Find the sum of the first 39 terms of the following series, to the nearest integer
7,15,23,...

Answers

Answer 1

Answer:

6201

Step-by-step explanation:

formula for series in AP

where n is the nth term and a is first term and d is difference between two terms in series \(sum = \frac{n}{2} (2a \: + (n - 1)d)\)


Related Questions

Suppose that 21 inches of wire costs 63 cents.
At the same rate, how much (in cents) will 54 inches of wire cost?

Answers

Answer:

162 cents

Step-by-step explanation:

to find the rate you want take the inches which is 21 and divide by the cost which is 63 and find the rate is 3 which means each inch costs 3 cents and so with that rate you can find the cost of 54 inchest of wire so you take your 54 inches and multiply it by 3 which is the cents per inch and find that 54 inches of wire would cost you 162 cents

(2) If the price of an item is represented by p, a final price of 0.7p indicates a discount of what percent?​

Answers

Answer:

30%

Step-by-step explanation:

First subtract: 1 - .70 = .30

Then move decimal over to the right 2 times and add percentage sign instead of the decimal: 30%

Need some help on this one as well haha, answer when you can:)​

Need some help on this one as well haha, answer when you can:)

Answers

Answer:

250 dollars

Step-by-step explanation:

2-1 Discussion: Models and Applications. 15 is 1cm A Rectangle has perimeter 140 cm and to langth than twice its width more

2-1 Discussion: Models and Applications. 15 is 1cm A Rectangle has perimeter 140 cm and to langth than

Answers

The length of the rectangle is 47 cm while its width is 23 cm

Here, we want to get the width and the length of the rectangle from the given information

Since we do not know the measure of these, we start by labeling the width and the length using variables

Let the width be w and the length be l

Firstly, we write the expresssion that calculates the perimeter

The expression is calculated as;

\(P\text{ = 2(l + w)}\)

where P in this case is 140 cm

Thus, we have;

\(\begin{gathered} 140\text{ = 2(l + w)} \\ l\text{ + w = 70 }\ldots\ldots.(i) \end{gathered}\)

We use the extra information to get another equation

The extra information is that the length is 1 cm more than twice its width

Mathematically, we have the equation as;

\(l\text{ = 1 + 2w }\ldots\ldots\ldots\ldots(ii)\)

So, now we have two equations to solve so as to get the width and the length

We can directly substitute the expression for l into equation 1

We have this as;

\(\begin{gathered} 1\text{ + 2w + w = 70 } \\ 1\text{ + 3w = 70} \\ \\ 3w\text{ = 70-1} \\ \\ 3w\text{ = 69} \\ \\ w\text{ = }\frac{69}{3} \\ \\ w\text{ = 23 cm} \end{gathered}\)

To get l, we simply substitute the value of w into the second equation

That would be;

\(\begin{gathered} l\text{ = 1 + 2(23)} \\ l\text{ = 1 + 46} \\ l\text{ = 47 cm } \end{gathered}\)

Tara and Ashley spent the same amount at the grocery store. Tara bought 5 pounds of apples. Ashley bought 3 pounds of apples and $5 worth other groceries. How much does one pound of apples cost?

Answers

Answer:

one pound of apple cost $2.5

Step-by-step explanation:

Let the amount they both spent at the grocery store be y and x be the price of apples per pound.

Since Tara bought 5 pounds of apples, 5x = y (1) and Ashley bought 3 pounds of apples and $5 worth other groceries, 3x + 5 = y (2).

Equating both expressions, 5x = 3x + 5

collecting like terms,

5x - 3x = 5

2x = 5

dividing both sides by 2, we have

x = 5/2

x = 2.5

So one pound of apple cost $2.5

Shreya and Shanice are selling pies for a
school fundraiser. Customers can buy
blueberry pies and lemon meringue pies.
Shreya sold 4 blueberry pies and 2 lemon
meringue pies for a total of $76. Shanice
sold 4 blueberry pies and 13 lemon
meringue pies for a total of $230. What is
the cost each of one blueberry pie and
one lemon meringue pie?

Answers

Answer:

$26

Step-by-step explanation:

Let blueberry pies = x and lemon pies = y.

4x + 13y = 230

4x + 2y = 76

Using elimination, we see that 11y = 154. Therefore, y = 14.

4x + 2(14) = 76

4x + 28 = 76

4x = 48

x = 12

x + y = 12 + 14 = 26.

$26 is your answer.

Answer:

Step-by-step explanation:

Let B be the price of a blueberry pie.  Let L be the price of a lemon meringue pie.

We are told that Shreya makes a total of $76 by selling 4 blueberry and 2 lemon meringue pies.  This can be made into an equation:

Shreya:  4B + 2L = $76

We also learn that Shanice is doing particularly well:

Shanice:  4B + 13L = $320

We want to determine the prices for each type of pie, B and L.  We have two equations and two unknowns.  That means we should be able to find the answers by substitution.

Rearrange Shreya's equation to isolate B:

Shreya:  4B + 2L = $76

               4B   = $76 - 2L

                 B = ($76-2L)/4

Now use this definition of B in Shanice's equation:

Shanice:  4B + 13L = $320

                4( ($76-2L)/4) + 13L = $320

                     ($76-2L) + 13L = $320

            11L = 244

                L = $22.18

Use L = $22.18 in either equation and solve for B:

4B + 2L = $76

4B + 2*($22.18) = $76

4B = $31.64

B = $7.91

---

Blueberry pies are $7.91 each.

Lemon meringue pies are $22.18 each

=========

CHECK:  Do these prices provide the correct sales for each person?

            Price($/pie)        Shreya     Shanice

Blueberry          7.91               4            4

Lemon Mer.    22.18                2           13

Blueberry Sales ($)                    31.64        31.64

Lemon Mer. Sales ($)               44.3       288.36

Total Sales                              $76        $320

YES - These prices account for each person's sales.

does regular exercise decrease the risk of cancer? a researcher finds 200 women over 50 who exercise regularly, pairs each with a woman who has a similar medical history but does not exercise, then follows the subjects for 10 years to see which group develops more cancer. this is a

Answers

the subjects for 10 years to see which group develops more cancer this is a Prospective study

Individuals are monitored in real-time for prospective studies, as information is gathered about them as their traits or situations evolve. Prospective studies include things like birth cohort studies.

In retrospective research, people are sampled, as details regarding their history are gathered. This could be done by asking people to recollect significant occurrences during interviews or by finding pertinent administrative data to fill in the blanks on former events and conditions.

A study sample is split into two groups in a randomized experiment: one will get the intervention under research, while the other won't.

A matched experiment is a type of research setup in which subjects are paired up according to traits they have in common before being divided into categories.

A survey involves asking a sample of people a specified set of questions.

Learn more about Prospective study here:https://brainly.com/question/28501660

#SPJ4

An employer offers a retirement program in which 7.7% of a worker's salary is deducted from their pay and deposited into an investment fund. the company then adds an additional 9% of the worker's salary to the fund. how much would an employee have deposited into their fund in the first year if their starting salary is 45,000?

Answers

According to the given statement the total deposited into the employee's fund in the first year would be $7,515.

To calculate how much would be deposited into the employee's fund in the first year, we need to add the amount deducted from the worker's salary (7.7%) and the additional contribution made by the company (9%).

Step 1:

Calculate the amount deducted from the worker's salary:


7.7% of the worker's salary = (7.7/100) * 45,000

Step 2:

Calculate the additional contribution made by the company:


9% of the worker's salary = (9/100) * 45,000

Step 3:

Add the two amounts to find the total deposited into the fund:


Total deposited into the fund = Amount deducted from the worker's salary + Additional contribution made by the company

In the first year, an employee with a starting salary of $45,000 would have $3,465 deducted from their pay and deposited into their retirement fund.

Additionally, the company would contribute $4,050 to the fund.

To know more about contribution visit;

https://brainly.com/question/33208709

#SPJ11

The file sequences.mat contains a set of fictitious bio-sequence in a cell array sequences {mu}(t). Thus sequences {3}(:) is the third sequence, GTCTCCTGCCCTCTCTGAAC which consists of 20 timesteps. There are 20 such sequences in total. Your task is to cluster these sequences into two clusters, assuming that each cluster is modelled by a Markov chain. State which of the sequences belong together by assigning a sequence v^n to that state for which p(h∣v^n) is highest. You may wish to use mixMarkov.

Answers

The exact code or specific sequence assignments cannot be provided without knowledge of the programming context or access to the mixMarkov function and the sequences data.

Clustering bio-sequences into two clusters using Markov chains can be achieved by applying a mixture model approach. In this case, the mixMarkov function can be utilized to assign the sequences to their respective clusters based on the highest conditional probability.

Given the file sequences.mat containing the bio-sequences in the cell array sequences, the mixMarkov function can be employed to perform the clustering. This function models each cluster as a separate Markov chain and calculates the conditional probability of each sequence belonging to a particular cluster.

By running the mixMarkov algorithm on the sequences data with two clusters, the function will assign each sequence to the cluster for which the conditional probability p(h∣v^n) is highest. The resulting clustering will group together sequences that share similar characteristics based on their Markov chain modeling.

It is important to note that the implementation details of the mixMarkov function and the specific assignment of sequences to clusters will depend on the programming language or software used for analysis.

Therefore, the exact code or specific sequence assignments cannot be provided without knowledge of the programming context or access to the mixMarkov function and the sequences data.

To learn more about sequence from the given link

https://brainly.com/question/12491544

#SPJ4

Salaries of 49 college graduates who took a statistics course in college have a​ mean​ of $63,800. Assuming a standard​ deviation, σ​, of ​$11,936​, construct a 90​% confidence interval for estimating the population mean μ.

Answers

There can be 90% confident that the population mean salary of college graduates who took a statistics course is between $60,947.78 and $66,652.22.

To construct a 90% confidence interval for estimating the population means μ of salaries for college graduates who took a statistics course, we can use the formula:

Confidence interval = sample mean ± (critical value) x (standard error)

First, we need to find the critical value from the t-distribution table with a degree of freedom of n-1. Since we have 49 college graduates, our degrees of freedom are 48. Looking at the table, the critical value for a 90% confidence level is 1.677.

Next, we need to find the standard error, which is calculated by dividing the standard deviation by the square root of the sample size. In this case, the standard error is $11,936/sqrt(49) = $1703.05.

Substituting these values into the formula, we get:

Confidence interval = $63,800 ± 1.677 x $1703.05
Confidence interval = $63,800 ± $2852.22

To learn more about Population :

https://brainly.com/question/25630111

#SPJ11



who is good at math?

Answers

Answer:

i will forever hate math

Step-by-step explanation:

Please I need help!!!!

Please I need help!!!!

Answers

Answer:

y=1/4x-1

Step-by-step explanation:

So lets start off by going over what slope intecerp form is.

Slope intercept form looks like this:

y=mx+b

Lets go over the different values in this formula:

y is always going to just be what mx+b equals, and you can plug in values for x to solve for it.

m is always teh slope. The slope is y/x, basically just the change in y over the change in x.

x is going to be the number you plug in a value for to solve for y.When writing slope intercept form, this will always just be x.

Lastly we have b. This is what y equals when x is 0.

Lets use this to make our slope intercept.

So we have:

y=mx+b

y and x are not going to have a written value, so we only need to determine m and b.

So lets find b.

B will be the slope. When we look at the points on the graph, we see (-4, -2) and (0, -1)

The difference in y is -1.(-2--1=-1). The difference in the x is -4.(-4-0=-4).

So b will be: -1/-4, or just 1/4:

y=1/4x+b

Now lets find b.

Lets specificly lookat what y equals when x is 0 on the graph.

We can see the point is (0, -1)

So the y intercept is -1. This means b is equal to -1:

y=1/4x-1

This is your slope intercept!

Hope this helps! :D

Sorry for bad grammar, I am writting on a strange keyboard.

Write yes if the following polygons are regular, and no if they’re not.

Write yes if the following polygons are regular, and no if theyre not.

Answers

Answer:

a. yes

b. no

c. yes

d. yes

e. yes

f. no

Step-by-step explanation:

a regular polygon must be equiangular (all angles are same) and equilateral (all sides are same)

A. equilateral triangle, regular

B. is a rectangle and the sides of rectangle are not all equal, thus, not regular

C. octagon, regular

D. flipped pentagon, regular

E. square, regular

F. not normal pentagon, not regular

Answer:

a. yes  

b. no  

c. yes  

d. yes  

e. yes  

f. no

Step-by-step explanation:

a regular polygon must be equiangular (all angles are same) and equilateral (all sides are same)

A. equilateral triangle, regular

B. is a rectangle and the sides of rectangle are not all equal, thus, not regular

C. octagon, regular

D. flipped pentagon, regular

E. square, regular

F. not normal pentagon, not regular

Michael buy a baket of mangoe on ale for \$ 4$4 before tax. ​

​The ale tax i 12%. ​

​What i the total price Michael pay for the baket of mangoe?

Answers

Total price paid by Michael for the basket of mangoes is $4.48.

For the calculation of total price, price of sales tax will be added with selling price. Forming the equation -

Total price = 4 + 12%×4

Calculating the percentage of sales tax on Right Hand Side of the equation

Total price = 4 + 12×4/100

Solving the percentage part on Right Hand Side of the equation

Total price = 4 + 0.48

Performing addition on Right Hand Side of the equation

Total price = $4.48

Hence, Michael has to pay $4.48 after addition of sales tax for the basket of mangoes.

Learn more about sales tax -

https://brainly.com/question/9437038

#SPJ4

Learn more

• Choose a topic from the list below: Argue why Josef Pieper conception of leisure is the best one in modernity, or instead why it might be a limited conception in comparison to another theory of leisure. • Argue why a life is better with leisure today, and why for the classical Greeks, an absence of leisure meant an absence of a happy life. • Argue why John Dewey and modern liberal thinkers did not agree with Aristotle's ideas on education or on leisure generally. • Argue how modern psychological conceptions of happiness and the classical idea of happiness in Aristotle differ. What was the "Greek Leisure Ideal" and how would it manifest today according to Sebastian De Grazia? What happened to it? • Argue why the liberal arts are so important in education and leisure, and explain its Greek origin and how that is received today. • You must choose from this list, but it can be modified slightly if you have an idea you wish to pursue. The main requirement is that you must contrast at least one ancient thinker and one modern one. • The paper must be well researched and contain a minimum of 6 sound academic sources. • Textbook or course readings may be used, but do not count in this total. DETAILS SCALCET8 1.3.039. 0/1 Submissions Used Find f o g o h. f(x) = 3x - 8, g(x) = sin(x), h(x) =x^2

Answers

To argue why the liberal arts are so important in education and leisure, one must discuss its Greek origin and how it is received today.

The term "liberal arts" comes from the Latin word "liberalis," which means free. It was used in the Middle Ages to refer to topics that should be studied by free people. Liberal arts refers to courses of study that provide a general education rather than specialized training. It encompasses a wide range of topics, including literature, philosophy, history, language, art, and science.The liberal arts curriculum is based on the idea that a broad education is necessary for individuals to become productive members of society. In ancient Greece, education was focused on developing the mind, body, and spirit.  

The study of the liberal arts is necessary to create well-rounded individuals who can contribute to society in meaningful ways. While the importance of the liberal arts has been debated, it is clear that they are more important now than ever before. The study of the liberal arts is necessary to develop the skills that are required in a rapidly advancing technological world.

To know more about Greek visit:

brainly.com/question/30200246

#SPJ11

A
company has the production function p(x, y) = 22x ^ 0.7 * y ^ 0.3
for a certain product. Find the marginal productivity with fixed
capital , partial p partial x
A company has the production function p(x,y)=22x70.3 for a certain product. Find the marginal productivity ap with fixed capital, dx OA. 15.4 OB. 15.4xy OC. 15.4 OD. 15.4 X VX IK 0.3 0.3 1.7 .

Answers

To find the marginal productivity with fixed capital, we need to calculate the partial derivative of the production function with respect to x (holding y constant). The correct answer would be option OB. 15.4xy.

Given the production function \(p(x, y) = 22x^0.7 * y^0.3\), we differentiate it with respect to x:

\(∂p/∂x = 0.7 * 22 * x^(0.7 - 1) * y^0.3\)

Simplifying this expression, we have:

\(∂p/∂x = 15.4 * x^(-0.3) * y^0.3\)

Therefore, the marginal productivity with fixed capital, partial p partial x, is given by \(15.4 * x^(-0.3) * y^0.3.\)

The correct answer would be option OB. 15.4xy.

learn more about marginal productivity here:

https://brainly.com/question/31050533

#SPJ11

Select all that apply
By doing which of these things do we show that p, q, and r are equivalent statements
• Show that p→q, r→q and q→r
• Show that p→r, q→p, and r→q
• Show that q→p, p→q, and r→q
• Show that r→p, p→q, and q→r

Answers

The statements p, q, and r are equivalent if and only if the following three conditionals are true: p→q, r→q, and q→r. option A is correct answer .

To show that p, q, and r are equivalent statements, we can show that each statement implies the other two.

Hence, the correct answer is:• Show that p→q, r→q and q→rThe other options provided are incorrect, here's why:• Show that p→r, q→p, and r→q: This shows that p, q, and r are connected but not equivalent. • Show that q→p, p→q, and r→q: This shows that p, q, and r are connected but not equivalent. • Show that r→p, p→q, and q→r: This shows that p, q, and r are connected but not equivalent.

The correct option is A.

For more question equivalent

https://brainly.com/question/28201741

#SPJ8

If a 98% confidence interval has bounds 73 and 80, which of the following could be the bounds for a 95% confidence interval? A. 73 and 81. B. 72 and 79. C. 72 and 81. D. 74 and 79.

Answers

The bounds for a 95% confidence interval could be option (B) 72 and 79

We know that the 98% confidence interval has bounds of 73 and 80. This means that if we were to repeat the same experiment many times, we would expect that 98% of the time, the true population mean would fall within this range.

To find the bounds for a 95% confidence interval, we can use the fact that a higher confidence level corresponds to a wider interval, and a lower confidence level corresponds to a narrower interval.

Since we want a narrower interval for a 95% confidence level, we can expect the bounds to be closer to the sample mean. We can calculate the sample mean as the midpoint of the 98% confidence interval

(sample mean) = (lower bound + upper bound) / 2 = (73 + 80) / 2 = 76.5

Next, we can use the formula for a confidence interval:

(sample mean) ± (z-score) × (standard error)

where the z-score depends on the desired confidence level, and the standard error depends on the sample size and sample standard deviation. Since we don't have this information, we can assume that the sample size is large enough (i.e., greater than 30) for the central limit theorem to apply, and we can use the formula

standard error = (width of 98% CI) / (2 × z-score)

For a 98% confidence interval, the z-score is 2.33 (found using a standard normal distribution table or calculator). Plugging in the values, we get

standard error = (80 - 73) / (2 × 2.33) = 1.70

Now, we can use this standard error to calculate the bounds for a 95% confidence interval

(sample mean) ± (z-score) × (standard error) = 76.5 ± 1.96 × 1.70

Simplifying, we get

(lower bound) = 76.5 - 3.33 = 73.17

(upper bound) = 76.5 + 3.33 = 79.83

Therefore, the correct option is (B) 72 and 79

Learn more about confidence interval here

brainly.com/question/24131141

#SPJ4

what is p to the power of to-5 when p = 14

Answers

Step-by-step explanation:

p^(-5)  =  1 / p^5  =  1/14^5  = 1.859 x 10^-6

N the United States, the average public school teacher currently earns an annual salary near $55,202. Reported national average salaries for the last six decades are listed below. Year National Average Teachers' Salary 1960 $4,995 1970 $8,626 1980 $15,970 1990 $31,367 2000 $41,807 2010 $55,202 Determine the average salary increase per year between the years 1980 and 1990. $1,539.70 $8,367.80 $2,566.20 $1,004.10

Answers

Answer:

$1,539.70

Step-by-step explanation:

Given the data :

National average Teachers' salary (NATS)

YEAR:_1960 _ 1970 _ 1980 _ 1990 _ 2000 2010

NATS:4995_8626_15970_31367_41807_55202

AVEAGE SALARY INCREASE PER YEAR BETWEEN 1980 and 1990

Salary in 1980 = $15970

Salary in 1990 = $31367

Average salary increase per year:

Difference in salary / difference in years

$(31367 - 15970) / (1990 - 1980)

= $15397 / 10

= $1539.7

8. Find (f+g)(x) if f(x) = 4x² - 5x and g(x) = 3x² + 6x - 4.​

Answers

\( {\qquad\qquad\huge\underline{{\sf Answer}}} \)

Here we go ~

\(\qquad \sf  \dashrightarrow \: (f + g)(x)\)

\(\qquad \sf  \dashrightarrow \: f(x) + g(x)\)

\(\qquad \sf  \dashrightarrow \: (4 {x}^{2} - 5x) + (3 {x}^{2} + 6x - 4)\)

\(\qquad \sf  \dashrightarrow \: 7 {x}^{2} + x - 4\)

find the unknown angle ​

find the unknown angle

Answers

Answer:

total angles in triangle = 180

180 = 44+56+ y

y = 180-44-56

y = 80°

now to find z and x

we know the 2 straight lines are parallel (indicated by arrows)

x = 56°

z = 44°

how?

alternate angles theorem

Alternate angles are angles that occur on opposite sides of the transversal line and have the same size. Alternate angles are equal: We can often spot interior alternate angles by drawing a Z shape: There are two different types of alternate angles, alternate interior angles and alternate exterior angles.

The volume of a​ cone-shaped hole is 21πft3 If the hole is 7ft​ deep, what is the radius of the​ hole?

Answers

Answer:

r = 3ft

Step-by-step explanation:

example of a cone-shaped hole is a funnel

V = 1/3 • π • r² • height

21π = 1/3 • π • r²• height

(21)3  = (1/3 • r² • 7)3

63/7 = (r² • 7)/7

√9 = √r²

r = 3

Ellie purchased 7 shirts that were originally priced at $15.50
each. She receives a discount of 20% off, then gets an additional 10% off of that price.
What was the total cost of the 7 shirts after she received both her discounts? Write your
answer to the Hundredths Place, DO NOT USE A $ Sign)
The total cost for 7 shirts was type your answer
dollars.

Answers

Answer:

10.85

Step-by-step explanation:

Answer:

11.16

Step-by-step explanation:

20% of $15.50 is $3.10 and 15.50 - 3.10 is 12.40

10% of 12.40 is 1.24 12.40 - 1.24 = 11.16 meaning that the total cost was 11.16 at the end

MARK MY ANSWER BRAINLIEST PLEASE

What is the value of 30 minus 2 (7 + 2) minus 1?
11
14
17
19

Answers

Answer:

11

Step-by-step explanation:

use distributive property

I have no clue if you can see this but help pleaseeeee

I have no clue if you can see this but help pleaseeeee

Answers

Answer:

b=5

a=1

Step-by-step explanation:

x+5y= 38

5x-y= 8

that's the answer

How would you divied 15 in half. If you answer, i will revial 2 things

Answers

Answer:

7.5

Step-by-step explanation:

ater it
i) A number consists of two digits. If the number formed by reversing its digits
is added to it, the sum is 143 and if the same number is subtracted from it the
remainder is 9. Find the number.
Ts hend
A numhor consists of turn dinits whose sum is 9 If three times the number is equal

Answers

Answer:

76

Step-by-step explanation:

Not sure what you mean by the second half, but I'll answer the first question. Since the number is two digits, you can represent it as 10x + y. If you reverse the digits, it becomes 10y + x. So, 11x + 11y = 143, and 9x - 9y = 9. Solving for x and y, you find x = 7 and y = 6.

In ASTU, u = 280 inches, 2T=63° and ZU=29º. Find the length of t, to the nearest
10th of an inch.

Answers

Answer:

514.6

Step-by-step explanation:

\(\sqrt{25} is an irrational

Answers

Answer:

Is Square Root of 25 Rational or Irrational?  

Step-by-step explanation:

A rational number can be expressed in the form of p/q. Because √25 = 5 and 5 can be written in the form of a fraction 5/1. It proves that √25 is rational.

The answer is:

⇨ √25 is a rational number

Work/explanation:

What are rational numbers?

Rational numbers are integers and fractions.

Irrational numbers are numbers that cannot be expressed as fractions, such as π.

Now, \(\bf{\sqrt{25}}\) can be simplified to 5 or -5; both of which are rational numbers.

Hence, √25 is rational.
Other Questions
find dz dt by the chain rule where z = cosh2 (xy), x = 1 2 t, and y = e t . ______ research uses questions to collect information about what people do, think, and believe. a. sample b. remunerative c. survey d. biased warehousing labor safety practices in the united states are monitored by which federal government agency? nsf using microbial bioproduction platform to elucidate phytochemical biosynthesis strigolactone as an example Solve for RN.50 points in it for you plus a thanks, 5 star rate and brainliest! What is the tendency towards decay or disintegration, exhibited by all closed systems whenthere is no external input to sustain them, known as?Group of answer choicesDisgregationEnthalpyEntropyNegentropy Use the unit price of gasoline at both gas stations to determine which gas station charges more for gasoline (gallons). Be sure to include the unit prices in your answer. Show or explain your work. gamma-ray bursters are great distances from earth, yet earth receives tremendous amounts of energy from them. explain. explain why most nerve cells have a myelin sheath Lines 19-24 how does the use of passive voice affect the meaning of these lines? from of plymouth plantation Electric power is to be generated by installing a hydraulic turbine-generator at a site 70m below the free surface of a large water reservoir that can supply water at a rate of 1500 kg/s steadily. If the mechanical power output of the turbine is 800 kW and the electric power generation is 750 kW, determine the turbine efficiency and the combined turbine-generator efficiency of this plant. How does the nararators description of L'Abri from Madame Valmonde's point of view develop the mood of the text? on december 5, 20x8, texas based imperial corporation purchased goods from a saudi arabian firm for 100,000 riyals (sar), to be paid on january 10, 20x9. the transaction is denominated in saudi riyals. imperial's fiscal year ends on december 31, and its reporting currency is the u.s. dollar. the exchange rates are: Im lost in my train of thought May someone please help please and thank you:) how do we remember the past? i need help with this question: What is Twain satirizing in Chapter 21? Pls help giving points coloring.Identify the word in bold If you traveled to the Spanish city of Crdoba in the 10th century, which of the following would you not find? a) A prosperous trading and religious centerb) A population larger than Paris, Francec) A government free from Islamic influenced) A cultural center for the region