Given the sequence ATGGCGAATCACGTCACTTGA
a) Write the sequence of nucleotides for the complementary strand of DNA.
b) Write the mRNA sequence transcribed from the complementary strand.
c) What is the tRNA sequence that would be used to translate this sequence?
d) Convert the message into an amino acid sequence.

Answers

Answer 1

Answer:

a. TACG

b.UAC CGC UUA GUG CAG UGA ACU

c.ATCG

d.ser-arg-leu-val-ser-stop-thr

Explanation:


Related Questions

URGENT !!! PLEASE HELP ME
Match the terms to the best description.
1. Hydrolysis
2. Monomer
3. Fatty acid
4. Polysaccharide
5. Starch
6. Glucose
7. Carbohydrate
8. Lipid
9. Dehydration Synthesis
10. Monosaccharide
11. Polymer
12. Glycogen
13. Phospholipid
a. A large molecule made up of linked monomers

b. C₂H₁2O6

c.An organic compound with C, H, and O in 1:2:1 ratio

d. A carbohydrate used to store short-term energy in animals

e. Monomer of carbohydrates; "one sugar"

f. Another term for carbohydrate; made of many monosaccharides

g. Reaction that breaks up a polymer into monomers by adding
water

h. A lipid that has a hydrophilic head and 2 hydrophobic tails that
make up biological membranes

i. Long, linear molecule made of mostly Cs & Hs; monomer of lipids

j. A single unit that can be linked together to make a polymer

k. A biomolecule used for long-term energy storage

l.A carbohydrate used to store short-term energy in plants

m. Reaction that links monomers into a polymer by removing
Water

Answers

Answer: A. polymer

B. glucose

C. carbohydrate

D. glycogen

E. monosaccharide

F. polysaccharide

G. hydrolysis

H. phospholipid

I. fatty acid

J. monomer

K. lipid

L. starch

M. dehydration synthesis

Explanation:

Mark the region of the ocean that represents the open ocean.

Mark the region of the ocean that represents the open ocean.

Answers

Answer:

The pelagic zone refers to open and free waters in the body of the ocean that stretch between the ocean surface and the ocean bottom and are not too close to some boundary, like a shore or the seafloor or the surface.

Explanation:

The open ocean lies over the continental shelf. The seafloor exists not contained in the open ocean. Therefore, the Red circle in the image exists as the correct answer.

What is an open ocean?

The pelagic zone, also understood as the open ocean exists in the area of the ocean outside of coastal areas. The pelagic zone consists of the water column of the open ocean and can be further separated into regions by depth. The word pelagic exists derived from Ancient Greek 'open sea'. The pelagic zone can be thought of as a designed cylinder or water column between the surface of the sea and the bottom.

Therefore, the red circle stands for the open ocean.

To learn more about open ocean,refer to:

https://brainly.com/question/1449128

#SPJ2

Restriction enzymes: A) act at the membrane to restrict the passage of certain molecules into the cell. B) are highly specialized ribonucleases that degrade mRNA soon after its synthesis. C) are sequence-specific DNA endonucleases. D) are very specific proteases that cleave peptides at only certain sequences. E) catalyze the addition of a certain amino acid to a specific tRNA. c The biological role of restriction enzymes is to: A) aid recombinant DNA research. B) degrade foreign DNA that enters a bacterium. C) make bacteria resistant to antibiotics. D) restrict the damage to DNA by ultraviolet light. E) restrict the size of DNA in certain bacteria.

Answers

Answer:

C) are sequence-specific DNA endonucleases

Explanation:

Restriction enzymes represent a type enzyme capable of recognizing short nucleotide sequences to cut at specific restriction sites in the DNA, these sites are known as target DNA sequences. Some of the most commonly used restriction enzymes are EcoRI, BamHI and HindIII, isolated from Escherichia coli, Bacillus amyloliquefaciens and Haemophilus influenza, respectively. Restriction enzymes are endonucleases because these enzymes only cleave the phosphodiester bond within the DNA chain, conversely to exonucleases, which cleave nucleotides from the end of the polynucleotide DNA strand.

Can someone help me with this please

Can someone help me with this please

Answers

What is it? It’s not a question. Tell me what it’s supposed to be and I will help.

what is the role that humans play in artificial selection

Answers

Answer is there options if not then i think it would be so then they can reproduce for offsprings to greater the population.

Explanation:

pls mark brainlies

HAPPY NEW YEARS !!! CAN SOMEONE PLEASEEEE HELP ME WITH THIS SCIENCE QUESTION I WILL MARK YOU BRAINLIEST !!!

HAPPY NEW YEARS !!! CAN SOMEONE PLEASEEEE HELP ME WITH THIS SCIENCE QUESTION I WILL MARK YOU BRAINLIEST

Answers

Answer:

The answer is c

Explanation: as you can see, the answer should be a decimal and there is a decimal inside the question, so as you can see its 0.37 so you would have two numbers behind the decimal so your answer would be C 18.91.

differents parts of a nephron in order

Answers

Answer:  1) Proximal Convoluted Tubule. 2) Loop of Henle. 3) Distal Convoluted Tubule. 4) Collecting Tubule. 5) Collecting Duct

Explanation:

Shredder
Scraper/Grazer
Filter Feeder
Invertebrate Predator
Vertebrate Predator
IIIII
:: Filter water to consume phytoplankton (microalgae) :: Consume leaves and algae and fungi on the leaf surface
:: Consume algae on rocks :: Prey on vertebrates and invertebrates :: Prey on small invertebrates


Match the organism to its proper feeding behavior

Answers

Explanation:

The first organism is a Filter Feeder, which filters water to consume phytoplankton (microalgae).

The second organism is a Scraper/Grazer, which consumes leaves and algae and fungi on the leaf surface.

The third organism is a Shredder, which consumes algae on rocks.

The fourth organism is an Invertebrate Predator, which preys on small invertebrates.

The fifth organism is a Vertebrate Predator, which preys on vertebrates and invertebrates.

When jaw become large enough to hold the permanent teeth . The milk teeth fall and permanent teeth appear

Answers

The "exfoliation" or "shedding" of milk teeth is the name of the procedure.

What is the Dentition of Humans?

The primary and permanent tooth sets make up the human dentition. Maxillary (upper) and Mandibular (lower) are the two opposing arches in which teeth are arranged. These can be split into their left and right halves along the midline (mid-sagittal plane).

Four Different Teeth Types and Their Purposes

The majority of individuals have 32 permanent adult teeth, which can be classified into four groups:

Incisors, Canines, Premolars, and Molars.

Learn more about Dentition here:

https://brainly.com/question/12410041

#SPJ1

HIV can paralyses the immune system of a person infected by the virus.
Explain why.​

Answers

Explanation:HIV attacks a specific type of immune system cell in the body. It's known as the CD4 helper cell or T cell. When HIV destroys this cell, it becomes harder for the body to fight off other infections. When HIV is left untreated, even a minor infection such as a cold can be much more severe.

Because HIV can hide inside of cells

The diffrence of a number and 4 thirds 11 thirds. What is the number?

Answers

For the word problem, If the difference of a number and the fraction \(\frac{4}{3}\) is \(\frac{11}{3}\), then the number is 5.

How do we solve for the number?

The above mathematical problem is a word problem. Word problems are problems that are written in words, rather than in symbols.

To solve for the difference or mystery number, we say, Let x be the number.

The problem states that x -  \(\frac{4}{3}\) =  \(\frac{11}{3}\),

movin -  \(\frac{4}{3}\) to the other side of the equation,

we get x = \(\frac{11}{3}\) + \(\frac{4}{3}\) = \(\frac{15}{3}\)

We solve the fraction by dividing 15 by 3

\(\frac{15}{3}\) = 5

Find more exercises on word problem;

https://brainly.com/question/29027588

#SPJ1

Please help!!

Why doesn't cloud formation take
place until the dew-point temperature is
reached?

Answers

Answer:

Clouds form when air reaches its dew point, the temperature when the air is saturated. This can happen in two ways. First, the air temperature can stay the same while the humidity increases. This is common in locations that are warm and humid.

Explanation:

Answer: The moisture in the cloud affects the weather.

Explanation:

thats why

Why can some medicines be absorbed through the skin?

Answers

Answer:

Explanation:

Some medication can be absorbed through the skin as the skin or mucous membranes allow it to enter through the body. Most drug absorbtion occurs between cells by passing through sweat pores and hair follicles, making it transcellular. Thus, topical medication is able to be absorbed through the skin due to pores and hair follicles.

Photosynthesis does not occur in deep water because

O The water temperature is too cold O There is no sunlight.
O There are not enough nutrients
O The salinity level of the water is too high​

Answers

Answer:

The salinity level is too high....

the increase of algae in a body of water
due to fertilizer runoff is called
O reclamation
O desertification
O eutrophication
O preservation

Answers

I think it’s Eutrophication because when I did a test with that question I got it right

if jeff is walking 2 mph, how far will he be able to travel in 30 minutes

Answers

1 mile.

Since he walks at a speed of 2 miles per hour, he will have only walked 1 mile after walking for half of an hour.

what is photosynthesis​

Answers

Answer:

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's activities.

Explanation:

I hope this helps!

Answer:

Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar.

Explanation:


I hope it helps! Have a great day!

Lilac~

After being chased by zombies, T-Dog is finally able to use the restroom and eat the food they found the abandoned house. His _ nervous system is responsible for making this happen
A. Somatic
B. Parasympathetic
C. Autonomic
D. Sypathetic

Answers

The nervous system that is at work in the T-dog here is the sympathetic nervous system.(Option D)

What is the nervous system?

The nervous system is able to control the actions of an organism by the release of electrical impulses. The sympathetic nervous system is under conscious control while the Parasympathetic nervous system is not under conscious control.

Thus, the nervous system that is at work in the T-dog here is the sympathetic nervous system.

Learn more about nervous system:https://brainly.com/question/13487019

#SPJ1

The same agriculture practices are used in every country around the world

Answers

The statement is not accurate. Agriculture practices can vary significantly from country to country due to various factors such as climate, geography, cultural traditions, available resources, and technological advancements.

Different regions have different agricultural practices and techniques based on their specific needs and conditions. For example, countries with arid climates may employ irrigation systems and drought-resistant crops, while those with abundant rainfall may focus on different cultivation methods. Additionally, cultural and traditional practices can influence agricultural techniques, as certain communities may have specific approaches to farming based on their heritage and local customs.

Moreover, advancements in technology and scientific research have led to the development of new agricultural practices, such as precision farming, vertical farming, and hydroponics. These practices aim to increase efficiency, productivity, and sustainability in agriculture, and they may be adopted to varying degrees in different countries based on factors like infrastructure, investment, and government policies.

In summary, agriculture practices are not the same in every country around the world. They vary depending on factors such as climate, geography, cultural traditions, available resources, and technological advancements. The diversity of agriculture practices reflects the adaptability and customization required to meet the specific needs of different regions and communities.

For more such answers on Agriculture

https://brainly.com/question/30176912

#SPJ8

A mother should do all of the following EXCEPT:
A. avoid gaining over 35 pounds
B. avoid alcohol
C. avoid smoking
D. increase calorie intake by 500 calorie to support the unborn fetus

Answers

Answer:

D. increase calorie intake by 500 calorie to support the unborn fetus

Explanation:

The first 3 a mother MUST avoid, or it could harm the fetus.

Hope this helps :)

One thing that a prospective mother should not do is to D. increase calorie intake by 500 calories to support the unborn fetus.

What should a pregnant woman do?

In order to protect the fetus, a mother should avoid alcohol and smoking as well as gaining weight over 35 pounds.

To avoid gaining this weight, the mother should not increase her calorie intake by 500 or more calories as this might cause complications.

Find out more on recommended pregnancy behavior at https://brainly.com/question/11668616.

#SPJ6

The R and S loci are 35 m.u. apart. If a plant of genotype is selfed, what progeny phenotypes will be seen and in what proportions

Answers

Complete question:

The R and S loci are 35 m.u. apart. If a plant of genotype RS/rs is selfed, what progeny phenotypes will be seen and in what proportions

Answer:

R-/S- = 0.6052 R-/ss = 0.1443rr/S- = 0.1443rr/ss = 0.1056

Explanation:

Available data:

R-S are 35 mu apartCross: RS/rs   x   RS/rs

First, we need to recognize the parental gametes and the recombinant ones.

Cross:

Parentals)     RS/rs    x      RS/rs

Gametes) RS  Parental   ⇒  Equal to the parental genotype

                 rs   Parental   ⇒  Equal to the parental genotype

                 Rs  Recombinant   ⇒  Product of recombination

                 rS   Recombinant   ⇒  Product of recombination

We know that genes are 35 MU apart from each other. The map unit is the distance between the pair of genes for which every 100 meiotic products, one of them results in a recombinant one.  

To calculate the recombination frequency, we have to know that 1% of recombinations = 1 map unit = 1cm. And that the maximum recombination frequency is always 50%.  

According to this information, if 1 MU = 1% recombination frequency, then

35MU --------- 35% recombination frequency = 0.35

Now, let us calculate the frequency of each gamete type.

35 map units = 35 % of recombination in total  

                      = % Rs + % rS  

                      = 17.5% Rs + 17.5% rS

Now, if the recombination frequency equals 35% then the parental frequency is 100% - 35% = 65%

65 % parental frequency = % of RS + % rs  

                                          = 32.5% RS + 32.5% rs

The frequency of each gamete is

RS  ⇒ Parental  ⇒  32.5% (65% / 2) = 0.325rs  ⇒ Parental ⇒ 32.5% (65% / 2) = 0.325Rs  ⇒ Recombinant  ⇒ 17.5% (35% / 2) = 0.175rS  ⇒  Recombinant ⇒  17.5% (35% / 2) = 0.175

F1 Genotypes and Proportions

RS/RS = 0.325 x 0.325 = 0.1056     RS/Rs = 2x 0.325 x 0.175 = 0.1137RS/rS = 2x 0.325 x 0.175 =0.1137   rs/rs = 0.325 x 0.325 = 0.10562rs/RS = 2x 0.325 x 0.325 = 0.2112rs/Rs = 2x 0.325 x 0.175 = 0.1137rs/rS = 2x 0.325 x 0.175 = 0.1137Rs/rS = 2x 0.175 x 0.175 = 0.061Rs/Rs = 0.175 x 0.175 = 0.0306rS/rS = 0.175 x 0.175 = 0.0306

F1 Phenotypes and Proportions

R-/S- = 0.1056 + 0.1137 + 0.1137 + 0.2112 + 0.061 = 0.6052 R-/ss = 0.1137 + 0.0306 = 0.1443rr/S- = 0.1137 + 0.0306 = 0.1443rr/ss = 0.1056

If R and S loci are 35 m.u. apart and a plant of genotype RS/rs is selfed, then the progeny phenotypes will be 0.606 RS; 0.106 rs; 0.144 Rs and 0.144 rS.

In this case, it is imperative to estimate gamete frequencies

RS = 0.65% / 2 = 0.325rs  = 0.65% / 2 = 0.325Rs  (recombinant) = 0.35 / 2 = 0.175rS (recombinant) = 0.35 / 2 = 0.175

In consequence, the F1 genotypes will be RS/RS = 0.1056  (i.e., 0.325 x 0.325); RS/Rs = 0.1137; RS/rS = 0.1137; rs/rs = 0.10562; rs/RS = 0.2112; rs/Rs = 0.1137; rs/rS = 0.1137; Rs/rS = 0.06; Rs/Rs = 0.0306; and rS/rS = 0.0306.

Finally, it is possible to obtain phenotypic frequencies by summing genotypic frequencies for each case in particular.

In conclusion, if R and S loci are 35 m.u. apart and a plant of genotype RS/rs is selfed, then the progeny phenotypes will be 0.606 RS; 0.106 rs; 0.144 Rs and 0.144 rS.

Learn more in:

https://brainly.com/question/24174095

Can you help me pick out these two answers for the questions using the cladogram please will mark brainlist and my AI can’t answer this question pleaseeee

Can you help me pick out these two answers for the questions using the cladogram please will mark brainlist

Answers

The amniotic egg is a trait that separates amphibians from primates. The trait that separates rabbits and primates from crocodiles is eggs with shells. Rabbits and primates are mammals while crocodiles are reptiles.

The Amphibians are cold-blooded animals that spend part of their lives on land and some part in water. The primates on the other hand are warm-blooded animals and they produce milk(mammals). Species of monkeys, apes, and lemurs are some of the examples of primates.

The trait that is common in primates and rabbits is the presence of hair. The crocodiles on the other hand are different from them as they lay hard-shelled eggs which protect the inner portion of the egg and also allow gaseous exchange.

To learn more about primates refer to the link:

https://brainly.com/question/29031326

#SPJ1

A cell where there is only one set of chromosomes

Answers

Answer:

A haploid cell has only a single set of chromosomes

Explanation:

please mark as brainliest

Which organelle begins to form in phase 4 of the process in figure 1

Answers

Answer:

2

Explanation:

I think because 2 is a even number and if you count by 2 ×2 it'll be 4

A botanist wanted to see if a new strain of corn could germinate in soil that was too salty for regular corn. She conducted a study on the germination success of seeds from the new strain that were exposed to various levels of salty soil, from zero to normal (100 mg/L), high (200 mg/L), very high (400 mg/L), to normally lethal (800 mg/L). The table below shows her data for this study.
Write a formal hypothesis for this study.
Does her data support or reject the hypothesis? Explain your reasoning.

A botanist wanted to see if a new strain of corn could germinate in soil that was too salty for regular

Answers

Formal hypothesis: The new strain of corn can germinate in soil with higher salt concentrations than regular corn.

The data from the study shows that the new strain of corn has a higher germination success rate than regular corn in soil with increasing salt concentrations. At normal salt concentration (100 mg/L), the germination rate for both the new and regular corn strains was high, with 90% of seeds germinating. At higher salt concentrations of 200 mg/L and 400 mg/L, the new strain of corn still showed a relatively high germination rate of 90% and 55%, respectively, while the regular corn strain had a lower germination rate of 90% and 35%, respectively.

Even at the highest salt concentration tested (800 mg/L), some seeds from the new strain of corn were able to germinate, although the percentage was not reported. Therefore, the data supports the hypothesis that the new strain of corn can germinate in soil with higher salt concentrations than regular corn.

Expansion:

Plants require a certain amount of salt to grow and function properly, but too much salt can be harmful and even lethal to them. The ability to germinate and grow in soil with high salt concentrations is an important trait for plants, particularly in regions with high soil salinity.

The study conducted by the botanist aimed to assess whether a new strain of corn had this desirable trait. The data collected from the study supports the hypothesis that the new strain of corn can germinate in soil with higher salt concentrations than regular corn.

The fact that the new corn strain had a higher germination success rate than regular corn at higher salt concentrations suggests that it may have adaptations that allow it to tolerate salt stress more effectively. These adaptations could include mechanisms for excluding salt from the plant, or for storing salt in compartments that are less harmful to the plant.

Overall, the results of this study are promising for the potential use of the new strain of corn in regions with high soil salinity. However, further research is needed to determine whether the new strain of corn has other desirable properties, such as higher yields or better nutritional value, and to assess its performance in field conditions.

do you guys no what dose-response relationship means

Answers

It is the description of the magnitude of the response of an organism as a function of exposure to a stimulus or stressor after a certain exposure time. Hope this helps!

What is a lightyear?
A: It is the distance that light can travel in one year.
B: The distance between the Earth and the Sun
C: Distance between the Earth and the Moon
D: None of the above

Answers

Answer:

A) It is the distance that light can travel in one year

Explanation:

A lightyear is a measure of distance used for all light in space.

Answer:

A

Explanation:

note that a light year is a distance, not a time

Which of the following is NOT an example of a biological model? (all answers choices 2nd slide)

Which of the following is NOT an example of a biological model? (all answers choices 2nd slide)
Which of the following is NOT an example of a biological model? (all answers choices 2nd slide)

Answers

I think it’s the second choice, growth equations for population growth

Answer:

pictures of different ecosystems

Explanation:

i got it right

scientists discovered that the difference between blond and dark hair in humans and other mammals comes down in part to a single nucleotide difference in the dna sequence of an enhancer that lies more than 350,000 base pairs upstream from the coding region of the gene it controls. on average, blonds transcribe this gene less efficiently than people with dark hair. which of the following statements about this blond/dark hair enhancer is correct?

Answers

The enhancer is associated with a protein during transcription initiation, about  blond/dark hair enhancer is correct.

Deoxyribonucleic acid (DNA) is a polymer made from two polynucleotide chains that coil round each other to shape a double helix. The polymer consists of genetic commands for all recognised organisms and viruses' development, functioning, boom, and replica. Nucleic acids consist of DNA and ribonucleic acid.

At some point of replica, DNA and the commands it contains are exceeded from adult organisms to their offspring. DNA now serves three awesome capabilities: genetics, immunology, and shape, all of which rely upon the sugar phosphate spine and bases in one of a kind approaches. DNA consists of nucleotide molecules. each nucleotide contains a sugar, phosphate, and nitrogen base organization.

Learn more about Deoxyribonucleic acid here:-https://brainly.com/question/16099437

#SPJ4

Question 1 A heterozygous yellow-seeded plant is crossed with a homozygous yellow seeded plant. i. ii. Question 2 Complete the punnet square and write the genotypic and phenotypic ration for the possible offsprings. (3 marks) Genotypic ration Phenotypic ration What is the probability of having a pure breeding green seeded offsprings (2 marks) What is the probability of having a yellow-seeded plant in F2 generation, when a true breeder from F1 is crossed with a non-true breeding yellow seeded plant? (2 marks)​

Answers

Answer:

Explanation:

To solve this problem, let's represent the heterozygous yellow-seeded plant as "Yy" and the homozygous yellow-seeded plant as "YY."

i. When crossing a heterozygous yellow-seeded plant (Yy) with a homozygous yellow-seeded plant (YY), we can set up a Punnett square to determine the possible offspring genotypes:

    Y     Y

y   Yy  Yy

y   YY  YY

ii. The genotypic ratio is 2:2 or 1:1 for the possible offspring genotypes: Yy and YY.

The phenotypic ratio is also 2:2 or 1:1 for the possible offspring phenotypes: yellow-seeded (YY and Yy).

Question 2:

To determine the probability of specific outcomes, we need additional information about the parental genotypes and their inheritance patterns. Please provide the genotypes of the true breeder from F1 and the non-true breeding yellow-seeded plant for a more accurate calculation.

Other Questions
What are the types of Sampling Techniques in Statistics? A newborn is admitted to the nursery. The newborn weighs 10 lb, 2 oz (4592 g), which is 2 lb (907 g) more than the birthweight of any of the neonate's siblings. Which intervention should the nurse implement in relation to this baby's birth weight?1. Document the findings2. Delay starting oral feedings3. Perform serial glucose readings4. Place the newborn in a heated crib Write a function named find_tuple() that takes two_nums as the input, find the tuple with the smallest difference between the 2 elements, and returns it as the function output! Define and explain the main features and the differences between accounting profit and economic profit. Also, provide the meaning of normal profits. find all prepositions in the spy hide the top secret file inside the wall and then silently escaping c - (-3) = 15What is the answer? Fill in the blank/ The air/ water syringe is primarily used during the coronal polishing procedure to ___. When an organization produces only a single product and attempts to sell it to two or more different market segments, which costs may it incur?. The Bearing of X from Y is 35 Find the bearing of Y from X Using your knowledge of storytelling techniques and "An Occurrence at Owl Creek Bridge," answer the following question with the best answer possible.Section III can best be described as _____.a flash forwarda flashbackchronologicalnone of the above TRUE OR FALSE The time period of a simple pendulum does not depend upon mass, but depends, but depends on the size of the bob, because by increasing the size of the bob, the effective length of the pendulum increases How many molecules are contained 9.6 mol C2H4? Scientists are studying how the construction of a farm affects the biodiversity of insects in a forest. Before the farm was constructed, 186 insect species were present. The scientists find that after the farm was constructed, the number of insect species decreased by 4% per month. Based on this trend, which function could be used to calculate how many months, f(x), it will take for the number of insect species to reach a value of n? In this country 60% of their arable land is used for dairy farming Need help question #1. Show steps please how much should he charge for rent in order to bring in maximum revenue and how many units are rented then? in which type of market does no buyer or seller have much impact on setting the going market price? Name all of the kingdoms of living things, indicate how they relate to each other. what is the mass of an object if its weight on earth is 1150N WILL GIVE BRAINLIEST