Find the volume v of the described solid s. the base of s is a circular disk with radius 2r. parallel cross-sections perpendicular to the base are squares.

Answers

Answer 1

The volume of the solid is \(V=128\frac{r^{3} }{3}\)

What do you understand by Volume ?

A liquid, solid, or gas's volume is the amount of three-dimensional space it occupies. Although there are many different units that can be used to indicate volume, the most common ones are liters, cubic meters, gallons, milliliters, teaspoons, and ounces.

base is x2+y2=(2r)2

==>y=-√(4r2-x2) ,√(4r2-x2)

So each cross section parallel has base = √(4r2-x2) - -(√(4r2-x2)) = 2√(4r2-x2) and height = base

So area of each cross section is 2√(4r2-x2)*2√(4r2-x2)= 4(4r2-x2)

Now we integrate from left side of circle to right side of circle (-2r to 2r)

V = 4 ∫[ -2r to 2r] (4r2-x2)dx

V = 4 (4r2x - x3/3) [ -2r to 2r]

V = 4 [(4r2(2r) - (2r)3/3) - (4r2(-2r) - (-2r)3/3)]

V = 4 [ (8r3 - 8r3/3) - (-8r3 + 8r3/3)]

V = 4 (16r3 - 16r3/3)

V = 4 (32r3/3)

V = 128r3/3

To learn more about the volume, visit: https://brainly.com/question/11685836

#SPJ4


Related Questions

An object is placed 10 cm in front of a concave lens. If the image formed at a distance of 5 cm from concave lens, calculate the focal length of the lens?​

Answers

Answer:

I would be 5 centimeters I think

the earth’s tilt changes its position relative to the stars and constellations as the earth rotates and orbits.

Answers

That's correct. The Earth's tilt, known as axial tilt or obliquity, causes its position relative to the stars and constellations to change as the Earth rotates and orbits the Sun.

The Earth's axis of rotation is tilted at an angle of approximately 23.5 degrees with respect to its orbital plane. This tilt remains constant throughout the year as the Earth orbits the Sun. As a result, different parts of the Earth receive varying amounts of sunlight at different times of the year, leading to the changing of seasons.

Due to this tilt, as the Earth orbits the Sun, the position of the North and South Poles and the equator relative to the stars and constellations appears to shift. This phenomenon is known as precession. Over a period of approximately 26,000 years, the Earth's axis traces out a cone shape, causing the position of the celestial poles to change. This means that the North Star (Polaris) is not a fixed point but changes over time.

The motion of precession and the Earth's tilt contribute to the changing positions of the stars and constellations relative to an observer on Earth throughout the year.

To know more about motion visit:

brainly.com/question/33317467

#SPJ11

A force of 3kN acts on a car to make it accelerate by 1.5m/s/s. What is the mass of the car?

Answers

Answer:

2

Explanation:

To find force it's force = mass times acceleration so to find mass you would divide force by acceleration

assuming that this mixture is ideal, that is, it follows raoult’s law, what is the partial vapor pressure of benzene in this mixture at 50 °c?

Answers

To determine the partial vapor pressure of benzene in a mixture at 50 °C, we need additional information, such as the mole fraction of benzene in the mixture and the vapor pressure of pure benzene at that temperature.

Raoult's law relates the partial vapor pressure of a component in an ideal mixture to its mole fraction and the vapor pressure of the pure component. If we have the mole fraction of benzene (Xbenzene) and the vapor pressure of pure benzene at 50 °C (Pbenzene), we can use Raoult's law to calculate the partial vapor pressure of benzene (Pbenzene_partial) in the mixture: Pbenzene_partial = Xbenzene * Pbenzene .The mole fraction of benzene (Xbenzene) represents the fraction of the total moles of the mixture that are benzene molecules. It ranges from 0 to 1, with 0 indicating no benzene present and 1 indicating that the entire mixture consists of benzene.

learn more about benzene here:

https://brainly.com/question/31837011

#SPJ11

How far will a car travel in 2 hours at 20m/s​

Answers

Use the formula distance = rate x time

The rate is 20 m/s

The time is 2 hours, which can be converted to seconds

1 hr = 60 min

1 min = 60 sec.

1 hr = 60 (60) = 3600 sec.

The distance traveled will be 20 m/s * 3600 s

- good day! (please give brainliest) ✨

The magnet on the right is moved toward the suspended magnet on the left.

Which statement describes the interactions of the magnets in terms of their magnetic fields?
A. A repulsive force between the two magnets causes the suspended magnet to swing to the left.
B. A repulsive force between the two magnets causes the suspended magnet to oscillate like a pendulum.
C. An attractive force between the two magnets causes the suspended magnet to swing to the right.
D. An attractive force between the two magnets cause the suspended magnet to oscillate like a pendulum.

Answers

A repulsive force between the two magnets causes the suspended magnet to swing to the left. Option A

What is a magnet?

We know that a magnet is any materials that has the magnetic domains in the substance being properly aligned. The implication of this is that the material is also capable of making the magnetic domains in another material to also become aligned.

The materials that can be attracted by a magnet are said to be magnetizable materials. We can see that the force that acts between two magnets can be an attractive force or repulsive force depending on the poles of the magnet that are facing each other.

Since unlike poles attract and like poles repel, the poles that have been shown in the image that is attached would repel each other.

Learn more about magnets:https://brainly.com/question/2841288

#SPJ1

The magnet on the right is moved toward the suspended magnet on the left.Which statement describes the

The coetticient of friction between a block and the surface it slides across is 0.360. The block has a mass of 150 kg

What force is required to accelerate the block 0.5 m/a^2.

Answers

The friction between the b;ock and surface is given by mass and accelerartion.

Force = mass * acceleration

what is quantum physics and what is the equation for space time and travel?

Answers

Answer:

Im not smart

Explanation:

but im your bff

Answer:

it explain how everythings work you should work with the speed of light multiply with the distance of the equator

if an electron experiences a force of 2 x 10-15 n as it accelerates between two metal plates, what is the magnitude of the electric field between the plates?

Answers

The magnitude of the electric field between the plates is 1.25 x × 10⁴ N/C.

Electric field - Every point in space where a charge, in any form, is present has an electric property that is called an electric field.

The magnitude of the electric field strength is given as :

E = F/q

where

E = electric field

F = electrostatic force

q = charge

electron experiences a force of as it accelerates between two metal plates =  2 x 10⁻¹⁵ N

Charge of the electron,

q = 1.6 × 10⁻¹⁹ C

Then

E = (2 x 10⁻¹⁵ N)÷(1.6 × 10⁻¹⁹ C)

E = 1.25 x × 10⁴ N/C.

The magnitude of the electric field between the plates is 1.25 x × 10⁴ N/C.

To know more about electric field

https://brainly.com/question/864340

#SPJ4

the nearpoint of an eye is 151 cm. a corrective lens is to be used to allow this eye to clearly focus on objects 25 cm in front of it. what should be the focal length of this lens?

Answers

When a lens is focussed to infinity, its focal length can be calculated. The angle of view—or the amount of the image will be captured—and magnification are both determined by the lens focal length.

How long is my lens's focal length?

The focal length of the lens, which is often expressed in millimeters, is the space between the lens as well as the image sensor whenever the subject is in focus .The maximum and minimum focal lengths of zoom lenses are specified, for instance, 18-55 mm.

How should I pick my focus length?

The focal length that isolates the topic, or hero, in your image and keeps out all the distractions, or villains, is the optimal focal length. Select a long depth of field lens, such as one with a 70, 135 or 200mm aperture, to separate textures and far-off details to pace of innovation backgrounds.

To know more about magnification visit:

https://brainly.com/question/28957672

#SPJ4

A box is being pushed at constant speed up an inclined

Answers

Answer:

ok what is the question

Explanation:

I don't know what the question is

provide 2 important pitching tips you can tell someone else. softball

Answers

I know you only need two, but here are some options to choose from.

Tip 1 - throwing a fastball. Use two points to keep your arm properly aligned your biceps brush your ear at the top of the backswing, and your pitching hand brushes your hip at release.

Tip 2 - throwing a curveball. Pictures should know that in order to maximize your curves, you should visualize a series of dots from the mound to the outside corner of the plate. Pitch along those dots.

Tip 3 - throwing a fast pitch rise. It’s possible that your wrist snap may be sideways. Play with different grips or finger pressures and try to relax them.

Tip 4 - throwing a change-up. Don’t always throw the change-up in a given situation. Make sure to change your pitch selection.

Tip 5 - throwing a drop-ball. Keep your pitching arm close to your body to avoid injury.

Which of the following is an example of a properly written testable hypothesis? *

A people should taste this new health food and see whether it makes them stronger

B When dog owners don't feed their puppies Brand A food, the puppies do not grow properly

C If Frederico had added the leaves to the compost pile last year, he wouldn't have to organic fertilizer

D if it is dark, then an owl will find a mouse by the sound the mouse makes​

Answers

Answer:

D. if it is dark, then an owl will find a mouse by the sound the mouse makes

A projectile has an initial horizontal velocity of 34.0 M/s at the edge of a roof top. Find the horizontal and vertical components of its velocity after 5.5s

I need shown work !

Answers

Answer:

\(v_x=34 m/s\)

\(v_y=53.9\ m/s\)

Explanation:

Horizontal Launch

When an object is thrown horizontally with a speed v from a height h, it describes a curved path ruled by gravity until it eventually hits the ground.

The horizontal component of the velocity is always constant because no acceleration acts in that direction, thus:

vx=v

The vertical component of the velocity changes in time because gravity makes the object fall at increasing speed given by:

\(v_y=g.t\)

The horizontal component of the velocity is always the same:

\(v_x=34 m/s\)

The vertical component at t=5.5 s is:

\(v_y=9.8*5.5=53.9\)

\(v_y=53.9\ m/s\)

what is the temperature of sweat when it is first produced? explain your answer.

Answers

The temperature of sweat when it is first produced is two degree more than normal temperature of the body because sweat removes extra heat from the body.

What is the temperature of sweat when it is first produced?

Our body begins to sweat when our body temperature goes up more than two degrees from normal which is 102 degree F. When you sweat, your body temperature drops back to the safe range which is 96.6 to 100.6 degrees F.

So we can conclude that The temperature of sweat when it is first produced is two degree more than normal temperature of the body because sweat removes extra heat from the body.

Learn more about temperature here: https://brainly.com/question/24746268

#SPJ1

for each of the following cases, indicate whether the work done on the second object in each example will have a positive or a negative value. a. the road exerts a friction force on a speeding car skidding to a stop. b. a rope exerts a force on a bucket as the bucket is raised up a well. c. air exerts a force on a parachute as the parachutist falls to earth.

Answers

a) The work done by frictional force on the skidding car is negative.

b) Positive work is accomplished by the rope's force on the bucket.

c) The work done by the force exerted by the air on the parachutist is negative.

W = F * d = F d cos gives the amount of work done.

where, force is F and displacement is d

a) The road exerts a frictional force on a speeding car skidding to a stop.

In this instance, the frictional force F works in opposition to the direction of motion and opposes the motion itself. The angle between displacement and frictional force, which is in the opposite direction and equals 180°.

So, the work done by the frictional force on the skidding car is negative.

b) A bucket is being raised up a well while being pulled by a rope.

The bucket is raised upward by the rope's upward force F. The force and displacement are in the same direction, and their angle is equal to zero.

So, the work done by the force exerted by the rope on the bucket is positive.

c) As a parachutist falls to the ground, air pulls on a parachute.

The air opposes the parachutist's descent with a force F as they both plummet to the ground under the influence of gravity. The force exerted by the air is in a direction opposite to the motion of the parachutist. The force of air and displacement have an angle of 180 degrees.

So, the work done by the force F exerted by the air on the parachutist is negative.

To know more about force:

https://brainly.com/question/21787568

#SPJ4

HELP MEEEEE HURRRYYYY EASYY

What best describes the greatest height a ball will bounce off the ground after being dropped from a height of 50 centimeters?

A. Less than 50 centimeters, as the ball transforms some of its thermal energy into sound energy

B. Less than 50 centimeters, as the ball transforms some of its potential energy into sound energy

C. Greater than 50 centimeters, as the ball transforms some of its thermal energy into potential energy

D. Greater than 50 centimeters, as the ball transforms some of its potential energy into thermal energ

Answers

Answer:

C

Explanation:

thats what i think it depends on the amount of force someone dropped the ball with.

Answer: A) "Less than 60 centimeters, as the ball transforms a part of its potential energy into heat energy"

Explanation:

I took the test

HELP MEEEEE HURRRYYYY EASYYWhat best describes the greatest height a ball will bounce off the ground

Find the electric field and the potential at the center of a square of side 2.0cm

Answers

The electric field at the center of a square of side 2.0 cm is 0, and the potential at the center is also 0.

The electric field at the centre of a square an be identified by

1. In a square, the electric field at the center is zero due to the symmetry of the charges.

2. Since the square is neutral and has equal amounts of positive and negative charges distributed symmetrically, the net electric field at the center cancels out to zero.

3. The potential at a point is the amount of work done to bring a unit positive charge from infinity to that point.

4. In this case, since the square is neutral and the potential is a scalar quantity, the potential at the center is also zero.

5. Therefore, both the electric field and potential at the center of the square of side 2.0 cm are zero.

learn more about electric field here

https://brainly.com/question/15800304

#SPJ11

The gray whale travels an average of 120 km per day as it migrates

Answers

A gray whale travels an average of 120 km per day as it migrates is an example of Speed.

Speed is the ratio of distance to time taken. It is given by:

Speed = Distance / time

Speed is a scalar quantity, hence it has magnitude and no direction.

Hence, A gray whale travels an average of 120 km per day as it migrates is an example of Speed since the direction of the whale is not given.

Find out more at: https://brainly.com/question/22610586

What word
When an object is vibrating, we say that it has energy in its kinetic energy___
completes the sentence?

Answers

Answer:

that is which produces Sound

Answer:

The right answer is "stores"

Explanation:

All objects that are moving will have some energy in their kinetic energy store.

An electric motor is running on 120 V. The current is measured to be 2 A. How many ohms of resistance is the motor

Answers

Answer:

60 ohms

Explanation:

\(v = ir \\ 120 = 2i \\ i = 120 \div 2 \\ i = 60ohms\)

If it is helpful pls follow

The electric motor has a potential difference of 120 V and a current of 2 A, so the resistance in the circuit is 60 Ω.

What is Resistance?

Electrical resistance, which measures how a substance or equipment reduces the flow of electric current through it, is a type of electrical quantity. Ohms (Ω) units have been used to express resistance. If we use the analogy of water flowing through pipes, as the pipe gets thinner, the resistance will increase and the water flow diminishes.

A circuit's opposition to the flow of electricity is assessed by its electrical resistance.

Electrons moving through a conductor, such as with a metal wire, create an electric current. The ions in the metal may be damaged by the speeding electrons. Resistance results from this, making it harder for the current that flows.

According to the ohm's law,

\(V=RI\)

V = 120V

I = 2A

120 = R (2)

R = 60 Ω.

Therefore, the resistance in the circuit is 60 Ω.

To know more about Resistance :

https://brainly.com/question/11431009

#SPJ5

This type of severe weather only develops when a group of storms meet over warm tropical waters what type of storm is this

Answers

Monsoon is the answer

A student's room has a TV (250 W) ,heater (1150 W) and lamp (200 W) Electricity costs 10 fills per KWh. Calculate how much it would cost to run these three appliances for a total of 2 hour 30 minutes

Answers

Answer:

Cost = 40 fills

Explanation:

First, we will calculate the total power consumed by all appliances:

\(Power = P_{TV}+P_{heater}+P_{lamp}\\Power = 250\ W+1150\ W+200\ W\\Power = 1600\ W = 1.6\ KW\)

Now, we will calculate the energy required:

\(Energy = (Power)(Time)\\Energy = (1.6\ KW)(2.5 h)\\Energy = 4 KWh\\\)

Now, for the cost we use the following formula:

\(Cost = (Energy)(Unit\ Cost)\\Cost = (4\ KWh)(10\ fills/KWh)\\\)

Cost = 40 fills

Based on the information above, describe the place and time that UV rays would be the most harmful on Earth. Support your answer with facts from the text.

Answers

UV rays wοuld be the mοst harmful οn Earth at the equatοr during the summer sοlstice. The strength οf UV rays is highest in the trοpics, especially during the summer sοlstice when the sun is directly οverhead, accοrding tο the text.

What is UV Rays?

UV rays, οr ultraviοlet rays, are a type οf electrοmagnetic radiatiοn that cοmes frοm the sun and has a shοrter wavelength than visible light. They are classified intο three types based οn their wavelength: UVA, UVB, and UVC. UVC rays have the shοrtest wavelength and are the mοst harmful tο living οrganisms, but they are mοstly absοrbed by the Earth's atmοsphere befοre they reach the surface. UVB rays have a lοnger wavelength and can cause sunburn and skin cancer, while UVA rays have the lοngest wavelength and can cause skin aging and wrinkles. Overexpοsure tο UV rays can be harmful tο bοth humans and animals.

The equatοr is lοcated in the trοpics, and the summer sοlstice οccurs when the Earth's tilt is maximized tοwards the sun, resulting in mοre direct sunlight and strοnger UV rays. Therefοre, the cοmbinatiοn οf being in the trοpics and during the summer sοlstice makes the UV rays the mοst harmful.

Learn more about UV Rays from given link

brainly.com/question/24524460

#SPJ1

Complete question:

Based on the information above, describe the place and time that UV rays would be the most harmful on Earth. Support your answer with facts from the text.

Based on the information above, describe the place and time that UV rays would be the most harmful on

1. our entire solar system orbits around the center of the about once every 230 million years. 2. the milky way and andromeda galaxies are among a few dozen galaxies that make up our . 3. the sun appears to rise and set in our sky because earth once each day. 4. you are one year older each time earth about the sun. 5. on average, galaxies are getting farther apart with time, which is why we say our is expanding. 6. our is moving toward the star vega at about 70,000 km/hr.

Answers

(1) Our entire solar system orbits around the center of the Milky Way Galaxy about once every 230 million years.

(2) The milky way and andromeda galaxies are among a few dozen galaxies that make up our Local Group.

(3) The sun appears to rise and set in our sky because earth rotates once each day.

(4) You are one year older each time earth orbits about the sun.

(5) On average, galaxies are getting farther apart with time, which is why we say our universe is expanding.

(6) Our solar system is moving toward the star vega at about 70,000 km/hr.

1.0 Revolution of the solar system

Our entire solar system orbits around the center of the Milky Way Galaxy about once every 230 million years.

2.0 Milky Way and Andromeda galaxies

The milky way and andromeda galaxies are among a few dozen galaxies that make up our Local Group.

3.0 Rotation of the Earth

The sun appears to rise and set in our sky because earth rotates once each day.

4.0 Revolution of the Earth

You are one year older each time earth orbits about the sun.

5.0 Expansion of the universe

On average, galaxies are getting farther apart with time, which is why we say our universe is expanding.

6.0 Motion of the solar system

Our solar system is moving toward the star vega at about 70,000 km/hr.

Learn more about solar system here: https://brainly.com/question/1286910

#SPJ1

The process by which a star experiences a sequence of drastic variations during its stellar life:
a. Cosmic big bang.
b. Interstellar collapse.
c. Stellar birth.
d. Stellar evolution.

Answers

The correct answer is d. Stellar evolution.

This refers to the process by which a star undergoes a series of changes throughout its life, including the fusion of hydrogen into helium, the expansion and contraction of its outer layers, and eventually the formation of a planetary nebula or supernova explosion. These changes can cause the star to experience drastic variations in its size, brightness, and temperature over time.

Stellar birth (c), which takes place in regions of thick molecular clouds referred to as stellar nurseries, is the start of a star's life cycle. A protostar is created when a cloud of gas and dust collapses due to gravity. The protostar undergoes more gravitational collapse as it contracts, heating up until it reaches a density and temperature that allow nuclear fusion to start in its core.

Once fusion has started, the star moves into the main sequence phase, where stable hydrogen fusion occurs, turning hydrogen into helium in the star's core. The majority of a star's life is spent in this phase. But when the star uses up its hydrogen fuel, it starts to go through some major modifications.

To know more about the supernova explosion, click here;

https://brainly.com/question/14018571

#SPJ11

You are out on the water in foggy conditions. You hear one prolonged blast plus two short blasts every two minutes. What does this sound signal mean?

Answers

The sound signal helps to caution and let other people know the exact

position or location during sailing in limited visibility conditions.

Sailors are in which charge of controlling and movement of ships. In limited

visibility conditions such as during fogs, one prolonged blast plus two short

blasts every two minutes are done.

This helps to alert people and other sailors of their location at sea to prevent

accidents and death.

Read more about Sailors here https://brainly.com/question/6337527

The sound signal helps to know the exact location during sailing in foggy conditions.

Who are sailors?


Sailors are the in charge of controlling and movement of ships. In limited visibility conditions such as fogs, one prolonged blast plus two short blasts every two minutes are done.

This helps to caution people and other sailors around their location at the sea to prevent accidents and death.

Learn more about Sailors

https://brainly.com/question/6337527

#SPJ5

It is possible for a fault to have a N-S strike and an East dip False True

Answers

True, it is possible for a fault to have a north-south (N-S) strike and an eastward dip.

Faults can have various orientations and dips depending on the tectonic forces and geological conditions in a particular region. The strike refers to the direction of the fault line on the Earth's surface, while the dip indicates the angle at which the fault plane is inclined from the horizontal. Therefore, a fault can have any combination of strike and dip, including an N-S strike and an eastward dip.

Faults are geological fractures where movement has occurred, and their orientations can vary. A fault with a north-south (N-S) strike means it extends in that direction horizontally. The dip refers to the angle of the fault plane from the horizontal. So, it is possible for a fault to have an N-S strike and an eastward dip.

To know more about tectonic forces.

https://brainly.com/question/13897553

#SPJ11

an emf of 0.2 v drives an electrical current of 2 ma through a solution of sodium chloride in 1 hour. (a) how much charge has been passed? (b) assuming there is no resistance elsewhere in the circuit, what is the resistance represented by the solution? (c) by what means is the charge carried through the solution?

Answers

(a) The charge passed is equal to the current multiplied by the time, so Q = I * t = 2mA * 1h = 2 C.

(b) The resistance represented by the solution is equal to the voltage divided by the current, so R = V / I = 0.2V / 2mA = 0.1 ohm.

(c) The charge is carried through the solution by the ions present in the solution. The ions carry the charge in the form of either electrons or protons. In the case of sodium chloride, the ions are Na+ and Cl-, which carry the charge in the form of protons and electrons respectively.

For more questions like resistance represented  visit the link below:

https://brainly.com/question/19582164

#SPJ4

A
71kg swimmer climbs onto a Styrofoam block whose density is
160kg/m^3. If the styrofoam block sinks so that its top surface
aligns with the free surface level of water. What is the block’s
volume?

Answers

The volume of the Styrofoam block is approximately 0.44375 cubic meters.

To calculate the volume of the Styrofoam block, we can use the relationship between density, mass, and volume.

The density of the Styrofoam block is given as 160 kg/m^3. The mass of the swimmer is 71 kg.

Density = Mass / Volume

Rearranging the formula, we can solve for volume:

Volume = Mass / Density

Volume = \(71 kg / 160 kg/m^3\)

Volume ≈ \(0.44375 m^3\)

Therefore, the volume of the Styrofoam block is approximately 0.44375 cubic meters.

It's worth noting that in this scenario, the Styrofoam block is buoyant in water, allowing the swimmer to float. The block displaces an amount of water equal to its own weight, which balances the weight of the swimmer, resulting in equilibrium.

To know more about Styrofoam refer here:

https://brainly.com/question/30426194#

#SPJ11

Other Questions
5'-CGACACCGTTTCCAGCGCTCGAGCCACGCGAAGCTTCAGTCGCTGTGTCTCGAAG3'-GCTGTGGCAAAGGTCGCGAGCTCGGTGCGCTTCGAAGTCAGCGACACAGAGCTTCCGCACTACCACGAAGCGGAGCGCCTCCGCCGTCGCCCGCTTGGCCCCGTCGACAAGCGTGATGGTGCTTCGCCTCGCGGAGGCGGCAGCGGGCGAACCGGGGCAGCTGTTGTACCCCGTGAGGAAGAAGTTCCCTCTGCCGAGCACTATTTAGCAGTCCGAACAG-3'CATGGGGCACTCCTTCTTCAAGGGAGACGGCTCGTGATAAATCGTCAGGCTTGTC-5'1. Underline a 20-nucleotide target DNA sequence in the top (5 to 3) strand of the sequence above. Remember that this sequence should be directly upstream (on the 5 end) of a PAM sequence (5-NGG-3, where N stands for any of the four bases).2. Highlight the PAM sequence that is next to your target DNA sequence. This is where Cas9 will bind. although a strong romantic relationship benefits a couples happiness, research shows that loneliness can be experienced if time spent with friends is curtailed or eliminated. In the context of economic interdependence, identify a true statement about globalization. a. Companies may decide to expand globally as a strategy to reduce costs by finding cheaper labor in developing countries. b.France, Germany, and Switzerland top the list for hosting the most multinational enterprises. c. Most multinational enterprises have ensured that their foreign factories adhere to high human resource standards. d. Countries such as Cuba and Zimbabwe offer continuity and consistency for global firms because of the countries' stable legal and political systems. An aqueous solution that has a hydrogen ion concentration of 1.0 x 10^-8 mole per liter has a pH of 1) 6, which is basic 2) 6, which is acidic 3) 8, which is basic4) 8, which is acidic Living things are ordered,and can get more complex as they grow.Do we thereforedefy the second law of thermodynamics? How does a diagram show a rock cycle?. What are two ways leaves help a plant survive?O A. They produce seeds that allow the plant to reproduce itself.B. They have tissues that absorb water and minerals from the soil.C. They make food for the plant using sunlight and carbon dioxide.D. They have specialized cells that allow the plant to exchangegases with air. The domain of the function f(x) is the set of integers greater than -5. Which of the following values represent elements of the range of f? Answer choices below. What elements are typically required in a physicians medical report to process a disability income insurance claim? determine whether rolle's theorem can be applied to f on the closed interval [a, b]. (select all that apply.) f(x) Using the information in the chart above, is is possible for these two dogs to produce an offspring that is small? When reading mutual fund quotations, the ________ is the price per share.A. NAV (Net Asset Value)B. PSV (Per Share Value)C. MFV (Mutual Fund Value)D. PAV (Partial Asset Value) what has roots that no one sees is taller than trees yet never grows market equilibrium occurs when question content area bottom part 1 a. other things remain the same. b. the quantity demanded equals the quantity supplied. c. everyone who wants the good gets the quantity he or she wants. d. the market is changing rapidly. e. buyers get the lowest possible price. Consider the following parametric equations.x=t+3,y=4t;0t16a. Eliminate the parameter to obtain an equation inxandy. b. Describe the curve and indicate the positive orientation. a. Eliminate the parameter to obtain an equation inxandy. (Type an equation.) b. Choose the correct answer below. A. The curve is a line going up and to the right astincreases. B. The curve is a line going down and to the left astincreases. C. The curve is a parabola that opens downward. D. The curve is a parabola that opens upward. I will make you as brainliest please give me 5 hardest questions about balance of nature according to the syllabus of class 8. HURRY UP PLEASE Mr Louis thinks there are irregularities in the payroll system, and orders an inspection of a random sample of vouchers issued since January 1, 2006. A sample of ten vouchers is randomly selected, without replacement, from the population of 2,000 vouchers. Each voucher in the sample is examined for errors and the number of vouchers in the sample with errors is denoted by x. If 20% of the population of vouchers contains errors, the mean value of x isa) 400b) 2c) 200d) 5e) I If average inventory is $5 million and annual sales is $55 million, what is the inventory turnover rate?a. $5 million dollars per yearb. $55 dollars per yearc. 5 times per yeard. 11 times per year Please, help me ,,,,,,,,,,,,,,, The renowned philosopher who lived and worked in the greek city of alexandria in the fifth century was?