Explain the impact of a force on wave movement on land.

Answers

Answer 1

Answer: Waves are important for building up and breaking down shorelines. Waves transport sand onto and off of beaches, transport sand along beaches, carves structures along the shore. The largest waves form when the wind is very strong, blows steadily for a long time, and blows over a long distance.

The wind could be strong, but if it gusts for just a short time, large waves won’t form. Wave energy does the work of erosion at the shore. Waves approach the shore at some angle so the inshore part of the wave reaches shallow water sooner than the part that is further out. The shallow part of the wave ‘feels’ the bottom first. This slows down the inshore part of the wave and makes the wave “bend.” This bending is called refraction.

Wave refraction either concentrates wave energy or disperses it. In quiet water areas, such as bays, wave energy is dispersed, so sand is deposited. Areas that stick out into the water are eroded by the strong wave energy that concentrates its power on the wave-cut cliff.

A wave-cut platform is the level area formed by wave erosion as the waves undercut a cliff. An arch is produced when waves erode through a cliff. When a sea arch collapses, the isolated towers of rocks that remain are known as sea stacks.

Wave Deposition

PictureRivers carry sediments from the land to the sea. If wave action is high, a delta will not form. Waves will spread the sediments along the coastline to create a beach. Waves also erode sediments from cliffs and shorelines and transport them onto beaches.Beaches can be made of mineral grains, like quartz, rock fragments, and also pieces of shell or coral. Waves continually move sand along the shore and move sand from the beaches on shore to bars of sand offshore as the seasons change. In the summer, waves have lower energy so they bring sand up onto the beach. In the winter, higher energy waves bring the sand back offshore.Some features form by wave-deposited sand. These features include barrier islands and spits. A spit is sand connected to land and extending into the water. A spit may hook to form a tombolo. Shores that are relatively flat and gently sloping may be lined with long narrow barrier islands. Most barrier islands are a few kilometers wide and tens of kilometers long.In its natural state, a barrier island acts as the first line of defense against storms such as hurricanes. When barrier islands are urbanized, hurricanes damage houses and businesses rather than vegetated sandy areas in which sand can move. A large hurricane brings massive problems to the urbanized

Explanation:


Related Questions

Which mutation changes the number of chromosomes in the cell

Answers

Answer: aneuploidy

A gain or loss in the number of chromosomes from the normal 46 is called aneuploidy. A common form of aneuploidy is trisomy, or the presence of an extra chromosome in cells. "Tri-" is Greek for "three"; people with trisomy have three copies of a particular chromosome in cells instead of the normal two copies.

High school and collage students answers only.
What role do enzymes play in the chemical reactions of living organisms?

Answers

Answer:

Enzymes are proteins that act as biological catalysts. They speed up chemical reactions that take place in cells. Enzymes act by lowering the activation energies, which has a dramatic effect on how quickly reactions completed.

Explanation:

basically  they lower the activation energy and increase the rate of chemical reactions.

Which term best describes two predators living in the same habitat who feed on the same prey?

A.coexistence
B.mutualism
C.competition

Answers

Answer:

The answer is C, competition

Competition refers to the interaction between the organisms to seek or feed on the same resource.

The term that best describes the two predators living in the same habitat feeding on the same prey is competition.

Competition can be defined as:

Competition in an ecosystem or habitat will take place when the ecological niche of organisms overlaps as both organisms try to use the same resource.

In habitat, the predators feeding on the same prey will have competition, as the predators will fight for food, nutrients, and a source of energy to survive.

Competition can be caused among animals due to food, space, and shelter.

Thus, the correct answer is Option C.

To know more about competition, refer to the following link:

https://brainly.com/question/1622043

please help with this

please help with this

Answers

Answer:D

Explanation:

Projections of loose connective tissue from the dermis, which extend upward between the adjacent ridges of the epidermis, are called:________ a. No answer text provided. b. dermal papillae c. No answer text provided. d. epidermal ridges

Answers

Projections of free connective tissue from the dermis, which stretch out vertically between the neighboring edges of the epidermis, are called dermal papillae. The correct answer is dermal papillae.

The dermis contains a ton of collagen, a sort of tissue that invigorates the dermis, and furthermore elastin, which gives versatile properties to the dermis. The top layer of the dermis is known as the papillary dermis, so named for the finger-like projections (papillae) which project upwards to the epidermis.

The papillary district of the dermis is made out of free areolar connective tissue. This is named for its fingerlike projections called papillae, which stretch out toward the epidermis and contain terminal organizations of blood vessels.

To learn more about dermal papillae here

https://brainly.com/question/14501560

#SPJ4

Which are used as parts or components of a projects

Answers

Answer:

Scope Statement.Critical Success Factors.Deliverables.Work Breakdown Structure.Schedule.Budget.Quality.Human Resources Plan.

Explanation:

The type of molecule shown below is.

A. Carbon Dioxide.

B. Hydrogen.

C. Oxygen.

D. Water.

The type of molecule shown below is.A. Carbon Dioxide.B. Hydrogen.C. Oxygen.D. Water.

Answers

Answer:

letter B

Explanation:

hope this helps

HELP SUPER EASY!!

Why does fragmented forest habitat increase the risk of predation on bird nests by cats, dogs, raccoons, and other animals?
Responses

Birds will prefer to make their nests at the edges of forest habitat.


Predators are more common at the edges of fragmented habitat.


Predators have an easier time spotting bird nests in fragmented habitat.


Birds are forced to build nests on the ground instead of in protected trees.

HELP SUPER EASY!! Why does fragmented forest habitat increase the risk of predation on bird nests by

Answers

Predators have an easier time spotting bird nests in fragmented habitat is the correct response.

Fragmented forest habitats often create edges between different types of habitat, which can provide easier access for predators to enter the area. Additionally, when forest habitats are fragmented, they often create patches of smaller and isolated areas, which can lead to a higher density of predators in a smaller area. This increased predator density, combined with easier access to bird nests, can increase the risk of predation on bird nests by predators such as cats, dogs, raccoons, and other animals. Predators have an easier time spotting bird nests in fragmented habitats because there are fewer places for birds to hide their nests, and predators have a greater view of the surrounding area.

Example of reactants
Please help!

Answers

Answer:

H2 (hydrogen gas) and O2 (oxygen gas) are reactants in the reaction that forms liquid water: 2 H2(g) + O2(g) → 2 H2O(l). Notice mass is conserved in this equation.

Answer:

reactants are those substances which react together to form product, for example hydrogen and oxygen reacts to form water molecules, therefore here reactants are hydrogen and oxygen

theropods appeared during the _______ and persisted until the kt boundary extinction event. (unless you count birds too, in which case they are still around)

Answers

Mesozoic era.Theropods appeared during the Mesozoic era and persisted until the KT boundary extinction event. However, if we consider birds too, in that case, they are still around. The theropod group of dinosaurs includes the majority of carnivorous dinosaur species. In size, theropods varied from the smallest species, such as Anchiornis and Microraptor, to the giant theropods such as Spinosaurus and Tyrannosaurus rex.

The Triassic period was the first period of the Mesozoic era, and it was during this time that the very first dinosaurs evolved. Theropod dinosaurs continued to be a significant part of the dinosaur fauna throughout the Mesozoic era, which spanned approximately 180 million years. By the end of the Cretaceous period, theropod dinosaurs, as well as all non-avian dinosaurs, had gone extinct as a result of the KT boundary extinction event.

To know more about mesozoic era visit:

https://brainly.com/question/1698817

#SPJ11

What else erupts besides lava?? PLEASE SOMEONE HELP ME ASAP

Answers

Answer:

Smoke would make sense but I cant be sure.  Is it a multiple choice question?

(also it could be water from a geyser)

Four substances are important for both photosynthesis and cellular respiration: oxygen, glucose, carbon dioxide, and water. What is the best explanation for how both processes use these substances?

Four substances are important for both photosynthesis and cellular respiration: oxygen, glucose, carbon

Answers

Answer:

D. Photosynthesis uses carbon dioxide and water to make glucose and oxygen; respiration uses glucose and oxygen to make carbon dioxide and water.

Explanation:

Photosynthesis uses carbon dioxide and water to make glucose and oxygen; respiration uses glucose and oxygen to make carbon dioxide and water is the best explanation for how both processes use these substances

what is photosynthesis ?

The process in which sunlight energy is used by  plants, algae and certain bacteria convert them into chemical energy and starch called as photosynthesis.

Photosynthesis occur in chloroplast  which has its own DNA, genes and hence can synthesize their own proteins, photosynthetic Pigments responsible for trapping sunlight present in chlorophyll pigment of chloroplast, like chlorophyll a, b and c.

Bacteria also have chlorophyll known as bacteriochlorophyll can absorb infrared rays, other pigments are Carotenoids which are yellow, orange or red-coloured pigments that absorb bluish-green light., Xanthophyll, Phycobilins.

plastids are found in the cytoplasm of eukaryotic photosynthetic organisms. They contain pigments and store nutrients. Plastids are of three types such as Leucoplast, Chromoplasts, Chloroplasts

Antennae is made up of 100 to 5000 pigment molecules that capture light energy from the sun in the form of photons, Reaction Centers where photosynthesis occur.

For more details regarding photosynthesis, visit

brainly.com/question/1388366

#SPJ6

A reaction is catalysed by an enzyme.
Figure 2 shows how temperature
affects the rate of this reaction.
rada
4-5
Rate of Reaction (units)
Explain why the reaction has stopped at point Z.
40
30
20
0
Figure 2
1
10 20 30 40 50 60
Temperature (°C)
Look at points X and Y on Figure 2.
Describe the relationship between rate of reaction and temperature between points X and Y.

A reaction is catalysed by an enzyme.Figure 2 shows how temperatureaffects the rate of this reaction.rada4-5Rate

Answers

Answer:

2.1)As Temperature increases, the rate of reaction increases.

2.2)Enzymes are sensitive to changes in temperature. At point Z, the temperature beacame too high for the enzyme to function, thereby denaturing the enzyme. Once the enzyme was denatured the reaction could not continue.

32. Identify the reactant(s) in the chemical reaction, CO₂ + H₂O → H₂CO3. a. CO₂, H₂O, and H₂CO3 b. CO₂ and H₂O H₂CO3 d. CO₂​

Answers

H2O AND CO2 are the reactants of this reaction.

What is reactant and product?

Chemical compounds known as reactants are those that take part in chemical reactions and produce new substances known as products. The new compounds that are created in a chemical reaction between reactants are called products. H2+O2→H2O.

How do you identify reactants?

Reactants are the substance(s) in a chemical equation to the left of the arrow. A component that is present at the outset of a chemical reaction is known as a reactant. Products are the substance(s) to the right of the arrow.

How do we define a chemical reaction?

A chemical reaction is the transformation of one or more chemicals, known as reactants, into one or more new compounds, known as products. Chemical components or compounds make up substances.

To know more about reactants visit:

https://brainly.com/question/14225536

#SPJ9

What is the chemical equation for cellular respiration?

Answers

Answer: C6H12O6 +O2 → CO2 + H2O+ energy

Explanation:

Examine the graphic organizer shown , which phrase is the best lanes for box 2 , HURRY

Examine the graphic organizer shown , which phrase is the best lanes for box 2 , HURRY

Answers

C. Binary fission, because it’s the separation of one body into two smaller, identical ones

4. what types of substances can go directly through the cell membrane? What
types of substances will need the help of various proteins for transport?

Answers

(Please give brainliest)

oxygen, carbon dioxide and water
Explanation:
the molecules that can diffuse easily includes molecules that are small. But in some cases, water may need to be diffused using the channel protein.

Transcribe the following dna strands into mrna strands: ATTCGACGTC
GATAGCTAGG

Transcribe the following dna strands into mrna strands: ATTCGACGTCGATAGCTAGG

Answers

Answer:

1. ATTCGACGTC

  UAAGCUGCAG

2. GATAGCTAGG

   CUAUCGAUCC

Explanation:

First write the DNA strands out:

ATTCGACGTC

GATAGCTAGG

Next, bind the strand with the opposite to the corresponding letter.

For mrna strands, the following is associated with:

A -> U

T -> A (apples in the tree mnemonic)

C -> G (cars in the garage mnemonic)

G -> C (cars in the garage mnemonic)

The strands transcribed into mrna strands would look like:

1. ATTCGACGTC

  UAAGCUGCAG

2. GATAGCTAGG

   CUAUCGAUCC

Answer:

The first one will be UAAGCUGCAG. The second one is CUAUCGAUCC.

_________ is the study of the means by which living organisms both obtain and utilize the nutrients they need to grow and sustain life.

Answers

The answer is Nutrition

Which of the following is NOT an evidence of evolution?

Comparative embryology
Molecular comparisons
Fossils
Dating of the earth
Comparative anatomy
Vestigial structures

Answers

Answer:

Dating Of The Earth

Explanation:

Dating of the earth is not an evidence of evolution. While it provides important context for understanding the timescale over which evolution has occurred, it is not itself a direct observation of the processes of evolution. The other options listed - comparative embryology, molecular comparisons, fossils, comparative anatomy, and vestigial structures - all provide evidence for evolution by revealing similarities and differences between species that are best explained by common ancestry and divergent evolution over time.

The template strand of DNA : 3'- TAC GGG CTA CAA CTT AAC AGA CCA ATC-5' C 1. What will be produced if this DNA molecule is replicated? 2. What is the transcriptional result regarding this DNA molecule? 3. What is the amino acid sequence of the polypeptide chain that will be synthesized according to the mRNA molecule transcribed from this gene? 4.What are the anticodon sequences of the tRNA molecules that can carry these amino acids? 5. If this DNA got a mutation that changed the first 3 bases to 3'-ATT-5', what will happen to the polypeptide chain to be synthesized?

Answers

The double-stranded DNA molecule: 5'-ATG CCC GAT GTT GAA TTG TCT GGT TAG-3'. the following sequence (complementary to the template DNA strand): 5'-AUGCCCGAUGUUGAAUUUGUCUGGUTAG-3'. gene will be: Methionine-Proline-Aspartic acid-Valine-Asparagine-Arginine-Proline-Isoleucine.

1. If this DNA molecule is replicated, a new complementary strand will be synthesized, resulting in the double-stranded DNA molecule: 5'-ATG CCC GAT GTT GAA TTG TCT GGT TAG-3'

2. The transcriptional result regarding this DNA molecule will be the synthesis of an mRNA molecule with the following sequence (complementary to the template DNA strand): 5'-AUGCCCGAUGUUGAAUUUGUCUGGUTAG-3'

3. The amino acid sequence of the polypeptide chain that will be synthesized according to the mRNA molecule transcribed from this gene will be: Methionine-Proline-Aspartic acid-Valine-Asparagine-Arginine-Proline-Isoleucine.

4. The anticodon sequences of the tRNA molecules that can carry these amino acids are: tRNA-Met (anticodon 3'-AUG-5'), tRNA-Pro (anticodon 3'-CCC-5'), tRNA-Asp (anticodon 3'-GAU-5'), tRNA-Val (anticodon 3'-GUU-5'), tRNA-Asn (anticodon 3'-AAU-5'), tRNA-Arg (anticodon 3'-CGU-5'), tRNA-Ile (anticodon 3'-AUU-5').

5. If this DNA got a mutation that changed the first 3 bases to 3'-ATT-5', the mRNA transcribed from the mutated gene will have the sequence 5'-AUG CCC GAC UGU UAA UUG UCU GGU UAG-3'. This will result in a different amino acid sequence: Methionine-Proline-Asparagine-Cysteine-STOP, leading to premature termination of the polypeptide chain synthesis.

To know more about mutation refer here:

https://brainly.com/question/13923224#

#SPJ11

What fish is native to the shallow tropical waters of the western atlantic?.

Answers

One fish that is native to the shallow tropical waters of the western Atlantic is the queen angelfish.

This colorful fish is found in coral reefs from Florida and the Bahamas down to Brazil, and is a popular sight for divers and snorkelers. The queen angelfish has a striking appearance, with a bright blue body, yellow tail fin, and electric blue markings on its face and fins.

They can grow up to 18 inches long and are known to be territorial, often defending their patch of coral from other fish.

In addition to their beauty, queen angelfish play an important role in the coral reef ecosystem. They feed on sponges and algae, helping to keep the reef clean, and are preyed upon by larger fish and sharks. However, like many reef fish, queen angelfish are threatened by habitat destruction, overfishing, and climate change.

It is important to protect these fragile ecosystems and the species that depend on them in order to preserve the biodiversity and beauty of our oceans.

To know more about Atlantic, visit:

https://brainly.com/question/31251342#

#SPJ11

place the following steps of polysaccharide chain cleavage by lysozyme into the correct order. 1) Lysozyme and products dissociate 2) Lysozyme and substrate form an enzyme-substrate complex, forcing one sugar molecule into a strained conformation. 3) Glutamic acid donates a proton to one sugar as aspartic acid attacks the C1 carbon of a second sugar. 4) Glutamic acid donates a proton to one sugar as aspartic acid attacks the C1 carbon of a second sugar. 5) The water oxygen attacks the C1 carbon, breaking the sugar- aspartate bond. 6)Glutamic acid polarizes a water molecule, drawing a proton away from the water. 7) A covalent bond forms between the aspartic acid and the sugar, and the sugar-sugar bond is hydrolyzed.

Answers

Lysozyme and substrate form an enzyme-substrate complex, forcing one sugar molecule into a strained conformation. Glutamic acid donates a proton to one sugar as aspartic acid attacks the C1 carbon of a second sugar.

A covalent bond forms between the aspartic acid and the sugar, and the sugar-sugar bond is hydrolyzed. The water oxygen attacks the C1 carbon, breaking the sugar-aspartate bond. Glutamic acid polarizes a water molecule, drawing a proton away from the water. Lysozyme and products dissociate. The correct order of steps of polysaccharide chain cleavage by lysozyme are as follows: Lysozyme and substrate form an enzyme-substrate complex, forcing one sugar molecule into a strained conformation. Glutamic acid donates a proton to one sugar as aspartic acid attacks the C1 carbon of a second sugar.

A covalent bond forms between the aspartic acid and the sugar, and the sugar-sugar bond is hydrolyzed. The water oxygen attacks the C1 carbon, breaking the sugar-aspartate bond. Glutamic acid polarizes a water molecule, drawing a proton away from the water. Lysozyme and products dissociate. Lysozyme is an enzyme that breaks down glycosidic bonds in bacterial cell walls. The enzyme binds to a sugar molecule in the substrate and rearranges it into a strained conformation when it binds to it .The enzyme's glutamic acid donates a proton to one sugar in the substrate, while its aspartic acid attacks the C1 carbon of a second sugar.  A covalent bond forms between the aspartic acid and the sugar, breaking the sugar-sugar bond.

To know more about Lysozyme visit:

https://brainly.com/question/31868978

#SPJ11

Read the paragraph. [1] Our house was once a stop on the Underground Railroad. [2] It was common for an enslaved person to stop there on their way to the North. [3] The Underground Railroad were a network of hiding places. [4] The cellar beneath our house has a secret door that was installed to trick slave catchers. Which sentence has a subject-verb agreement error? sentence 1 sentence 2 sentence 3 sentence 4

Answers

Answer:

sentence 3

Explanation:

edge 2020

In sentence 3 'The Underground Railroad were a network of hiding places' a subject-verb agreement error is observed.

What is a subject-verb agreement?

In a sentence when the subject of the sentence does not accept in number with the verb, the sentence misses subject-verb agreement.

In the given sentence 'The Underground Railroad were a network of hiding places'  the verb “were” is not matching the subject, it is a subject-verb agreement error.

There would be, 'was' is used as a verb in sentence three, correctly sets the subject-verb agreement. The subject of this sentence is the singular “one,” not the plural “Railroads.” This suggests the verb should also be singular.

Therefore, sentence three correctly depicts the subject-verb agreement error.

Learn more about subject-verb agreement, here:

https://brainly.com/question/30958919

#SPJ7

assume interference between regions (a-b and b-c) is 40%. when an f1 individual produces gametes, what proportion of its gametes would have abc genotype?

Answers

The proportion of gametes with the abc genotype in the F1 individual, considering a 40% interference, is 2.16 (or 2.1600 as a decimal fraction).

To determine the proportion of gametes with the abc genotype in the F1 individual, let's solve step by step:

Step 1: Determine the possible combinations of alleles for the F1 individual based on the parental genotypes AABBCC and aabcc. The F1 individual will have the genotype AaBbCc.

Step 2: Calculate the recombination frequencies between the gene regions:

The distance between genes A and B is 20 mu.

The distance between genes B and C is 30 mu.

Step 3: Apply the interference of 40% to the recombination frequencies. Interference refers to the reduction in the frequency of double crossovers compared to the expected frequency based on independent assortment. To account for this, we multiply the recombination frequencies by (1 - interference).

For the region between genes A and B, the adjusted recombination frequency is:

Recombination frequency (AB) = 20 mu × (1 - 0.40) = 12 mu

For the region between genes B and C, the adjusted recombination frequency is:

Recombination frequency (BC) = 30 mu × (1 - 0.40) = 18 mu

Step 4: To determine the proportion of gametes with the abc genotype, we multiply the adjusted recombination frequencies together, as the occurrence of recombination events between different regions is independent.

Proportion of gametes with abc genotype = Recombination frequency (AB) × Recombination frequency (BC)

= 12 mu × 18 mu = 216 mu²

Step 5: Convert the proportion of gametes to a decimal fraction by dividing by the total possible recombination units (mu²) for the entire chromosome.

Total recombination units for the chromosome = (20 mu + 30 mu) × 2 = 100 mu²

Proportion of gametes with abc genotype = 216 mu² / 100 mu² = 2.16

Learn more about the gametes at

https://brainly.com/question/11479681

#SPJ4

The question is -

In fish, genes A, B, and C are on chromosome 5. The map of genes A, B, and C is:

A----------------------------B-----------------------------------------C

20mu 30mu

You cross an individual with genotype AABBCC to an individual with genotype aabcc, and F1 progeny are collected.

Assume interference between regions (a-b and b-c) is 40%. when an f1 individual produces gametes, what proportion of its gametes would have abc genotype?

1. Why would it be important to consider island biogeography if you are managing a reserve for an endangered species?
2. Can an invasive species invade a biome different than its original biome? Why or why not?
3. As climate change moves the temperature and precipitation patterns (biomes) what happens to organisms adapted for those biomes? Why?

Answers

Answer:

they will be chance for them dining but in most cases scientists and biometrics. will save them

Answer:

1. The concept of island biogeography also provides important information about how many species should be able to survive and thrive in a given ecosystem, as well as what conservation efforts can be used to protect threatened species.

2. Like said above, the most important difference between non-native and native is if the species came by itself or was helped by humans. ... But in most cases the human intervention is clear (like grey squirrels). To much of the public it doesn't matter if they see a red or grey squirrel, as long as they can see a squirrel

3.Because climate determines plant growth, it also influences the number and variety of other organisms in a terrestrial biome. Biodiversity generally increases from the poles to the equator. It is also usually greater in more humid climates.

15. Use what you know about probability to determine the percent chance of each of the following
outcomes from a cross between two parents with the genotypes AaBbCCDdEEff and AaBbCcddEeFF.
a. AABBCCDDEEFF=
b. AaBbCcddEEFf=

Answers

(a)There is a 1/1024 chance of the offspring having the genotype AABBCCDDEEFF.; (b)There is a 1/65536 chance of the offspring having the genotype AaBbCcddEEFf.

What is genotype?

Scoring of the type of variant present at given location in the genome is called genotype.

Parent 1 gametes:

AaBbCCDdEEff: ABCEf, ABCEf, abCEf, abCEf, ABcEf, ABcEf, abcEf, abcEf, ABCEf, ABCEf, abCEf, abCEf, ABcEf, ABcEf, abcEf, abcEf

Parent 2 gametes:

AaBbCcddEeFF: ABCde, ABCde, ABcde, ABcde, AbCde, AbCde, Abcde, Abcde, ABCde, ABCde, ABcde, ABcde, AbCde, AbCde, Abcde, Abcde

a. AABBCCDDEEFF:

(1/2)⁵ x (1/2)⁵ = 1/1024

This means that there is a 1/1024 chance of the offspring having the genotype AABBCCDDEEFF.

b. AaBbCcddEEFf:

For the AaBbCc part of the genotype, there are 4 possible alleles for each parent, so there are 16 possible combinations. The probability of each parent passing on a specific combination of alleles is 1/16, so the probability of both parents passing on the same combination of alleles is (1/16)²= 1/256.

For dd, each parent has a 1/4 chance of passing on recessive allele, so the probability of both parents passing on the recessive allele is (1/4)² = 1/16.

For EE, each parent has a 1/2 chance of passing on dominant allele, so probability of both parents passing on the dominant allele is (1/2)² = 1/4.

For Ff , each parent has a 1/2 chance of passing on either allele, so probability of both parents passing on same allele is (1/2)² = 1/4.

(1/256) x (1/16) x (1/4) x (1/4) = 1/65536

This means that there is a 1/65536 chance of the offspring having the genotype AaBbCcddEEFf.

To know more about genotype, refer

https://brainly.com/question/902712

#SPJ1

I've been stuck on this question for quite a while now need some help best if I can get an answer with explanation

I've been stuck on this question for quite a while now need some help best if I can get an answer with
I've been stuck on this question for quite a while now need some help best if I can get an answer with

Answers

Answer:

B is most probably the right answer since it has the both hydrophollic and characteristics.

Not 100% sure though

hich of the point mutations is unlikely to change a protein's ability to function? select all that apply.

Answers

The point mutation which is unlikely to change a protein's ability to function are silent mutations and conservative mutations. Point mutation is a small-scale mutation that affects a single nucleotide pair within DNA. It involves a change in a single nucleotide within a DNA sequence. It can result in the creation of a new protein with an altered amino acid sequence. The effects of point mutations on the protein's functionality are dependent on the location of the nucleotide change and the type of nucleotide change that occurred.

SILENT MUTATIONS are mutations in the nucleotide sequence that do not lead to an alteration in the resulting protein's amino acid sequence. A protein with a silent mutation would retain its ability to function. Silent mutations are mutations that arise due to the wobble base pairing rule and are often seen in the 3rd position of a codon. CONSERVATIVE MUTATIONS are mutations that cause the replacement of one amino acid with another that is chemically comparable.

These mutations do not cause significant changes to the protein's ability to function and, as a result, do not usually have a serious impact on the protein's activity. MISSSENSE MUTATIONS are mutations in the nucleotide sequence that lead to a change in a protein's amino acid sequence. The outcome of missense mutations is highly dependent on the location of the nucleotide change. It can lead to a change in protein activity, function, or stability. It can either have a neutral or a detrimental effect on protein activity.

learn more about mutation

https://brainly.com/question/17031191

#SPJ11

Passage of plasma proteins such as albumins and lipoproteins between hepatocytes and blood is facilitated by the ___ hepatic sinusoidal capillaries

Answers

The passage of plasma proteins such as albumins and lipoproteins between hepatocytes and blood is facilitated by the fenestrations present in hepatic sinusoidal capillaries. These capillaries are unique in their structure and are designed to allow the transfer of blood and plasma proteins to and from the liver.

The hepatic sinusoidal capillaries are lined with specialized endothelial cells that contain small holes or fenestrations. These fenestrations are large enough to allow the passage of small molecules and plasma proteins but small enough to prevent the passage of larger cells such as red blood cells or platelets. The fenestrations are covered by a layer of glycocalyx, which acts as a sieve to further regulate the movement of molecules and proteins into and out of the liver.

The fenestrations in the hepatic sinusoidal capillaries are important for several reasons. Firstly, they allow the liver to filter out toxins and other harmful substances from the bloodstream. Secondly, they allow the liver to take up nutrients and other essential molecules from the bloodstream. Finally, they allow the liver to secrete bile and other substances into the bloodstream to be transported to other parts of the body.

In conclusion, the fenestrations in hepatic sinusoidal capillaries play a crucial role in the transfer of plasma proteins such as albumins and lipoproteins between hepatocytes and blood. These structures are unique in their design and allow the liver to filter out harmful substances, take up nutrients and essential molecules, and secrete bile into the bloodstream.

For more such questions on Capillary.

https://brainly.com/question/12968850#

#SPJ11

Other Questions
A force of 40 N is applied tangentially to the rim of a solid disk of radius 0.10 m. The disk rotates about an axis through its center and perpendicular to its face with a constant angular acceleration of 145 rad/s2. Determine the mass of the disk. Goodmorning, can someone please help me figure this out? Thanks in order to help her students understand that text has meaning, a prekindergarten teacher regularly reads aloud from big books, pointing to the words as she reads them. what other skill from the texas prekindergarten guidelines does this activity support? Katie buys several pairs of socks for $3 per pair.Which equation represents Katie's total cost, c, when she buys s pairs of socks and why? What does the imagery in this passage help readers imagine? the cold winds that Bedivere withstands the moons light reflecting off the sword the jewelry that Bedivere is wearing the way that Bedivere hides the sword true or false__________ Secondary (S) waves are the type of seismic wave that are the last to be recorded on a seismograph and cause the most damage in an earthquake. Which equation best describes the law of conservation of momentum?O pi=PFOp;>POp;OP; + Pi = 0 what are the speeds of (a) a proton that is accelerated from rest through a potential difference of 1000 v1000 v and (b) an electron that is accelerated from rest through a potential difference of 1000 v? What was one effect of the Silk Road on China? A.The Silk Road facilitated the Han policy of expansionism.B.Warlords used the Silk Road as a supply route during battles.C.The Silk Road created a monopoly for Chinese trade.D.The Silk road promoted the exchange of goods and ideas throughout China. the government passed the cares act to address the economic fallout of the covid-19 pandemic. which of these provisions were included in the legislation? Complete the sentences with the correct form of the correctverb in brackets. Include a pronoun where necessary. 1 The room was full, so he needed to take a deep breathbefore hel(go in/ go in for)2 The teacher didn't notice that we hadn't done the homework. We(get away / get away with)3 The starter wasn't very tasty, but the main courseIt was delicious! (make up / makeup for)4 I didn't answer the phone because Iyet. (get up/get up to)5 If you don't understand a word,in the dictionary. (look up / look up to)6 If you make a promise, you shouldn't. (go back / go back on) please help me, please I need a lot of help me is failing Mark works at a clothing store and earns a 20% commission on his total sales. Last month, Mark sold $1,500 in clothing total sales. What was his commission last monthwork needs to be shown Pls help 15 points pls hurry what kinds of damage can a malicious actor do with a sqli attack? a. change passwords b. reduce prices on ecommerce sites c. insert users into database table d. drop database tables entirely e. create logins The definition of the inner product is not important here, but it is (v, o) = f dx*(x)o(x). The relevant bit here is that terms that look like Wi2 are normalized to one and cross terms like B*W go to zero. Consider the W+ boson. We know that it is W+ = N (W + iW), (1.2) we can determine the normalization N by fixing |W+2 = N (|W| + |W|) = 1. This means N= 2 (1.3) The linear combination for the Z boson is proportional to the combination that gets a mass. 1.1 Inserting the vev Show that iv D (H): iv g (W - iW) 2/2 g'B - gW (9W 1/) = 2/12 (1+). (1.4) 22 where g = g + g is the characteristic Z-boson interaction strength. In the last step we just defined the properly normalized W and Z bosons. Based on the above note, convince yourself that g'BgW = -9Z with respect to the properly normalized Z. The minus sign is conventional. 1.2 Masses When you take D (H)2, you end up with masses MW+W+MZ +/M7 (1.5) The factor of 1/2 is convention for terms with two identical particles. Show that the masses are MW gv 4 M = 922 (1.6) 4 Which particle is heavier, the Z or the W Larry does not want to save his internet browsing details on his computer. What files should Larry delete to clear his information from the computer?A. Trojan horsesB. virusesC. cookiesD. spam the absorption spectrum of a certain red dye is shown above. if a student analyzing the same concentration of this dye neglected to wipe fingerprints off the cuvette before placing it in the spectrophotometer, how would the absorption curve be affected? responses 10 points whats an average height for a egg drop? 20m or what? Recent research suggests that states arose as a form of political organization because?