Describe the 4 steps taken to separate a solid mixture of iron fillings, chalk powde
and table salt based on their properties given below.
[3]
The first step has been done for you.
Soluble in water?
Magnetic?
Decompose upon
heating?
No
Yes
No
Iron
Fillings
Chalk
powder
able salt
No
No
Yes
Yes
No
No

Answers

Answer 1

Answer:

no yes

Explanation:


Related Questions

placing a hydrophobic molecule into water causes water molecules to orient themselves around it.
T/F

Answers

True.

When a hydrophobic molecule is placed in water, it disrupts the hydrogen bonding between water molecules. As a result, water molecules near the hydrophobic molecule will orient themselves in a way that minimizes contact with it. This means that the hydrophobic molecule will be surrounded by water molecules that are arranged in a more ordered and structured way than the surrounding water. This effect is known as the hydrophobic effect and is responsible for many important biological processes, such as the folding of proteins. Overall, the hydrophobic effect plays a crucial role in determining the behavior of molecules in aqueous environments.

To know more about hydrophobic molecule visit:
https://brainly.com/question/30764518
#SPJ11

Un carrusel da 1 vuelta cada minuto. Una mamá se da cuenta que el niño está por caerse y arranca a protegerlo cuando el niño ya le lleva 90 grados de ventaja. ¿Con qué aceleración debe alcanzarlo antes de que el niño complete media vuelta? a)¿Si ambo van en el mismo sentido?b) ¿Si ambos van en sentido contrario?

Answers

The acceleration is of mother before child reaches half a revolution is,
a) 0.42 radians per second squared b) 0.42 radians per second squared

If both are moving in the same direction, the relative velocity of the child with respect to the mother is the angular velocity of the carousel, which is 2π radians per minute. The mother needs to cover the same distance as the child in half the time, so her relative velocity with respect to the child must be twice the angular velocity of the carousel, which is 4π radians per minute.

To calculate the required acceleration, we can use the formula: acceleration = (final velocity - initial velocity) / time. Since the mother starts from rest and reaches a velocity of 4π radians per minute, the final velocity is 4π radians per minute. The time to cover half a revolution is 30 seconds. Therefore, the acceleration required for the mother to catch up with the child is,

acceleration = (4π - 0) / 30 = 4π/30 ≈ 0.42 radians per second squared

If both are moving in opposite directions, the relative velocity of the child with respect to the mother is the sum of their individual angular velocities. Since the mother is moving in the opposite direction to the carousel, her angular velocity is -2π radians per minute. Therefore, the relative velocity is (2π - (-2π)) = 4π radians per minute.

Using the same formula as before, the acceleration required for the mother to catch up with the child is,

acceleration = (4π - 0) / 30 = 4π/30 ≈ 0.42 radians per second squared

To know more about acceleration, here

brainly.com/question/28810559

#SPJ4

--The complete question is, A carousel completes 1 revolution every minute. A mother realizes that her child is about to fall and starts moving to protect him when the child already has a 90-degree lead. What acceleration must she reach to catch up with him before the child completes half a revolution? a) If both are moving in the same direction? b) If both are moving in opposite directions?--

3) An earth moving machine uses diesel oil, which when burnt will produce 3.0x10 9 J of energy. The work performed by the machine is 2.7x 10 8 J. What is the efficiency of the machine?

Answers

Answer:

The answer is below

Explanation:

The efficiency of a machine is the ratio of its output to its input. The efficiency shows how effective the machine by the way it converts the input energy into work. The higher the efficiency of the machine the more effective it is. The efficiency is usually less than 1.

Given that the machine uses diesel oil (input) that can produce 3.0 x 10⁹ J of energy while the work performed by the machine (output) is 2.7 x 10⁸ J. The efficiency is given as:

Efficiency = output / input = 2.7 x 10⁸ J / 3.0 x 10⁹ J = 0.09 = 9%

This means that the machine is not effective because of its low efficiency

17) Name two ways you could decrease the potential energy of a bucket full of water sitting on a bench.

Answers

Answer: Two ways you could decrease the potential energy of a bucket full of water sitting on a bench are: -(i) Lift it in such a way that you decrease its height as compared to the bench.(ii) Put it on a stool whose height is lower than the bench.

Explanation:

The potential energy of an object has the following formula

         Potential energy = mgh

      where m = mass of the object

                   g = acceleration due to gravity

                   h = height of the object

This means that the potential energy of an object depends upon its mass, acceleration due to gravity, and height.

In the given situation we have a bucket full of water. If the mass and acceleration due to gravity are not changed, the only way the potential energy can be decreased is by reducing the height of the bucket full of water.

This can be done by: -

         (i) Lifting the bucket full of water in such a way that you

             decrease its height as compared to the bench.

        (ii) Put the bucket full of water on a stool whose height is

            lower than the bench.

Answer:

1.By decreasing it's contents- this decreases the weight of the bucket thus decreasing the potential energy of the bucket.

2.By decreasing the height of the bench we have decreased the amount of potential energy stored in the bucket

Put the steps in order to show how crystals are formed

Answers

Answer:

A) Formation of ions

B)Formation of ionic bonds

C)Formation of cubes

D)Formation of crystals

Hope this helps

Answer:

1 4 2 3

Explanation:

edge 2021

Lucy and JoJo need to make 140 cupcakes for the school dance. Lucy made 35 of the cupcakes. JoJo made 42 cupcakes What fraction of the cupcakes do Lucy and JoJo still need to make?

Answers

Answer:

9/20

Explanation:

According to this question, Lucy and JoJo need to make 140 cupcakes for the school dance. Lucy made 35 of the cupcakes while JoJo made 42 cupcakes. This means that in total, (42 + 35) cupcakes has been made by both Lucy and JoJo

That is, 77 cupcakes out of 140 has been made. This is 77/140 i.e. 11/20

Since 77/140 cupcakes has been made, Lucy and JoJo still need to make;

140 - 77 = 63 cupcakes to meet up their target for the school dance.

This means that the fraction left is 63/140

63/140 in its lowest term is 9/20

Hence, 9/20 of the cupcakes still need to be made by Lucy and JoJo.

Explanation: 140 - 35 = 105 - 42 = 63

yare yare daze

I use tusk act 4 main

Pls help me!!!!!!!!!!!!!!!!!

Pls help me!!!!!!!!!!!!!!!!!

Answers

Answer:they are a renewable source

Explanation: because they come from the ocean and the ocean is 75% of the world so there will always be waves.

Answer:

All movement is energy. The world's tides, ocean waves and river currents all contain kinetic and potential energy that can be used to drive turbines and produce electricity, reducing our dependence on fossil fuels.

Your welcome

In the circuit shown in the figure (Figure 1), find the magnitude of current in the upper branch. Find the magnitude of current in the middle branch. Find the magnitude of current in the lower branch. What is the potential difference V_ab of point a relative to point b?

Answers

a) The upper branch's current magnitude is 0.8 A (la).

b) The middle branch's current density is 0.2 A.

c) The lower branch's current density is equal to 0.6 A.

What is current?

Any progression of electrical charges, such as submicroscopic charged particles like electrons with electrostatic repulsion and protons with positive charge, ions, nucleons that have received or lost one or even more charge carriers, or holes, charge carrier insufficiencies that can be believed of as positive particles, constitutes an electrical charge.

Briefing:

la+lb+Ic=0

=>lb-1+lb+Ic=0

=>2lb+Ic=1

=>4Ic-2+Ic=1

⇒>5Ic=3

=>Ic=3/5=0.6

so lb=2Ic-1=0.2

la=lb-1=-0.8

between a and b,

Va-3la+4lb-Vb=0

⇒>Va - Vb = 3la-4Ib

=-3×0.8-4×0.2

=-2.4-0.8

=-3.2 V

To know more about current visit:

https://brainly.com/question/12882120

#SPJ4

prove p=f/a science chapter pressure​

Answers

Explanation:

Let 'F' be force acting perpendicularly, 'A' be the area and 'P' be the pressure exerted.

Then,

Pressure is directly proportional to the the force acting perpendicularly i.e.

P ∝ F ............. (i)

Pressure is inversely proportional to the area on which force acts i.e.

P ∝ 1/A ........... (ii)

Combining equations (i) and (ii),

P ∝ F/A

or, P = K × F/A [where K is a constant]

If F is 1N, A is 1m² and P is 1 N/m², then K is 1.

So, P = F/A proved...

Two objects (X and Y) are placed a distance of 2.005 m from each other. The charge on X is 4.505 x 10-6 C. If the force

between the objects is 0.3750 N, what is the charge on Y? Round to the appropriate number of sig figs. Do not include the

units. Do not put your answer in scientific notation.

С

Blank 1:

Answers

Therefore, the charge on object Y is 3.26 μC.

The force between two charged objects is given by Coulomb's law:

F = k * (q1 * q2) / r^2

where F is the force, k is Coulomb's constant (9 × 10^9 N·m^2/C^2), q1 and q2 are the charges on the objects, and r is the distance between them.

In this problem, we have q1 = 4.505 × 10^-6 C, r = 2.005 m, and F = 0.3750 N. We want to find q2.

Rearranging Coulomb's law to solve for q2, we get:

q2 = (F * r^2) / (k * q1)

Substituting the given values, we get:

q2 = (0.3750 N * (2.005 m)^2) / (9 × 10^9 N·m^2/C^2 * 4.505 × 10^-6 C)

q2 = 3.26 × 10^-6 C

Therefore, the charge on object Y is 3.26 μC.

To know more about Coulomb's law click here:

https://brainly.com/question/506926

#SPJ11

Dos masas con valores de 8kg y 12kg cada una se encuentran separadas por una distancia de 1m. Determinar la fuerza de atraccion gravitacional entre ellas si se compara con el valor de sus pesos Como es este valor?

Answers

The question is: Two masses with values ​​of 8kg and 12kg each are separated by a distance of 1m. Determine the force of gravitational attraction between them if compared with the value of their weights. What is this value?

Answer: The force of gravitational attraction between them if compared with the value of their weights is \(640.704 \times 10^{-11} N\).

Explanation:

Given: \(m_{1}\) = 8 kg,       \(m_{2}\) = 12 kg

Distance = 1 m

Formula used is as follows.

\(F = \frac{G \times m_{1} \times m_{2}}{r^{2}}\)

where,

F = force of gravitational attraction

G = gravitational constant = \(6.674 \times 10^{-11} N m^{2}/kg^{2}\)

\(m_{1}\) = mass of object 1

\(m_{2}\) = mass of object 2

r = distance between the centers of these two objects

Substitute the values into above formula as follows.

\(F = \frac{G \times m_{1} \times m_{2}}{r^{2}}\\= \frac{6.674 \times 10^{-11} Nm^{2}/kg^{2} \times 8 kg \times 12 kg}{(1 m)^{2}}\\= 640.704 \times 10^{-11} N\)

Thus, we can conclude that the force of gravitational attraction between them if compared with the value of their weights is \(640.704 \times 10^{-11} N\).

Let h : Z → R be the point mass function of some distribution.
a) Let Ω = Z × Z. Show that if we define each ω = (ω1, ω2) ∈ Ω,
pω = hω1 hω2, then (pω)ω∈Ω is the point mass function of some distribution.
b) Consider the random variable X : Ω → Z, X(ω) = ω1 + ω2. Show that X's
the point mass function of the distribution, i.e. PX, is

Hints: the a) point is largely a repetition of the old one, but the latter point may require some thought. In particular, you should think about why it is enough to calculate
probability P({ω ∈ Ω : X(ω) = x}). For this, you should think about
that what this event has to do with the event
​​​​​​​x - n}
and why it can be applied to calculate the probability of this event
definition of probability distribution.

Answers

We have demonstrated that (pω)ω∈Ω is the point mass function of some distribution, and that the random variable X has a point mass function PX equal to (pω)ω∈Ω.

In order to show that (pω)ω∈Ω is the point mass function of some distribution, we need to demonstrate that it satisfies the properties of a probability distribution.

a) Let's consider the properties of a probability distribution. Firstly, the values of pω must be non-negative for all ω ∈ Ω. This is true since pω is defined as the product of two non-negative values hω1 and hω2.

Secondly, the sum of probabilities over all possible outcomes must be equal to 1. In this case, we need to show that the sum of (pω)ω∈Ω over all possible ω in Ω is equal to 1. To do this, we can consider the sum:

Σ(pω)ω∈Ω = Σ(hω1 hω2)ω∈Ω

By the properties of the point mass function h, we know that Σhω1 = 1 and Σhω2 = 1. Therefore, the above expression becomes:

Σ(pω)ω∈Ω = Σ(hω1 hω2)ω∈Ω = 1 * 1 = 1

Thus, we have shown that (pω)ω∈Ω satisfies the properties of a probability distribution.

b) Now let's consider the random variable X(ω) = ω1 + ω2 and show that its point mass function PX is equal to (pω)ω∈Ω.

To calculate PX(x) = P({ω ∈ Ω : X(ω) = x}), we need to consider the event where the sum of the components ω1 and ω2 is equal to x. This can be expressed as:

{ω ∈ Ω : X(ω) = x} = {(ω1, ω2) ∈ Ω : ω1 + ω2 = x}

Now, notice that this event is equivalent to the event {ω1 = n, ω2 = x - n} for any fixed n. The probability of this event is given by pω1 pω2 = hω1 hω2, which matches the point mass function (pω)ω∈Ω.

By considering all possible values of n, we can cover all the cases for X(ω) = x, and therefore, we have shown that PX(x) is equal to (pω)ω∈Ω.

Learn more about mass function here:

https://brainly.com/question/30765833

#SPJ11

Juanita studies several free-body diagrams in which a normal force is shown. What is always true about a normal force in a free-body diagram?

Answers

Answer: B

Explanation: it is perpendicular to a surface

Answer:

it is perpendicular to a surface

Explanation:

What is the weight on Earth of a girl with a mass of 32 kg (F = ma)?

Answers

Answer:

~ 314 N

Explanation:

F = ma

  = 32 ( 9.81) = ~ 314 N

10 solve the following humeric problem - S. a What is the lift height of salu? T. object energy required to 25 kg to mass of a 10 m.

Answers

Mass=m=25kgHeight=h=10mAcceleration due to gravity=g=10m/s^2

\(\boxed{\sf E_P=mgh}\)

\(\\ \sf\longmapsto E_P=25(10)(10)\)

\(\\ \sf\longmapsto E_P=25(100)\)

\(\\ \sf\longmapsto E_P=2500J\)

Explain a situation in which a lighter object would take more work to move than a heavier object

Answers

Answer: The lighter object could be pushed up a much steeper incline and for a much longer distance.

Explanation: Using the formula for work, W= F d cosФ, you can see that it takes into account distance and the angle of the incline. With a much larger incline and with much more distance to cover, eventually the lighter object would require more work than a heavier object with no incline and very little distance to cover.

Which option is an example of a chemical reaction that occurs at a very slow rate?

Answers

You haven’t put the option but I’ve done this question and it is d

Answer:D

Explanation:

:)

water has a density of about 0.0361 pounds/cubic inch. you might know that wood floats on water. what can you conclude about the densities of objects that float and the densities of objects that do not? review your results from parts b and c before deciding.

Answers

The density of an object determines whether it will float or sink in water. Objects with lower densities float, while objects with higher densities sink. On the other hand, if the density of an object is greater than the density of water, it will sink.

The density of an object determines whether it will float or sink in water. If the density of an object is less than the density of water, it will float. On the other hand, if the density of an object is greater than the density of water, it will sink.
In this case, since the density of water is 0.0361 pounds/cubic inch, any object with a density less than 0.0361 pounds/cubic inch will float. Therefore, we can conclude that objects with lower densities float, while objects with higher densities sink.
For example, if we have a piece of wood with a density of 0.02 pounds/cubic inch, it will float because its density is lower than that of water. However, if we have a metal block with a density of 0.04 pounds/cubic inch, it will sink because its density is higher than that of water.
To summarize, the density of an object determines whether it will float or sink in water. Objects with lower densities float, while objects with higher densities sink.

To know more about density visit:

https://brainly.com/question/29775886

#SPJ11

A charge of 6.5 x 10-5 C is attracted by another charge with a force of 250 N when
they are separated by 0.15 m. Find the magnitude of the other charge.
8.65 X 105 C
9.62 × 10-2 C
6.15 x 10-6 C
O 9.62 x 10 c

Answers

Answer:

We can use Coulomb's law to solve this problem:

F = k * q1 * q2 / r^2

where F is the force between the two charges, k is Coulomb's constant (k = 9 x 10^9 N m^2 / C^2), q1 and q2 are the magnitudes of the charges, and r is the distance between them.

We know the force F, the distance r, and the magnitude of one of the charges q1. We can rearrange the equation to solve for the magnitude of the other charge q2:

q2 = F * r^2 / (k * q1)

Substituting the values we have:

q2 = (250 N) * (0.15 m)^2 / (9 x 10^9 N m^2 / C^2 * 6.5 x 10^-5 C)

Simplifying:

q2 = 8.65 x 10^5 C

Therefore, the magnitude of the other charge is 8.65 x 10^5 C.

A dog runs to the left for 20 meters and five seconds. then the dog runs to the right 35 meters in 10 seconds , stands still for 30 seconds and finally runs 15 meters right in 10 seconds. write a title for the graph and correctly label and scale

Answers

The accurate title for the graph is; "A graph of distance against time" and the scale on the x axis is 2cm:1 unit while the scale on the y axis is 2cm: 5 units.

What is a scale?

The term scale has to do with the way that we can be able to represent information on paper. It is common that the information that we are trying to depict is too large that we can not easily show the information on paper. This is why we need a graph so that it can be compressed and still be readable by all.

In this case, we are being asked to get a good title for the graph and also to suggest a scale that would be very good for us to be able to present the information and make it intelligible. We must consider the magnitude pf the data so as to do this.

Learn more about scale diagrams:https://brainly.com/question/21804002

#SPJ1

You toss an apple across the room to a friend. Which of the following
statements is true about the apple at the top of its trajectory?

You toss an apple across the room to a friend. Which of the followingstatements is true about the apple

Answers

I believe the answer is C, but im not sure.

Explanation:

Answer:

its vertical component of its velocity is zero

Explanation:

When you are riding in a car then the driver suddenly steps on the gas pedal, why do you feel a jolt and push back?

Answers

Answer:

Effects of Interia

As a more familiar example of inertia, think about riding in a car. ... If the car comes to a sudden stop, your body tends to keep moving forward. When the car starts moving again, your body tends to stay at rest. You move forward because the car seat exerts an unbalanced force on your body.

According to Newton's third law, action and reaction are equal and opposite.

What is Newton's third law?

According to Newton's third law, action and reaction are equal and opposite.

When the car suddenly stops due to the braking force, a reaction force counterbalances it which tends to move the passengers forward hence they all jolt forward.

Learn more about Newton's third law: https://brainly.com/question/974124

#SPJ2

* Question Completion Status: Moving to another question will save this response. Question 29 Which one of the following statements is not true? (choose all apply) O UV radiation is a type of ionizing

Answers

One statement that is not true is that UV radiation is a type of electromagnetic radiation. It is also a type of ionizing radiation. UV radiation is actually a form of non-ionizing radiation.

UV radiation, or ultraviolet radiation, is a type of electromagnetic radiation that falls between visible light and X-rays on the electromagnetic spectrum. It is often categorized into three types: UVA, UVB, and UVC. Unlike ionizing radiation, such as X-rays and gamma rays, which have enough energy to remove tightly bound electrons from atoms or molecules, UV radiation lacks the necessary energy to ionize atoms or molecules. Instead, it primarily interacts with the outermost electrons of atoms or molecules, leading to chemical reactions and causing biological effects.

UV radiation is commonly associated with sunlight and has various effects on living organisms and materials. It can cause sunburn, premature aging of the skin, and an increased risk of skin cancer. Exposure to excessive UV radiation can also damage the eyes and impair the immune system. It is important to protect oneself from excessive UV exposure by wearing sunscreen, protective clothing, and sunglasses.

Learn more about UV radiation here:

https://brainly.com/question/4144192

#SPJ11

A school bus moves at 15 m/s relative to an outside observer. If a student walks toward the front of the bus at 3 m/s relative to the bus, how fast is the student moving relative to the observer?

If the same student turns around and walks to the back of the bus at 3 m/s, what is the relative velocity of
the student to the observer?

Answers

Answer:

A.) 18 m/s

B.) 12 m/s

Explanation:

Given that a school bus moves at 15 m/s relative to an outside observer. If a student walks toward the front of the bus at 3 m/s relative to the bus, how fast is the student moving relative to the observer ?

Since the student direction is in the direction of the bus, the student velocity relative to the bus velocity will be:

15 + 3 = 18 m/s

Therefore, the observer will see the student moving very fast at a speed of 18 m/s

 If the same student turns around and walks to the back of the bus at 3 m/s, the student will be moving in an opposite direction. The relative velocity of the student to the observer will be 15 - 3 = 12 m/s

Therefore, the observe will see the student moving very fast at a speed of 12 m/s

A common activity like cooking a meal can use many natural _________.

Answers

A common activity like cooking a meal can use many natural Ingredients

Ingredients

Ingredients are substances combined to make a particular mixture such as a meal. most of the ingredients used for the preparation of a meal are sourced naturally.

In cooking different recipes of a meal the use of specific ingredients for each recipe differentiates the recipes.

Therefore we can conclude that cooking a meal requires the use of natural ingredients.

Learn more about cooking ingredients : https://brainly.com/question/1119876

A single stranded sequence of a gene is shown below. An investigator wants to amplify and isolate this small gene using PCR. Design two PCR primers, each 15 nucleotides long, that can be used to amplify this DNA segment. (remember that DNA sequences are written 5' to 3' by convention) ACTTTCCAAACGCCCCGTGTCGATACTGAACGAATCGATGCACGCTCCC TTCCTTGAAAACGCATAAACATACAAGTGGGCAGATGATGCGTACGCCC CTCTAATACATCCAACACTCTACGCCCTCTTCAAGAGCTGGAAGGGCA CCCTGCACTTGGATAGGGGATTATCTCGTAAGGCAAGCTCGTACCGTC ATTCATGCGGAAGAGTTAACACGATTGGAAGTAGGGATAGTTTCGAA CCTCGGTTACTAGTCCTAATAAGGGAACGCTGTCTGAAGGATGAGTGT CAGCCAGTGTA Forward Primer Reverse Primer

Answers

The forward primer for PCR amplification of the given gene sequence is 5'-ACTTTCCAAACGCCC-3', and the reverse primer is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.

To design the PCR primers for amplifying the given gene sequence, we need to identify regions that flank the target segment. The primers should be complementary to the template DNA and positioned in such a way that DNA synthesis occurs in the desired direction.

Based on the provided gene sequence, the forward primer is designed to bind to the coding (sense) strand of DNA. It starts at position 1 (5'-end) and extends for 15 nucleotides. The forward primer sequence is 5'-ACTTTCCAAACGCCC-3'.

The reverse primer, on the other hand, is designed to bind to the non-coding (antisense) strand of DNA. It starts at a position near the end of the gene sequence (position 241) and extends for 15 nucleotides in the opposite direction. The reverse primer sequence is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.

These primers will anneal to their complementary sequences on the template DNA during the PCR amplification process. The resulting amplicon will span the target gene segment and can be subsequently isolated and studied further.

To learn more about amplification click here brainly.com/question/30300512

#SPJ11

Provide three reasons for a leftward shift of the LM curve. Provide two reasons for a steep IS curve.

Answers

a. The shift of the LM curve to the left occurs due to a decrease in the money supply or an increase in the demand for money.

b. Two reasons for a steep IS curve are High Investment Demand and Inflexibility in Investment.

The LM curve shows the various combinations of interest rates and income that bring about the equality of the supply and demand for money.

Below are three reasons for the leftward shift of the LM curve:

1. Decrease in Money Supply: The leftward shift of the LM curve can occur if the money supply decreases. This causes the interest rates to rise because the demand for money is greater than the supply.

2. Increase in Money Demand: An increase in the demand for money can lead to a leftward shift of the LM curve. This happens when people want to hold more money than is available in the economy, and the interest rate rises as a result.

3. Increase in Prices: An increase in prices causes a leftward shift of the LM curve. This is because, at higher prices, people need more money to conduct their transactions, and an increase in the money supply is required to keep the interest rate constant.

Now, moving on to the steep IS curve:

1. High Investment Demand: A steep IS curve may occur if there is high investment demand. This happens when businesses are optimistic about the future and invest more, causing the demand for credit to increase and the interest rates to rise.

2. Inflexibility in Investment: A steep IS curve can also be caused by inflexibility in investment. This occurs when businesses are unwilling to change their level of investment due to economic conditions, and any changes in the interest rates have a significant effect on investment and output levels.

Learn more about investment demand from the given link:

https://brainly.com/question/15121395

#SPJ11

Part G
Based on your observation of the Tracker videos and the calculations of average vertical velocity and acceleration,
• Why do you think the vertical acceleration values are not equal to the theoretical acceleration due to gravity, -9.81 meters/second?
• What can you say about your earlier prediction about which ball will land first? If your hypothesis was wrong, can you propose an alternate
rationale for the observed results?

Part GBased on your observation of the Tracker videos and the calculations of average vertical velocity

Answers

Answer: I think the vertical acceleration values are not equal to the theoretical acceleration due to gravity, -9.81 meters/second2 due to the gravity force and maybe the drag due to air resistance.

Explanation: About my earlier prediction about which ball will land first, I can say that my hypothesis was right, but not quite because I calculated the average vertical acceleration, where the time period is t = 0.10 second to t = 1.00 second, the results were different. If the result were maybe right or close to the I would have said that my hypothesis was correct.

Other airplanes are designed with larger and more powerful propellers. Which of the following best explains why such a propeller could not be installed on Manny's airplane?

Answers

The reason that explains why such a propeller could not be installed on Manny's airplane is that Manny's airplane is likely not strong enough to withstand the forces caused by flying faster

What is a propeller?

A propeller is an object with a rotating hub and radiating blades pitched to form a helical spiral that, when rotated, applies linear thrust to a working fluid like water or air.

The propeller's function is to offer a means of propulsion so that the aircraft can move forward through the air. The propeller itself is made up of two or more interconnected blades that are fastened to the engine shaft by a central hub.

A propeller is a device that, when turned, moves you forward through a fluid. In this case, other aircraft have larger, more powerful propellers built into their designs. Manny's aircraft is not strong enough to withstand the forces of faster flight.

Learn more about propeller on:

https://brainly.com/question/14986599

#SPJ1

Do y’all know what A is?! I really need help!

Do yall know what A is?! I really need help!

Answers

It is the crest/peak.
Other Questions
What is the verb 3 of Split? What type of development tool is used when a group of individuals is selected to respond to a variety of items?a. content groupb. theory groupc. criterion groupd. convergent group Which one of these equations is an accurate expression of the balance sheet?A) Assets = Stockholders' equity - LiabilitiesB) Assets = Liabilities - Stockholders' equityC) Stockholders' equity = Assets - LiabilitiesD) Liabilities = Stockholders' equity - AssetsE) Stockholders' equity = Assets + Liabilities 2/5x10/7 in simplest form Einhard shows us the great Frankish king in his own times---in battle, at table, reading St. Augustine, educating his children, molding that rally of civilization we call the Carolingian Renaissance. Identify the best examples of Einhards "public relations spin depicting Charlemagne as the ideal King.Cite textual evidence to support your argument. During the War of 1812, which battleled to the Americans gaining controlof the Mississippi Territory?A. the Battle of Horseshoe BendB. the Battle of ShilohC. the Battle of Bull Run Solve the equation 4x+1=3 without a calculator, using either a table or a graph. (Find what x equals). In Mexico and most of Central America, most wealth is A. concentrated within the upper class. B. spread out evenly among all the people. C. divided between the middle class and the upper class. D. given to help the poorer class. Write a short story, no more than two A4 pages, from the perspective of a 1,000-year-old person. What have they seen over their long life? How do they feel about the world now? Ok i have a couple questions what is......87.57- 78.87 =___1.44- 0.149 =___10.5- 2.78 + 15.5 =___14.27- 2.27 - 0.05 =___ 7) use hf0 listed below to calculate h0rxn for the reaction c 4 hno3 ----> co2 4 no2 2 h2o hf0 (kj/mol) 0 -174.1 -393.5 33.2 -285.8 a) -123.9 kj b) -472.1 kj c) -201.9 kj d) -404.8 kj e) -135.9 kj group of answer choices a 3.Add 6.4 and -27.5A -33.9B. -21.1C. 21.1D. 33.9 Ege saat 21.30da yatt ertesi sabah 7.15'te uyand.Ege ka saat ka dakika uyuduACLLLLLLL LAZIM!!!!!!!!!!!!! any 4 differences between latitudes and longitudes.. A scientist has a 5.00 liter solution of 4.00 m nacl. if the scientist wanted to dilute the solution to 1.50 m, how many liters would the new solution need to be? where are you getting these numbers from?Question 4 (1 point) Saved If the solubility of CaCO3 is 10 g per 100.0 g of water at 25C, what would be the mole fraction of CaCO3 in this solution? 0.0270 0.0111 0.0196 0.1552100g of wate Definition: A group of steps or events that are in order is called a a nurse is seeing a client who is experiencing symptoms of moderate anxiety. she tells the nurse she and her parents disagree over her sexual orientation. which theory would best explain the course of the client's anxiety? Provide the correct verb form of Ser or Estar Soy de Alaska, pero trabajando en Chicago. Situational leadership requires the clear recognition of subordinate needs.a. true b. false