomagnification" or "biological magnification."
What is meant by biomagnification ?Biomagnification is the accumulation of a chemical by an organism as a result of exposure to both food and water, resulting in a concentration that is higher than what would have been expected from equilibrium and higher than what would have occurred with only water exposure.
The accumulation of a certain material in the bodies of creatures at various trophic levels of a food chain is known as biomagnification. The buildup of the chemical DDT in zooplanktons is one instance of biomagnification in action. These zooplanktons are consumed by little fish.
The process of some chemicals building up in living things to a concentration that is higher than what occurs in the inorganic, non-living world is known as "biomagnification" or "biological magnification."
To learn more about biomagnification refer to :
https://brainly.com/question/7631542
#SPJ4
How does tRNA determine the correct sequence in which to assemble the amino acids?
sequence of nitrogenous bases in DNA determines the order in which tRNA gets attached to mRNA
HOPE THIS HELPS
Which of the following is an example of an object that is accelerating?
A
A basketball sits motionless on the gymnasium floor.
B
A hockey puck slows down and comes to a stop.
с
A soccer ball travels at 3 m/s for one second.
D
A train travels 100 km in a straight path towards the northeast.
Answer:
B
Explanation:
acceleration is a change in velocity, and situation B is the only situation where the velocity of the object is changing
Answer:
D.
Explanation:
Answer A - The basketball is not moving, motionless.
Answer B - The hockey puck eventually stops moving.
Answer C - The soccer ball eventually stops after one second.
Answer D is correct because the train is continuously moving.
How to poop effectively in the toilet poop poop poop poop poop poop poop pooppooppoop poop poop poop
Few tips for pooping effectively in toilet are relaxing, having adequate time, siting in correct posture, using gravity. Also making sure to intake fiber rich food, while staying hydrated in the key.
To poop effectively in the toilet, follow these tips:
1. Relax: Find a comfortable position and relax your body. Stress or tension can make it difficult to have a bowel movement.
2. Adequate time: Allow yourself enough time in the bathroom. Rushing can interfere with the natural process.
3. Correct posture: Sit on the toilet with your feet flat on the floor or a footstool, slightly elevating your knees. This position mimics a squatting posture, which can help align the rectum for easier elimination.
4. Use gravity: Allow gravity to assist you by leaning slightly forward or placing your hands on your knees. This position helps to straighten the rectum, facilitating the passage of stool.
5. Don't strain: Avoid excessive straining or holding your breath, as it can lead to unnecessary pressure and make elimination difficult.
7. Fiber-rich diet: Maintain a balanced diet that includes plenty of fiber from fruits, vegetables, whole grains, and legumes. Fiber adds bulk to the stool, making it easier to pass.
8. Stay hydrated: Drink an adequate amount of water throughout the day to keep stools soft and easier to pass.
for more questions on pooping
https://brainly.com/question/29630973
#SPJ8
true or false are acts like a blanket that keeps the earth warm
Answer:
True
Explanation:
The air, aka the atmosphere, is like a protective blanket around the Earth that keeps it warm amongst other things.
Which of the following is an Abiotic factor?
Wind
Animals
Plants
Humans
Answer:
Wind
Explanation:
what is the correct order of protein production?
1) ribosome
2) endoplasmic reticulum
3) secretory vesicles
4) golgy apparatus
a) 1,2,3,4
b) 2,4,3,1
c) 1,2,4,3
d) 3,2,4,1
Answer:
The correct order of protein production is:
c) 1,2,4,3
Ribosome: Protein synthesis begins in the ribosomes, which are located either in the cytoplasm or attached to the endoplasmic reticulum.
Endoplasmic Reticulum: After the initial stages of protein synthesis in the ribosomes, the newly synthesized protein is transported into the endoplasmic reticulum (ER) for further processing and modification.
Golgi Apparatus: The proteins synthesized in the ER undergo further processing and modifications in the Golgi apparatus. This includes sorting, packaging, and modifying the proteins to their final functional forms.
Secretory Vesicles: Once the proteins are properly processed and modified in the Golgi apparatus, they are packaged into secretory vesicles. These vesicles transport the proteins to their destination, such as the plasma membrane for secretion outside the cell.
Therefore, the correct order is 1, 2, 4, 3.
Answer:
The correct order of protein production is ribosome, endoplasmic reticulum, Golgi apparatus, and secretory vesicles. So the correct answer would be c) 1,2,4,3.
Many proteins destined for the endoplasmic reticulum, the Golgi apparatus, lysosomes, the plasma membrane, and secretion from the cell are synthesized on ribosomes that are bound to the membrane of the endoplasmic reticulum. The Golgi apparatus then distributes these proteins and lipids that it receives from the ER.
Why is the cheetah gene pool small today?
When a natural disaster dropped their total world population down to less than seven individual cheetahs.
which of the following is an artificial
hormone
PAA
IBA
NAA
ALL OF THESE
pls...help Mee with the correct answer
What is the difference in the concentration of molecules in two areas across a membrane.
The difference in the concentration of molecules in two areas across a membrane is concentration gradient.
In the field of science, concentration gradient can be described as a term that is used when there is a difference in the number of molecules inside and outside the membrane. Due to this difference, molecules either pass into a cell or outside of a cell.
When the concentration of a molecule is higher outside a cell as compared to the inside of a cell, a concentration gradient will develop. As a result of this concentration gradient, molecules will move into the cell.
To learn more about concentration gradient, click here:
https://brainly.com/question/13814995
#SPJ4
Repeat the process again when one parent is heterozygous black and the other is
homozygous brown.
Genotypes:
% homozygous black fur (BB)
% heterozygous black fur (Bb)
% homozygous brown fur (bb)
Phenotypes:
% black fur
% brown fur
Answer:
genotypes:
0% homozygous black fur (BB)
50% heterozygous black fur (Bb)
50% homozygous brown fur (bb)
phenotypes:
50% black fur
50% brown fur
Explanation:
B b
b . Bb bb
b . Bb bb
what happens if a cell divides with damaged present in its dna
If a cell has a mistakes in its DNA that can not be repaired, it could go through self-destruction (apoptosis ).
Apoptosis is a not a common technique for the duration of existence that facilitates the frame remove cells that now no longer paintings or that it would not need. Most DNA harm receives repaired right away due to those proteins. But if the DNA harm takes place to a gene that makes a DNA restore protein, a mobile has much less cap potential to restore itself. So mistakes will increase in different genes over the years and permit a most cancers to form. The cell cycle will now no longer continue to the following stage. Due to which the following department will now no longer happen. This will result in cell death. DNA harm can have an effect on everyday mobile replicative characteristic and effect fees of apoptosis (programmed mobile death, regularly stated as 'cellular senescence').
To learn more about cell check the link below:
https://brainly.com/question/3717876
#SPJ4
Near the end of both March and September,
a. spring begins in both hemispheres.
b. the sun's rays strike Earth with the same intensity everywhere.
c. Earth's axis is no longer pointing at the North Star.
d. neither end of Earth's axis is tilted toward the sun.
Answer:
A. Spring begins in both hemispheres.
Explanation:
There are 2 equinoxes in a year. One on 21st March and one on 22nd September. This is when both side of the hemispheres have roughly the same amount of daytime and nighttime.
which of the following statements are true regarding the early stages of biofilm formation? choose one or more: a. it requires communication between two or more bacterial species. b. cells may initially explore the substrate via twitching motility. c. environmental cues, such as ph and temperature, signal planktonic cells to settle. d. initial attachment involves cell surface structures (such as flagella, fimbriae, pili, and lps). e. early colonists coat the surface with glycoproteins to recruit more cells. f. cells at this stage are very resistant to antibiotics.
The following statements are true regarding the early stages of biofilm formation:
b. cells may initially explore the substrate via twitching motility
c. environmental cues, such as ph and temperature, signal planktonic cells to settle
e. early colonists coat the surface with glycoproteins to recruit more cells.
f. cells at this stage are very resistant to antibiotics.
The first steps involved in the origin of life on Earth, as well as the growth of living entities from a single cell, can be referred to as the early stage of bioformation.
Scientists think that the early stage of bioformation on Earth began with the formation of simple organic substances such as amino acids, sugars, and nucleotides. These molecules were most likely generated by chemical processes in the early Earth's atmosphere and ocean, which were abundant in carbon, nitrogen, and other important elements. These chemical components merged throughout time to form more complex molecules like proteins, DNA, and RNA, which are the building blocks of life.
For more such questions on biofilm formation, click on:
https://brainly.com/question/17130101
#SPJ4
Help due soon I’ll give brainliest
Over half of the people in Cape Canaveral, Florida are
over the age of fifty. How is
this related to Florida's role in space research?
A)
The Kennedy Space Center only hires people who are over fifty years old.
B)
The Cape Canaveral communities offer free medical care for senior citizens.
Cape Canaveral has laws only allowing senior citizens to live in the
community
An entire generation of space-industry workers retired in the Space Coast
area.
D)
Answer:
B
Explanation: