Given the genotype yyrr what are all of the possible allele combinations that could be passed along to the offspring due to independent assortment?.

Answers

Answer 1

The possible allelic combinations that could be passed along to the offspring due to independent assortment is (yr) only. As, the organism is homozygous recessive for both the genes.

What is Genotype?

The genotype of an organism is the complete set of genetic material. Genotype of an organism can also be used to refer to the alleles or variants an individual carries in a particular gene or genetic location.

The number of alleles an individual can have in a specific gene depends on the number of copies of each chromosome present in that species, which is also referred as ploidy. For example, humans are diploid organisms.

The genotype of an organism is (yyrr) as this organism produced organisms due to independent assortment, the alleles assort from each other. The organism is homozygous recessive for both the genes therefore, the offspring produced will have only single combination which is (yr).

Learn more about Genotype here:

https://brainly.com/question/12116830

#SPJ1


Related Questions

In order to perform a soil microbial count on a sample of soil, you made an initial dilution by mixing 0.1g of soil in 10ml of sterile water then performed a serial dilution. You performed two additional 1:10 dilutions and plated 10 ul of the last two dilutions. By adding 0.1g of soil to 10ml of water, you generated a __initial dilution Which plate counts indicate improper technique took place during your dilution series? Choose a CORRECT answer for BOTH of the statements above
A. You generated a 10-2 initial dilution. Plate counts 171 and 25
B. You generated a 102 initial dilution. Plate counts 165 and 16
C.You generated a 10-initial dilution. Plate counts 252 and 25
D. You gerverated a 10-initial dilution Plate counts 312 and 29
E. You generated a 10-3 initial dilution Plate counts 111 and 11 

Answers

The correct answer is B. The student generated a 102 initial dilution, and plate counts 165 and 16 indicate that improper technique took place during the dilution series.

To determine the initial dilution, we need to look at the dilution factor of the last two plates. The last two plates were both 1:10 dilutions, which means that they were both diluted by a factor of 10. Therefore, the initial dilution was 10 x 10 x 10 = 10^3 or 1000.

This means that the student added 0.1g of soil to 100ml of sterile water to make the initial dilution. Therefore, answer choices A, C, D, and E are all incorrect because they list incorrect initial dilutions. Only answer choice B lists the correct initial dilution of 10^2, but we also need to consider the plate counts.

Plate counts are the number of colonies that grow on the agar plates, and they can indicate whether there was too much or too little bacteria in the sample. Plate counts that are too high or too low can indicate that the student made a mistake during the dilution series.

In this case, the plate counts are 165 and 16, which is a difference of 10-fold. This means that there was a problem with the dilution series because there should not be such a large difference in the number of colonies between two consecutive dilutions. Therefore, we can conclude that improper technique took place during the dilution series.

To know more about initial dilution, refer here:

https://brainly.com/question/13386994#

#SPJ11

UN says ozone layer slowly healing, hole to mend by 2066


Please write a summary only (7-10) sentences about this article, please i need the answer in the next 10 min but the sooner the better.

UN says ozone layer slowly healing, hole to mend by 2066Please write a summary only (7-10) sentences
UN says ozone layer slowly healing, hole to mend by 2066Please write a summary only (7-10) sentences
UN says ozone layer slowly healing, hole to mend by 2066Please write a summary only (7-10) sentences

Answers

The summary writeup regarding what UN says ozone layer slowly healing, hole to mend by 2066 is given below

What is the ozone layer  about?

The United Nations has announced that the hole in the ozone layer is slowly healing and is projected to be completely mended by 2066.

This is largely due to the success of the 1987 Montreal Protocol, which regulated the production and consumption of ozone-depleting substances such as chlorofluorocarbons (CFCs).

While the healing process is still in progress and there is still a long way to go, the fact that the hole in the ozone layer is shrinking is a positive sign that international efforts to protect the ozone layer are working.

However, the report also warns of new threats to the ozone layer, including increasing emissions of greenhouse gases and the potential use of new ozone-depleting substances. Despite this progress, the UN says more action is needed to protect the ozone layer and address other environmental challenges.

The healing of the ozone layer is a result of the global efforts to phase out ozone-depleting substances such as CFCs, halons, and methyl bromide through the Montreal Protocol.

These substances were widely used in refrigeration, air conditioning, and industrial processes. The phasing out of these substances has led to a decrease in their atmospheric concentrations, which in turn has led to a decrease in the rate of ozone depletion.

The Antarctic ozone hole, which forms annually during the Southern Hemisphere's spring, has also shown signs of recovery. The size of the hole has been gradually decreasing since 2000, and is expected to return to 1980 levels by the 2060s.

Overall, the healing of the ozone layer is a testament to the success of international cooperation and the effectiveness of the Montreal Protocol in protecting the planet and all its inhabitants. But it's important to note that this is not the end of the story and we need to continue our effort to protect the ozone layer and address other environmental challenges.

Learn more about ozone  from

https://brainly.com/question/29795386

#SPJ1

based on prior experiments, you have determined that for a culture of s. aureus an absorbance reading of 1.0 au650 is approximately equal to 4.75 x 106 cells/ml. how many cells should be present after 9 generations in a 1 ml culture, if the initial cell culture had an absorbance reading of 0.75?

Answers

The number of cells that should be present after 9 generations in 1 ml culture, if the initial cell culture has an absorbance reading of 0.75 is 290,000,000 cells/ml

To calculate the number of cells present after 9 generations in a 1ml culture with an initial absorbance reading of 0.75 AU650, you need to use the following formula:

Number of cells = (Initial cell count) x (2⁹)

Since you determined that an absorbance reading of 1.0 AU650 is approximately equal to 4.75 x 10⁶ cells/ml, we can calculate the initial cell count for a 0.75 AU650 absorbance reading to be:

Initial cell count = (4.75 x 10⁶) x (0.75) = 3.56 x 10⁶ cells/ml

After 9 generations in a 1ml culture, the number of cells should be:

Number of cells = (3.56 x 10⁶ x (2⁹) = 290,000,000 cells/ml

Therefore, the number of cells in the culture should be around 290,000,000 cells/ml after 9 generations.

Learn more about the number of cells at https://brainly.com/question/28560794

#SPJ11

Cellular structures and molecules vary greatly in size, number, and distribution.


a. True

b. False

Answers

(a.) The statement is True. Cellular structures and molecules do indeed vary greatly in size, number, and distribution. Cells are complex entities composed of various organelles, molecules, and macromolecules that carry out specific functions.

Indeed, the size, quantity, and distribution of cellular structures and molecules vary substantially. Cells are intricate structures made up of different organelles, chemicals, and macromolecules that perform specialized tasks. The size of these parts can vary greatly, from tiny molecules like ions or metabolites to enormous organelles like the nucleus or mitochondria. Depending on the cell type and its metabolic needs, the amount of these structures inside a cell can also change. Additionally, the arrangement of molecules and cellular components within a cell might be non-uniform, with some organelles being restricted to particular areas or compartments. Cellular biology is fundamentally characterized by the variation in the size, quantity, and distribution of cellular components.

To know more about cellular structure:

https://brainly.com/question/30626506

#SPJ4

waht is the plant in biology​

Answers

Answer: genes nucleus asexual clones

Explanation:

Brian is a forensic investigator studying a tool mark on a door jam. He has gone through the steps of collecting the tool mark evidence. Next, he searches for an item that might have made the tool marks. What steps should he take with suspected objects he finds?
Identify and describe the tool.
Compare the tool mark cast and the comparison cast under a microscope.
Photograph the tool.
Make a comparison cast of the tool.

Answers

Answer:

I got you my mans

Explanation:

Identify and Describe

vvvvvvvvvvvvvvvvvvv

Photograph

vvvvvvvvvvvvvvvvvvv

Make a comparison cast

vvvvvvvvvvvvvvvvvvv

Compare under a microscope

Make a separate drawing or use a felt-tip pen to present it with the proof. Numerous items with tool marks that come off with force entry can be submitted immediately. A portion of a window or door molding, a window or door sill, a latch, a bolt, a lock, or a doorknob are all included in this.

What forensic investigator studying a tool mark?

An item with a tool mark may occasionally be gathered as proof (e.g., a doorknob bearing marks from pliers is removed from the door and placed into evidence).

The examiner will use the comparison microscope to compare examine tool marks in a manner similar to how they are examined for bullets and cartridge cases.

The toolmark examiner will contrast the test mark's microscopic characteristics with the tool mark on the supporting documentation.

Therefore, Even if it is decided not to cast the tool markings, minor crime scenes should nonetheless have their tool marks photographed.

Learn more about forensic here:

https://brainly.com/question/13073221

#SPJ2

Should genetically modified salmon be used as food? Why or why not?

Answers

The salmon are safe to consume, the added DNA is safe for both the fish itself, & they grow more quickly as promised by the sponsor. The salmon can grow more quickly as a result.

What is DNA exactly?

Deoxyribonucleic acid, also known as DNA, is just the molecule that includes the genetic material necessary for an organism's growth and operation. The structure of DNA is a double helix, which is made up of two connected strands that loop around one another to mimic a twisted ladder.

DNA is it DNA or RNA?

RNA contains ribonucleic acidity, whereas DNA is complementary to the template strand. Despite the fact that both DNA and RNA contain specific genes, there are a lot of distinctions between the two.

To know more about DNA visit:

https://brainly.com/question/264225

#SPJ1

Plzzzz help

Write what the mRNA sequence would be if the second DNA letter in the sequence above
was deleted.

Answers

Answer:

Changes to short stretches of nucleotides are called gene-level mutations, because ... A deletion mutation occurs when a wrinkle forms on the DNA template strand and ... sequence with a different set of reading frames is transcribed to mRNA (b). ... can also lead to another type of mutation known as a frameshift mutation


Which option correctly classifies the plant in the following scenario?
The stem of a non-coniferous young plant is cut horizontally. Inside, the vascular bundles are arranged in rings around a central core.
O cotyledon
O dicot
O gymnosperm
O monocot

Answers

Answer:

b.) Dicot

Explanation:

The vascular bundles are in rings, which is a tell tale sign of a dicot plant. Monocot plants have scattered vascular bundles.

ASAP
How do products of photosynthesis compare to the reactants of respiration?

Answers

Answer:

Explanation:

Photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by-products and ATP is energy that is transformed from the process.

Hope This Helps

On the tables in the library __________ the many germs that have escaped in the hot breath of hardworking students.A. CrawlB. Either crawl or crawlsC. CrawlsD. Neither crawl nor crawls

Answers

On the tables in the library crawls the many germs that have escaped in the hot breath of hardworking students. The answer is: C.

The correct option is C because "crawls" agrees in subject-verb agreement with the plural noun "germs." In this sentence, we are referring to the germs as the subject, and since they are plural, the verb "crawls" is the appropriate form.

Option A, "Crawl," does not agree with the subject-verb agreement because it is in the singular form, which does not match the plural subject "germs." Option B, "Either crawl or crawls," is not necessary as it presents both singular and plural forms, but only the plural form is required for subject-verb agreement.

Option D, "Neither crawl nor crawls," is incorrect because it eliminates both singular and plural verb forms, which are needed to match the subject "germs."

Therefore, the correct option is C.

To know more about subject-verb agreement, refer here:
https://brainly.com/question/30491015
#SPJ11

when genes are linked, a few of the recombinant genotypes still occur in the offspring because of

Answers

When genes are linked, a few of the recombinant genotypes still occur in the offspring because of crossing over during meiosis. Crossing over is the exchange of genetic material between homologous chromosomes, which occurs during prophase I of meiosis.

This process can result in the formation of new combinations of alleles on the chromosomes that were previously linked. However, the frequency of recombinant genotypes is lower than the frequency of non-recombinant genotypes, as the closer the genes are located on the chromosome, the less likely they are to be separated by crossing over.

The distance between the linked genes and the frequency of crossing over determine the probability of recombinant genotypes occurring in the offspring.

Therefore, linked genes tend to be inherited together more often than not.

know more about meiosis click here:

https://brainly.com/question/29383386

#SPJ11

Describe how remote sensing can be used to estimate and compare NPP among ecosystems.

Answers

By monitoring the quantity of solar energy that is absorbed by vegetation and then transformed into biomass through photosynthesis, remote sensing can be used to assess and compare net primary production (NPP) among ecosystems.

What are the uses of remote sensing in managing ecosystems?

The distribution of forest ecosystems, global seasonal variations in plant productivity, and the three-dimensional (3D) structure of forests have all been mapped using remote sensing.

What are the basic productivity estimation techniques?

Water for which productivity is to be assessed is enclosed in sealed white and dark bottles (bottles painted dark so light would not enter). Primary productivity can be estimated by the amount of oxygen utilised by a volume of water in a defined amount of time.

To know more about photosynthesis visit:-

https://brainly.com/question/29764662

#SPJ1

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Answers

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

4. La secuencia de ADN que codifica para la síntesis de la hormona del crecimiento corresponde a un gen, puesto que: a) determina un fenotipo que se hereda de padres a hijos. b) es susceptible de mutación. c) presenta codones y anticodones. d) permite la síntesis de una hormona. e) se encuentra en el núcleo celular.

Answers

Answer:

Permite la sintesis de la hormona.

Explanation:

Para la sintesis de la hormona de crecimiento se necesita la presencia de una secuencia de bases nitrogenadas en el ADN.

Al ser expresados por medio de su traduccion por el ARNm se expresan los caracteres fenotipicos desarrollando la estimulacion de la liberacion de la hormona del crecimiento.

Esta hormona es la encargada de fomentar que el cartilago de crecimiento de los huesos largos y otras zonas del cuerpo se desarrollen y funcionen como centros proliferativos de celulas para desencadenar el desarrollo del humano en edades tempranas.

How does the use of hydroelectric energy compare to the use of coal?
a.
Hydroelectric energy is more commonly used than coal.
b.
Hydroelectric energy is associated with less waste production than coal.
c.
Hydroelectric energy has a larger environmental impact than coal use.
d.
Hydroelectric energy requires more land space than coal use.

Answers

Currently, Coal is widely used because it's cheaper.

hydroelectric energy is more expensive (to build) but it has much much less waste, and no carbon emissions unlike coal

rest options are false.

Answer:

B.) Hydroelectric energy is associated with less waste production than coal.

Explanation:

While coal produces ash, CO2, CO, NOx, SOx, and many other waste products, hydroelectric energy has no waste products and doesn't pollute the environment.

what experimental evidence provided the initial insights into the compositions of codons encoding specific amino acids? select the three correct answers. what experimental evidence provided the initial insights into the compositions of codons encoding specific amino acids?select the three correct answers. electron microscopy studies of resulting polypeptides studies on homopolymer rna s introduced into an in vitro system studies on heteropolymer rna introduced into an in vivo system studies on homopolymer rna s introduced into an in vivo system assays of the relative amino acid composition of resulting polypeptides studies on heteropolymer rna s introduced into an in vitro system

Answers

Studies on homopolymer RNAs, heteropolymer RNAs, and assays of the relative amino acid composition of resulting polypeptides are the experimental evidence in its terms: Option B, C, and E.  

Studies on homopolymer RNAs introduced into an in vitro system, studies on heteropolymer RNAs introduced into an in vivo system, and assays of the relative amino acid composition of resulting polypeptides are the experimental evidence that first revealed the compositions of codons encoding specific amino acids.

They created proteins with multiple types of amino acids using synthetic RNAs that randomly combined two bases at various ratios. From these proteins, they were able to determine that the genetic code is triplet and to restrict the codon options for further amino acids. By 1966, Nirenberg's team had successfully deciphered every codon for an amino acid.

To know more about the experiment, refer:

https://brainly.com/question/25734857

#SPJ4

Correct question is:

What experimental evidence provided the initial insights into the compositions of codons encoding specific amino acids? select the three correct answers.

electron microscopy studies of resulting polypeptides

studies on homopolymer rna s introduced into an in vitro system

studies on heteropolymer rna introduced into an in vivo system

studies on homopolymer rna s introduced into an in vivo system

assays of the relative amino acid composition of resulting polypeptides

studies on heteropolymer rna s introduced into an in vitro system

gibberellin stimulates the production of α-amylase in germinating seeds, an enzyme that converts ______ into ______.

Answers

Germinating seeds. α-amylase is an enzyme that converts starch into glucose, which is a simple sugar that can be used by the growing plant for energy.

Gibberellin is a plant hormone that plays an important role in the growth and development of plants.

When a seed germinates, it starts to grow and develop into a seedling. In order to do this, it needs energy, which it obtains by breaking down its stored reserves of starch. α-amylase is the enzyme that is responsible for breaking down the starch into glucose, which can then be used by the growing plant.

Gibberellin stimulates the production of α-amylase by activating the genes that code for this enzyme. This allows the plant to rapidly break down its stored reserves of starch and obtain the energy it needs to grow and develop.

to know more about Gibberellin refer here:

https://brainly.com/question/20601611#

#SPJ11

Which of the following synovial joints does not have a concave or convex articulating surface?
A. Condyloid joint
B. Pivot joint
C. Gliding joint
D. Hinge joint

Answers

Answer: C

Explanation:

Gliding joint (source: trust me bro)

What is the name of the organelle where photosynthesis takes place

Answers

Answer:

chloroplasts!!!!!

NEED HELP

The lymphatic system is a network of tissues and organs and works closely with your immune system. It is made up of three parts; lymph, lymph vessels, and lymph nodes. Lymph is a fluid that contains white blood cells that defend against germs, and is produced by a combination of processes in your bone marrow and thymus. Lymph vessels (different from blood vessels) carry lymph throughout your body and drain fluids from tissues, along with collecting and transporting damaged cells and foreign particles. Lymph nodes are glands found throughout the lymph vessels, usually clustered where vessels branch off, such as in the neck and armpits. This is where white blood cells fight infection. The lymphatic system clears away infection and keeps your body fluids in balance. If it's not working properly, fluid builds up in your tissues and can cause swelling.

Research one of the lymphatic disorders listed below. Write a report on what the disorder is, what its symptoms are, who it can affect most, and what other issues it can cause. Make sure to cite your sources, and include statistics in a table or a graph based on information you found about your disorder.

Lymphedema
Lymphadenitis
Lymphangiosarcoma

Answers

I have researched Lymphedema for you.

Lymphedema is a chronic and progressive lymphatic disorder that occurs when there is an accumulation of protein-rich lymph fluid in the interstitial tissues. It is caused by a dysfunction in the lymphatic system, which can lead to swelling and fluid retention in affected areas. Lymphedema most commonly affects the limbs, but it can also occur in the head, neck, torso, and genitalia.

Symptoms of lymphedema can vary in severity and can include swelling, a feeling of heaviness or tightness in the affected area, restricted movement, skin changes such as thickening and hardening, and recurrent infections. These symptoms can significantly impact an individual's quality of life, making it challenging to perform daily activities such as walking or dressing themselves.

Lymphedema can affect anyone, but it is more common in women than men. It can develop at any age, but it most commonly occurs in individuals over the age of 40. There are two types of lymphedema: primary and secondary. Primary lymphedema is a rare genetic disorder that occurs due to an abnormal development of the lymphatic system. Secondary lymphedema is more common and occurs due to damage to the lymphatic system, often as a result of surgery, radiation therapy, infection, or trauma.

Lymphedema can lead to other issues such as cellulitis, lymphangitis, and lymphorrhea. Cellulitis is a bacterial skin infection that can occur due to the accumulation of lymph fluid, making it difficult for the body to fight off infections. Lymphangitis is a condition where the lymphatic vessels become inflamed and can cause fever and chills. Lymphorrhea is the leakage of lymph fluid through the skin, which can lead to skin breakdown and infection.

According to the National Lymphedema Network, an estimated 10 million Americans and 250 million people worldwide are affected by lymphedema. It is a chronic condition that currently has no cure, and treatment is focused on managing symptoms and preventing complications. Treatment can include manual lymphatic drainage, compression therapy, exercise, and skin care.

Sources:

National Lymphedema Network. (n.d.). What Is Lymphedema? Retrieved February 28, 2023, from https://lymphnet.org/resources/lymphedema-information/

Mayo Clinic. (2022, March 1). Lymphedema. Retrieved February 28, 2023, from https://www.mayoclinic.org/diseases-conditions/lymphedema/symptoms-causes/syc-20374682

bacterial dna containing an operon encoding three enzymes is introduced into chromosomal dna in yeast (a eukaryote) in such a way that it is properly flanked by a promoter and a transcriptional terminator. the bacterial dna is transcribed and the rna correctly processed, but only the protein nearest the promoter is produced. why?

Answers

The RNA transcript from the bacterial DNA will be capped at the 5′ end after normal eukaryotic processing. The translation initiation complex will form at the 5′ cap and travel along the mRNA until it reaches the first AUG codon, at which point translation will start.

The polypeptide is released when one of the termination codons is encountered. Because the Shine-Dalgarno sequences that come before them are not recognized by the eukaryotic translational machinery, translation of the downstream polypeptides cannot occur.

The bacterial chromosome is a single circular molecule that houses all of the DNA for the majority of bacteria. The chromosome joins a number of proteins and RNA molecules to form the nucleoid, an amorphous structure. This is located in the bacterial cell's cytoplasm.

learn more about bacterial DNA:

https://brainly.com/question/11884698

#SPJ4

cells introduction summary

Answers

Cells are the basic building blocks of life and are found in all living organisms. They are composed of organelles, which are specialized structures that perform different functions, such as providing energy, storing genetic information, and carrying out chemical reactions. Cells also contain a variety of molecules, such as proteins and lipids, which are responsible for the cell's structure and function. Understanding the structure and function of cells is essential to understanding how organisms function and interact with their environment.

An energy pyramid for a community is shown.
Blackbirds
100 J
Green plants
10,000 J
Hawk
10 J
Snails
1000 J
A scientist makes a claim that a pyramid of numbers for this community is
not necessarily the same shape as the energy pyramid. Which statement
provides evidence that supports this claim?
← PREVIOUS
0
Max

Answers

"The number of individuals at each trophic level does not necessarily reflect the amount of energy transferred."

What is the pyramid of numbers?

As you ascend the trophic levels of an energy pyramid, the energy level declines, creating a pyramid-shaped structure. The quantity of people in each trophic level, however, might not follow the same pattern. Even though they receive more energy, trophic levels higher than theirs can nonetheless contain fewer individuals.

In the given energy pyramid example:

Blackbirds: 100 J

Green plants: 10,000 J

Hawk: 10 J

Snails: 1000 J

Therefore, the number of individuals in the community may not align with the shape of the energy pyramid.

Learn more about pyramid of numbers:https://brainly.com/question/1217901

#SPJ1

When does a recessive trait show up for a female?


A. When there are two recessive alleles present

B. When there are two dominant alleles present

C. When there is one recessive allele present

D. When there is one dominant allele present

Answers

Answer:

A. When there are two recessive alleles present.

Explanation:

The only way for a recessive trait to manifest is for there to be 2 alleles for that trait.

Answer:

a

Explanation:

if the individual has two copies of the allege

what would happen to animal and plant cell in an
A isotonic solution

B Hypotonic solution

C Hypertonic solution

Answers

Answer:

A:in isotonic solution both cells remain of same size.

B:in hypotonic solution , both cells will expand in size but due to the rigid plant cell wall it will not be able to expand to the degrees of an animal cell.

C:in hypertonic solutions , both cells will shrink in size

Explanation:

hypotonic solutions means that the osmolarity is less than that of the cellular cytoplasm(like less salt in water than that of cytoplasm), so water moves from low concentration(the solution with less salt) to high concentration(the solution with more salt). Therefore in case of hypotonic water moves from surrounding solution to inside of cell thus expanding the size.

Vice versa is true for hypertonic solution.

So just remember water moves from low concentration of solute(salt) to high concentration.

*content in brackets is for better understanding

What information from the client would support the diagnosis of guillain-barré syndrome?

Answers

The most patients with typical GBS present with rapidly progressive bilateral leg weakness with hypo/areflexia in the affected limbs. In rare cases, patients can present with facial, oculomotor, bulbar, i.e. difficulty with swallowing and speaking, weakness, or primary sensory symptoms.

The clinical diagnosis of GBS needs to be confirmed by cerebrospinal fluid analysis and nerve conduction studies. Lumbar puncture is indicated in every case of suspected GBS.

The things to be monitor in Guillain-Barré syndrome (GBS) respiratory status of patients with GBS must therefore be carefully and frequently monitored. Pulse oximetry and blood gases are inadequate for early detection of failure because hypoxemia and hypercarbia are very late manifestations.

To learn more about Guillain-Barré syndrome here

https://brainly.com/question/11059760

#SPJ4

please i need help right now!

please i need help right now!

Answers

Oxygen buddy. Ahahahahaha

neurons can have processes as long as 3 feet in the nerves of the leg. explain how this structure relates to the function of nervous tissue.

Answers

Nerve cells are commonly very lengthy and branched in order that it allows the transmission of signals or electrical impulses over all parts of the frame.

Multipolar neurons are defined as having 3 or greater approaches that expand out from the cell frame. They incorporate greater than 99% of the neurons in people and are the important neuron type found in the CNS and the efferent department of the PNS.

The axon of 1 neuron connects to the dendrite of every other to shape a synapse, and that is how nerve indicators are transmitted from one neuron to the subsequent. Axons may be very long, with some human axons extending extra than three toes from the mobile body.

Their feature is to send electric impulses and chemical alerts to and from the mind. maximum neurons have 3 elements, inclusive of a mobile frame, which includes the nucleus and the cytoplasm, an axon, which transmits data far from the nucleus, and dendrites, which receive messages from other neurons.

Learn more about nervous tissue here:-https://brainly.com/question/869589

#SPJ4

An ecosystem will most likely remain stable if

Answers

Answer:

it preserved and resourcefully used

Answer: relationships between organisms and they must be dependent on one another.

Explanation: There must be balance between producers, consumers, .

Other Questions
Upon what grounds did white Americans justify the racialization of slavery?A) Black Africans were viewed as an inferior human subspeciesB) Racial pseudo-science offered a hierarchical view in which Africans were "below" whitesC) Biblical scripture was used to justify African slaveryD) All of the answers are correct Name two surface features that Ganymede appears to have in common with the Moon.In what ways are these features similar? In what ways must the origins of the features on Ganymede be different? For the following exercises, lines L1 and L2 are given. a. Verify whether lines L1 and L2 are parallel b. If the lines L1 and L2 are parallel, then find the distance between them. 255 LI : x = 1+t, y = t, z = 2 + t, t ER, L2 = x-3 = y-1 = z-3 Is my teacher allowed to kick us out of the meets and mark as absent if we don't come in even if cant How do you find percentages? Gaussion Elimination +X3 -7x6 X+ 17x +5x3 2x3 7x - 6x03 X2 x 4 X3 11 13 11 + X4 - 10x4 = 50 = 6Gaussian Eliminahan B Back sub + Xy - 7x x + 7x2 - + 5x3 2x3 6x3 7x2 x = Which extracellular matrix component is expressed in a cell-specific manner and binds to the tripeptide sequence Arg-Gly-Asp If f(x)=8x+16, then find f-1 (x) What are the two possible alleles for the fin gene in snurfles? what letters are used to represent them? The procedures that an emergency medical responder can and must legally provide as care for a patient are called? Which illustration represents the arrangement of particles in a gas? Find the 20th term for the following sequence: -2, 2, 6, 10, a firm's marketing research needs tends to remain the same throughout the product lifecycle. group of answer choices true false Which of the following terms refers to the automatic and sequential process of development that results from genetic signals?A. KinshipB. MaturationC. EnvironmentD. Reflexes Genes do not affect more than our physical characteristicsTrueFalse find the coordinates of the missing endpoint if b is the midpoint of ac C(-5,4) B(-2,5)step by step explanation thank you! a metal complex absorbs light mainly at 420 nm. what is the color of the complex? a metal complex absorbs light mainly at 420 nm. what is the color of the complex? yellow green purple red orange which type of network allows outside clients the ability to check dates and meetings securely? (5 points) intranet vlan wan extranet preventing liabilities is a business-related consequence of failed software. group startstrue or false true, selected false Identify structures found in fungi. Check all thatapply.produce sporescontain pseudopodscontain hyphaecontain a fruiting body.