Describe the artistic style of Mesopotamian artists by the third century BCE.
This is what it is asking                  ​

Answers

Answer 1

Answer:

By the third century BCE, a distinct artistic style had already been established to define the Middle East and its people. Like most ancient art, it was religious in nature. Mesopotamian artists attempted to depict the relationship between the earthly and the heavenly. Most early Sumerian art was in the form of sculpture and found in the temple sphere. Votive statues have been found in ancient Sumerian temples that are believed to represent worshippers. These statues show people who are highly individual, with distinct hairstyles and clothing and of different shapes and sizes. However, all of them have widely open eyes, as if they are constantly alert.

Explanation: Took it right off the article and got 100%

Answer 2

Mesopotamian art and architecture was said to be widely known. The artistic style of Mesopotamian artists is described as;

It is viewed as a sophisticated and elaborate form of art. Their products were said to be very durable, in sculpture format, stone and clay forms. Their paintings is made up of unique geometric patterns with complicated designs. Mesopotamian art has a lot of forms such as cylinder seals, small figures in the round, and reliefs.

Three factors is known to  contribute to the character of Mesopotamian art and architecture. A factor is the sociopolitical organization of the Sumerian city-states.

Learn more from

https://brainly.com/question/16564120


Related Questions

Which of the following CANNOT be revealed about a work of art through observation of stylistic characteristics?
A. The artist who created it.
B. The meaning of the work of art.
C. The region in which it was created.
D.The period during which it was made.​

Answers

Answer:

A. the artist who created it

The  meaning of the work of art is what cannot be revealed about a work of art through observation of stylistic characteristics.

What is a work of art?

This means a painting or piece of sculpture that have a high quality, strong imaginatiion or aesthetic appealling.

Through the observation of stylistic characteristics if the work of art, we can reveal:

the artist who created itthe region in which it was createdthe period during which it was made.

Therefore, the Option B is correct.

Read more about work of art

brainly.com/question/1504175

1. In written music, the TIME SIGNATURE indicates how many beats
(counts) per measure, and which type of note receives one beat (count).
True or false?

Answers

The answer to your question is (TRUE)

What are the advantages of a common source amplifier over a common gate amplifier?

Answers

A common source amplifier has several advantages over a common gate amplifier, including:

1. High input impedance: A common source amplifier has a very high input impedance, which means that it draws very little current from the input signal source. This makes it ideal for amplifying voltage signals from high impedance sources, such as sensors or antennas.

2. Low output impedance: A common source amplifier has a low output impedance, which means that it can drive low impedance loads without significant loss of signal amplitude. This makes it ideal for driving long cables or other low impedance loads.

3. Voltage gain: A common source amplifier has a high voltage gain, which means that it can amplify small input signals to a much larger output signal. This makes it ideal for amplifying weak signals such as audio or radio signals.

4. Frequency response: A common source amplifier has a flat frequency response over a wide range of frequencies, which means that it can amplify signals without distorting their frequency content.

Overall, the common source amplifier is a versatile and reliable amplifier that is widely used in many electronic applications, including audio amplifiers, radio receivers, and sensor circuits.

The advantages of a common source amplifier over a common gate amplifier include higher voltage gain, better input impedance, and improved output impedance.

In electronics, a common source amplifier and a common gate amplifier are two types of amplifiers used in analog circuit design.

Both of these amplifiers have their own advantages and disadvantages, but in general, the common source amplifier offers higher voltage gain, better input impedance, and improved output impedance compared to the common gate amplifier.

One advantage of the common source amplifier is that it provides higher voltage gain. This is because the input signal is applied to the gate of the MOSFET transistor, which has high input impedance, and the output signal is taken from the drain, which has low output impedance.

This means that the common source amplifier can amplify the input signal by a greater amount than the common gate amplifier, resulting in a higher voltage gain.

Another advantage of the common source amplifier is that it offers better input impedance. The input impedance of an amplifier refers to the resistance seen by the input signal. In the common source amplifier, the input impedance is relatively high because the gate of the MOSFET transistor is isolated from the input circuit by a layer of insulation.

This means that the input signal is not significantly attenuated by the input impedance of the amplifier, which results in better fidelity of the output signal.

To learn more about amplifier, refer below:

https://brainly.com/question/16795254

#SPJ11

24. George Seurat used a painting technique called Pointillism to add color to Sunday Afternoon
on the Island of La Grande Jatte. In this technique, he placed tiny dots of paint next to each
other, rather than painting with smooth brushstrokes. Examine the piece and determine its mood.
How has the mood or feeling of the artwork effected by the artist's choice of painting technique?

Answers

Answer:

By using the artist's Pointillism, he wanted to give less spontaneity to the work and reinforce the effect of colors.

Explanation:

Pointillism highlighted the colors, making the work more vivid and eye-catching, even with the tiny blank spaces. This technique took away the air of spontaneity that the brushstrokes promoted. This created more focused works and with a mood of control, focus and concentration, giving the work a rigidity that other techniques did not promote. Pointillism was very influential, being a highly used technique to this day, in addition to influencing the emergence of other techniques.

can you recommend me songs?

Answers

محمد عبده the best singer

Answer:

sza- good days

summer walker- let it go

kehlani- toxic

trey songs- all about you

jhene aiko- bs

H.E.R- damage

chris brown- heat

Explanation:

Do you guys like my music???? Took me soooo long to make!!!


You've got std in me
You've got std in me
When the road looks rough ahead
And you're miles and miles from your nice warm hospital bed
You just remember what your old pal said
Boy, you've got std in me
Yeah, you've got std in me
You've got std in me
You've got std in me
You got troubles, and I got 'em too
There isn't anything I wouldn't do for you
We stick together and we see it through
'Cause you've got std in me
You've got std in me

Answers

Answer:

dam n

Explanation:

Without knowing the key signature, what will you be unable to read correctly on the staff?

Answers

\(answer\)

No sharps or flats in a key signature can indicate that the music is in the key of C major / A minor or that the piece is modal or atonal.

Maybe Brainlist Answer:⁠-⁠)

HappyEveryonePH

Who are my Metal/Rock/Punk music fans out there?

Answers

Answer:

rock

Explanation:

well-being as opposed to constructive relationships.
1.5
Recommend TWO ways in which women and children can be
protected from discrimination and violence.​

Answers

Answer:

men should stop abusing them and people should stop discriminating other people for their religions and stuff

Explanation:

Discuss the Social political background of Greek theatre

Answers

\(\huge\sf{Ꭺղsաҽɾ}\)

Greek theatre thus caused reflection and thinking, dialogue and debate. It was an essential element for the self-awareness of the community, not just entertainment. Taking topics of primary importance as well as more immediate issues, the theatre was, therefore, a natural complement to the Assembly

A relief sculpture is __________________ a. a three-dimensional form of art that is meant to be seen from all sides. b. a sculpture that has a relationship with its surrounding and religious significance. c. a type of sculpture that contains objects embedded in a ground surface. d. a form of site specific work, which is designed to affect the way a space is experienced. please select the best answer from the choices provided a b c d

Answers

Answer:

c

Explanation:

edge 2022

A relief sculpture is a type of sculpture that contains objects embedded in a ground surface. Hence, option C is correct.

What is relief sculpture?

Relief sculpture, which projects in varied degrees from a two-dimensional background, has a long history in both Eastern and Western cultures that dates back more than 20,000 years. While bas-relief  occasionally resembles a two-dimensional sketch, alto-relievo approaches three dimensions.

The three most popular types of relief art are called low relief, high relief, and sunken relief based on how many carved figures protrude from the background.

Famous examples of reliefs are the Keystone, South Dakota, and Mount Rushmore National Memorial. The majority of the Great Pergamon Altar's high relief can be found in Berlin's Pergamon Museum. Low relief of lions and dragons from the Ishtar Gate at Babylon.

Thus, option C is correct.

For more information about relief sculpture, click here:

https://brainly.com/question/30826592

#SPJ5

A is a mark with length and direction, created by a point that moves across a surface which can vary in length, width, direction, curvature and color. Different types of these are horizontal, vertical, diagonal, curvy, and zigzag.

Word Bank:
texture shape elements of art value color segments form line implied lines

Answers

A line is a mark with length and direction, created by a point that moves across a surface, which can vary in length, width, direction, curvature, and color. Different types of these lines are horizontal, vertical, diagonal, curvy, and zigzag.

What is a point?

A point can be defined as a zero-dimensional geometric object and it is generally represented by a dot.

This ultimately implies that, a point doesn't have a size such as length, width or height, but has position. This ultimately implies that, a point is an example of a zero-dimensional geometric object.

What is a line?

A line can be defined as a mark with length and direction, that is created by a point that is moving across a surface. Also, a line can vary in length, width, direction, curvature, and color.

The types of line.

Generally, there are different types of lines and these include the following:

Horizontal linesVertical linesDiagonal linesCurvy linesZigzag lines.

Read more on lines here: https://brainly.com/question/3574666

#SPJ1

The bronze sculpture (left) was created by Constantin Brancusi and is called Bird in Space. The watercolor (right) was sainted by James Audubon and is called Wild Turkey. Describe the message each artist wanted to convey to the

The bronze sculpture (left) was created by Constantin Brancusi and is called Bird in Space. The watercolor

Answers

Constantin Brancusi's sculpture aimed to convey a sense of movement and freedom through an abstract form, while James Audubon's watercolor painting aimed to capture the natural beauty and diversity of a bird species and its habitat.

What are the characteristics of each work of art?

The artist Constantin Brancuse in his sculpture "Bird in Space" of the modernist movement, aimed to use design elements such as lines and movement to suggest a bird in flight, translating its freedom. Audubon's watercolor painting in "Wild Turkey" reveals the beauty of America's birds in a naturalistic work.

Therefore, each artist in particular will use a series of elements and principles of art and design that when combined are capable of generating a visual and aesthetic harmony to portray their ideas.

Find more about works of art at:

https://brainly.com/question/1504175

#SPJ1

Why india music is considered the oldest unbroken musical tradition?

Answers

Answer:

Indian music is one of the oldest unbroken musical traditions in the world with mythological origins rooted in the Vedas (sacred Hindu scriptures). ... They are passed on through oral tradition by singers, dancers, and musicians, often performing in temples.

Angel is planning on painting his room with a beautiful deep blue over the holidays. mom has strict rules about not getting any paint on the ceilings and floors, so he must be very careful. his room also has two windows and a door that he won't be painting. what is the total amount of space he will be covering with blue if the windows are 12 square feet each, and his door is 16 square feet?

Answers

Answer: you cant figure this question out with out the actual dimensions of the room and the dimensions of the windows and door.

Explanation: in order to figure out how much paint to use you must first find the square footage of the room then take away the door and windows to get the exact amount of paint you would need.

Raphael's The Alba Madonna, 1510, is a later Renaissance work. Which of our themes of humanism, individualism, and scientific naturalism do you see in this painting? Do you see much perspective or chiaroscuro in this piece? If so, describe.

WITH REFERENCE LONG ANSWER

Answers

Raphael's painting, The Alba Madonna, does exhibit elements of humanism, individualism, and scientific naturalism, which were key themes of the later Renaissance.

Humanism can be seen in the focus on the human figures, particularly the Madonna and Child, as central subjects of the painting. The composition emphasizes the beauty and idealized form of the figures, reflecting the humanist belief in the inherent worth and dignity of individuals.

Individualism is evident in the distinct characterization of each figure. The Madonna, Child, and Saint John the Baptist are portrayed with unique facial expressions, gestures, and body language, highlighting their individual identities and personalities. This attention to individuality reflects the growing emphasis on the uniqueness and autonomy of individuals during the Renaissance.

Chiaroscuro, the technique of contrasting light and shadow, is not as prominent in The Alba Madonna as it is in some other Renaissance works. However, there is a subtle play of light and shadow, particularly on the figures and the landscape, which adds a sense of depth and volume to the composition.

Overall, The Alba Madonna showcases the themes of humanism, individualism, and scientific naturalism through its focus on the human figures, attention to individual characteristics, and the realistic portrayal of the human form. The use of perspective contributes to the spatial arrangement, while the subtle chiaroscuro enhances the sense of depth in the painting.

Learn more about autonomy

https://brainly.com/question/31939566

#SPJ11

someone smart please, don't answer if you don't know
Plz help quick

4. What three questions can you ask yourself to find out how you want the music you compose to sound?


5. What is the V Chord?


________________________________________


Critical Thinking Questions


1. Describe how you would write a motive.


2. How do melodic motive and chord progression work together?

Answers

4.

Answer One: What do the musical measures look like?

Answer Two: How does the bass sound without the melody.

Answer Three: How does the melody sound without the bass

5.when derived from the notes of the natural minor scale, falls as a minor triad or minor 7th chord

ran to the lighthouse door and knocked. true or false language arts

Answers

Answer:

False

Explanation:

I'm confused about this question but if it is asking if this is a complete sentence then this is incomplete because it doesn't have a subject. Ask yourself this question: Who ran to the door?

When will "A Man Called Otto" be shown?

Answers

A Man Called Otto began a limited theatrical release on December 30, 2022, before a wide release in the United States on January 13, 2023, by Sony Pictures Releasing.

What is the meaning Interval Pattern for Half Diminished 7th Chords?

Answers

The interval pattern for a half diminished 7th chord, also known as a minor 7th flat 5 chord, is a specific combination of intervals that defines its unique sound and structure.

In terms of intervals, a half diminished 7th chord consists of a root, a minor third, a diminished fifth, and a minor seventh. This can be represented as 1-b3-b5-b7. The "b" symbol indicates the lowering of the corresponding interval by one half step. The interval pattern contributes to the distinctive and somewhat dissonant quality of the half diminished 7th chord, making it a versatile and intriguing harmonic choice in various musical contexts.

Learn more about interval pattern

https://brainly.com/question/5789749

#SPJ4

What is a composures musical manuscript

Answers

Answer:

a composer writes a musical manuscript called a score

Explanation:

_____________ gradually change direction, while ____________ create a sense of motion. a. (1) curvilinear lines; (2) diagonal lines c. (1) diagonal lines; (2) freeform shapes b. (1) texture; (2) horizontal lines d. (1) curvilinear lines; (2) color Please select the best answer from the choices provided

Answers

Answer:

the answer is A

Explanation:

The bestoption to this question is (1) curvilinear lines; (2) diagonal lines. Curvilinear lines are lines that curve and change direction gradually.

What curvilinear lines and  diagonal lines ?

While diagonal lines are lines that are at an angle, creating a sense of motion. When curvilinear lines are used in an artwork or design, they create a sense of flow and continuity, while diagonal lines can create a feeling of dynamism and movement.

For example, imagine a painting of a river. The curvilinear lines of the river's path would create a sense of flow, while diagonal lines could be used to depict the ripples in the water or the movement of boats sailing on the river.

On the other hand, horizontal lines would create a feeling of calmness and stability, which would be inappropriate for conveying the movement and dynamism of a river.

In summary, curvilinear lines and diagonal lines are effective in creating different visual effects in an artwork or design. Curvilinear lines gradually change direction, while diagonal lines create a sense of motion, which can be used to great effect in various visual mediums .

Learn more about  curvilinear lines here

https://brainly.com/question/19065361

#SPJ7

1. what does the term illuminate mean?
a: to cover in gold
b: to sing
c: to light up
d: to draw

2. what does the term emphasis mean?
a: to enlarge
b: to stand out
c: to hide
d: to illuminate

3. Why do artists add emphasis?
a: to create a focus point
b: to create details
c: to make something large
d: to make something bright

4. During the Middle Ages, who was most likely to own a manuscript or book?
a: a tailor
b: a butcher
c: a duke or duchess
d: a peasant

Answers

Answer:

1) c: to light up

2) b: to stand out

3) a: to create a focus point

4) c: a duke or duchess

Answer:

1. To light up

2. To stand out

3.  To create a focus point

4. A duke or duchess

Explanation:

9. Cut time and 4/4 time are the same?​

Answers

I don’t know if you asking a question stating an opinion or fact
Cut time usually refers to any time signature but the most common time signature is 4/4

according to the documentary, during paperback writer, john lennon and paul mccartney are singing staggered entry vocals from which nursery rhyme?

Answers

The first number one hit for the Beatles that was not about love John Lennon in George Harrison saying the French nursery rhyme frére Jacques in the background the frére Jacques part has nothing to do with John Lennon part is thought it was clever but it does translate to bother brother John

Designing a sales presentation for a new product line is an example of a________.

Answers

Designing a sales presentation for a new product line is an example of a Personal selling.

Is designing a skill?

The capacity to see how something will appear after being moved about, as well as after its components have been moved or reorganised. Additional talents that support the technical nature of design arise in addition to all these cognitive or attitude abilities.

What exactly does designing entail?

A designer is essential to the success of a creative business. A designer always has a highly imaginative mind that can take in visual trends and apply them in novel and new ways using components like typography, illustration, photography, and layouts.

To know more about Designing visit:

https://brainly.com/question/29740669

#SPJ4

What is the best lion someone could draw?

Answers

Answer:

a circle for the head with triangles around it than oval for the body a face and sticks for the legs thats what i can do

what is abstract art? can you think of an example of an abstract artist?

Answers

Wassily Wassilyevich Kandinsky was a Russian painter and art theorist. Kandinsky is generally credited as the pioneer of abstract art.


Describe the different techniques that are used to construct skyscrapers. As building materials improved, what other building
techniques have been developed and improved?

Answers

It become, but, the refinement of the Bessemer procedure, first used in the united states of America in the 1860s, that allowed for the foremost strengthening in skyscraper creation.

As steel is stronger and lighter in weight than iron, the usage of a metallic frame made feasible the construction of actually tall homes.

Cutting-edge skyscrapers are constructed with metal or strengthened concrete frameworks and curtain walls of glass or polished stone. They use mechanical gadget which includes water pumps and elevators.

Skyscrapers have created the use of a metal skeleton structure. Giant girder grids are shaped through riveting metallic beams stop to stop to form vertical columns. On each floor, the vertical columns are linked to horizontal girder beams to help reinforce and beef up the shape.

Learn more about skyscrapers here https://brainly.com/question/27985617

#SPJ1

Answer:

It was, however, the refinement of the Bessemer process, first used in the United States in the 1860s, that allowed for the major advance in skyscraper construction. As steel is stronger and lighter in weight than iron, the use of a steel frame made possible the construction of truly tall buildings.

match the recording artist with their associated musical genre: hit spacebar to access and hit enter to open.answer has been selected. a. mainstream pop/country b. soft rock c. mainstream pop/rock d. disco

Answers

Match the recording artist with their associated musical genre, so the answer is:

Glen Campbell - countryJames Taylor - rockJohn Denver - countryThe Bee Gees - discoCarole King - rockFleetwood Mac - rockWhat is musical genre?

A music genre is a traditional classification that includes musical works that adhere to a common set of norms or customs. A variety of factors are used to categorize music into distinct genres. A music genre is a more inclusive word or apex that covers a wide range of musical styles. Therefore, if jazz music is the genre, additional styles like swing, jazz fusion, and be-bop are all included in the jazz genre. Rock music lends itself to several styles, like hard rock, classic rock, and so forth.

Learn more about musical genre: https://brainly.com/question/26187798

#SPJ4

Other Questions
what is the capital city of London how to prepare pure dry crystals of sodium chloridesalt by using hydrochloric acid and sodium hydroxide (use thymolphthalein as an indicator) what flight information publications are used to determine if radar is available at an airfield? 1. Given the double-stranded stretch of DNA below, determine the base sequence ofmessenger RNA strand produced using this gene as the template. *Hint: Only one of thetwo strands is used as the template.5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA 3'3' TACGGTAACG AATTCGCCCGTAAT ATGGTACT 5AUGCCAUUGCUU AAG-CGG-GCAULAUAU CCA UGAHow many amino acids will this protein contain? a super cooled liquid needs to ________ to turn into a solid. what is the magnitude of the electric force between charges of 0.29 c and 0.12 c at a separation of 0.88 m ? k The price of a DVD is $19 . This price is 12% lower than last week.What was the price of the DVD last week? After swimming 60 feet below the surface of the water, a whale swims up 30 feet. Use a number line to help you create an equation that shows the new location of the whale in relation to the water's surface. -120-100-80 -60 40 20 0 0 406 Interpret the sum in the context of the problem A. The equation is 60+(-30)-30. The whale is 30 feet below the water's surface B. The equation is 60 +30 90he whale is 90 feet below the water's surface OC. The equation is 60 + (30)-90. The whale is 90 feet below the water's surtace OD. The equation is -60 +30=30. The whale is 30 feet below the water's Surtace There are approximately 9.3 x 106 dairy cows in the United States, with each cow producing approximately 2.5 x 10 gallonsof milk each year. How much milk do United States dairy cows produce each year? Write the answer in scientific notation what is 2 and 2/7 as an improper fraction taxonomy is group of answer choices sequence of evolution science of naming organisms study of life evolutionary history of species what year was the first grammy awarded in hip hop? What are some of the problems that may result from taking revenge on another person. Which group did not fight to gain control of South Africaa. Zulusb. Boersc. Germansd. British!!!!! Find the measure of each angle indicated 40 85 ? put in order from greatest to least2.96 , 3 1/5, 3.48, 3 1/4 Why doesn't every cell in the body respond to every hormone circulating in the bloodstream? What is the answer to 3(2x+5)=3x+4x She was wearing _______ dress that she received for her birthday. quick please I need help