Graduating seniors must present three projects as part of a major requirement and must select them from a list of 10 possible projects. In how many ways can this be done? a 120b 720 c other:

Answers

Answer 1

ANSWER

120 ways

EXPLANATION

We want to see how many ways 3 projects can be selected from 10 possible projects.

Since there is no particular order for the selection, we will use combinuation.

We have:

\(\begin{gathered} ^{10}C_3\text{ = }\frac{10!}{(10\text{ - 3)! 3!}} \\ \text{ = }\frac{10!}{7!\text{ 3!}} \\ =\text{ 120 ways} \end{gathered}\)

That is the answer.


Related Questions

A report about how American college students manage their finances includes data from a survey of college students. Each person in a representative sample of 793 college students was asked if they had one or more credit cards and if so, whether they paid their balance in full each month. There were 500 who paid in full each month. For this sample of 500 students, the sample mean credit card balance was reported to be $825. The sample standard deviation of the credit card balances for these 500 students was not reported, but for purposes of this exercise, suppose that it was $200. Is there convincing evidence that college students who pay their credit card balance in full each month have a mean balance that is lower than $905, the value reported for all college students with credit cards

Answers

Answer:

Yes. There is enough evidence to support the claim that college students who pay their credit card balance in full each month have a mean balance that is lower than $905.

Step-by-step explanation:

We want to test the claim that college students who pay their credit card balance in full each month have a mean balance that is lower than $905.

To perform this test we have a sample of 500 students which have paid their balance in full each month. The sample mean is $825 and the estimated sample deviation is considered $200.

Then, the null and alternative hypothesis are:

\(H_0: \mu=905\\\\H_a:\mu< 905\)

The significance level is 0.05.

The sample has a size n=500.

The sample mean is M=825.

The estimated standard error of the mean is computed using the formula:

\(s_M=\dfrac{s}{\sqrt{n}}=\dfrac{200}{\sqrt{500}}=8.94\)

Then, we can calculate the t-statistic as:

\(t=\dfrac{M-\mu}{s/\sqrt{n}}=\dfrac{825-905}{8.94}=\dfrac{-80}{8.94}=-8.94\)

The degrees of freedom for this sample size are:

\(df=n-1=500-1=499\)

This test is a left-tailed test, with 499 degrees of freedom and t=-8.94, so the P-value for this test is calculated as (using a t-table):

\(\text{P-value}=P(t<-8.94)=0\)

As the P-value (0) is smaller than the significance level (0.05), the effect is significant.

The null hypothesis is rejected.

There is enough evidence to support the claim that college students who pay their credit card balance in full each month have a mean balance that is lower than $905.

What is the answer of this triangle congruence question.

What is the answer of this triangle congruence question.

Answers

The value of x in the triangles are 9.

What is a quadratic equation?

For variable x : ax² + bx + c = 0, where a≠0 is a standard quadratic equation, which is a second-order polynomial equation in a single variable. It has at least one solution since it is a second-order polynomial equation, which is guaranteed by the algebraic basic theorem.

Given:

The triangles are congruent.

That means, their corresponding angles are also congruent.

In ΔJKL,

the sum of all the angles of the triangle is 180°.

So,

x²-2x + x + 29 + 3x + 52 = 180

x² + 2x - 99 = 0

Solving the quadratic equation,

x² +11x - 9x - 99 = 0.

x (x + 11) -9 (x + 11) = 0

x = 9 and x = -11

Here, we take x = 9.

Therefore, the value of x is 9.

To learn more about the quadratic equation;

https://brainly.com/question/17177510

#SPJ1

what is the equation of the line shown in the graph? -2,3 and 3,-3

what is the equation of the line shown in the graph? -2,3 and 3,-3

Answers

Answer:

y + 3 = 0

Step-by-step explanation:

Since, line is intersecting y axis at y = - 3

So y + 3 = 0 is the required equation of the line.

the square root of 50

Answers

Answer:

The square root of 50 is approximately 7.07.

Answer:

7.07106781187...

Step-by-step explanation:

its an irrational number

{HELP ASAP }WILL GIVE 50+ POINTS AND BRAINLIEST
which statements are correct steps in finding the linear equation of the line that passes through the points -1,7 and 2,4 using the point slope form method. select all that apply

Answers

Answer:

y = - x + 6

Step-by-step explanation:

\( point \: slope: y - y_{1} = m(x - x_{1})\)

as y is the y coordinate of the final point , y1 is the y coordinate of the initial point, m is the slope or gradient of the line, x is the x coordinate of the final point, and x1 is the x coordinate of the initial point.

given (-1,7) and (2,4). 7 = y1, 4 = y, -1 = x1, 2 = x.

when substituted into the equation the unknown variable is the slope which we are solving for.

y-y1=m(x-x1) ; y = 4, y1 = 7, x = 2, x1 = -1

(given)

4-7 = m(2--1)

(substitution property of equality)

-3 = m(2--1)

(subtraction property of equality)

-3 = m(3)

(subtraction property of equality)

-3 = 3m

(multiplication property)

-1 = m.

(division property of equality)

m = -1

(symmetric property of equality)

_____________________________

once m is solved you just need the initial values to solve for the actual equation.

y - y1 = m (x - x1) ; y1 = 7, m = -1, x1 = -1

(given)

y - 7 = -1 (x - -1)

(substitution property of equality)

y - 7 = -1 (x + 1)

(subtraction property if equality)

y - 7 = -x - 1

(distributive property of equality)

y = -x - 1 + 7

(addition property of equality)

y = -x + 6

(addition property of equality)

Answer:

get from (4,1) to (2,9) go up 8 and over 2 left (-2) - (4 - 2, 1 + 8), do this again (2 - 2, 9+8) and end up at (0,17) which is the y how do you change 7x+3y=3 into slope intercept form.

fjnjerng ertekjrtker terkjtkert ertkjrenktmermt erktnkermter

1302 rounded to the nearest thenth

Answers

Answer:

1300

Step-by-step explanation:

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

Answer: 1300 Is the answer! I hope this helped

Explanation:

I hope this helped!

<!> Brainliest is appreciated! <!>

- Zack Slocum

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

A deep-sea diver dives from the surface to 131 feet below the
surface and then swims up 8 feet, down 18 feet, down another
28 feet and then up 23 feet. Find the diver's depth after these
movements.​

Answers

Answer:

146 feet below the surface

Step-by-step explanation:

\(-131+8-18-28+23=-146\)

the point representing 0 on the real number line is the

Answers

The point representing 0 on the real number line is the origin.

A number line is a visual representation of a set of real numbers. It is a straight line that is usually represented horizontally and it has a starting point, usually labeled as 0, which is called the origin.

Numbers to the right of the origin are positive, and numbers to the left of the origin are negative. The numbers on a number line are evenly spaced, and each point on the line represents a specific real number.

Number lines are useful in mathematics to represent numerical relationships, such as order, magnitude, and distance between numbers. They are also useful in teaching mathematical concepts, such as addition, subtraction, and fractions.

Learn more about number line here: https://brainly.com/question/12399107

#SPJ4

help please!!!!!!!!!!

help please!!!!!!!!!!

Answers

Answer:

The interval from -12 to -7

The interval from 6 to 12.

Step-by-step explanation:

The equation is log(x + 9) + log(x 9) = log[(x + 9)(x 9)]. = log(x² − 81)

Here is the equation:

log(x² - 81) = 0.47712

This can be expressed in exponential form:

x² - 81 = 10^(0.47712)

x² = 81 + 3.02343

x² = 84.02343

x ≈ ± 9.1658

The answers are therefore x -9.1658 and x 9.1658.

These intervals are where these solutions occur:

The answer, x -9.1658, can be found in the range from -12 to -7.

- The answer x = 9.1658 is found in the range of 6 to 12.

The appropriate choices are:

- The range between -7 and -12; - The range between 6 and 12.

Drag the tiles to the correct boxes to complete the pairs. Not all tiles will be used. Match each division expression with the correct quotient. (These are the answers)
18x^(2)+39x+15 over 3x+5 -----> 6x+3
35x^(2)-5x-30 over 5x-5 -------> 7x+6
15x^(2)-44x+21 over 5x-3 ------> 3x-7

Answers

can you answer the question that it’s in blue please

Answer:

18x^(2)+39x+15 over 3x+5 -----> 6x+3

35x^(2)-5x-30 over 5x-5 -------> 7x+6

15x^(2)-44x+21 over 5x-3 ------> 3x-7

Step-by-step explanation:

Plato Gang

If 2x-y=9 and 3x+4y=19, then y=

Answers

Answer:

x = 5

y = 1

Step-by-step explanation:

2x - y = 9

3x + 4y = 19

We multiply the first equation by 4

8x - 4y = 36

3x + 4y = 19

11x = 55

x = 5

Now we put 5 in for x and solve for y

2(5) - y = 9

10 - y = 9

-y = -1

y = 1

Let's Check the answer

2(5) - 1 = 9

10 - 1 = 9

9 = 9

So, x = 5 and y = 1 is the correct answer.

what is the probability of 26/100 19/100 and 55/100

Answers

Answer:

1/3

Step-by-step explanation:

Hope this helps

Answer:

1/3

Step-by-step explanation:

E


Sally's savings account has $238 and she is withdrawing (taking money out) $17 each week to put gas in her car. How much money will Sally have after 5 weeks?

Answers

Answer:

$153

Step-by-step explanation:

The Correct Answer for this is 153$ Because you times 17 by 5 and subtract that from 238

a circular window with a diameter of 26 inches is being installed over a door. the wall with the dor and window is 18 feet high. the door is 80inches from the floor to the top of the dooor. what is the distance from the cieling to the top of the window?

Answers

Answer:

24 inches

Step-by-step explanation:

First, we need to convert the height of the wall to inches since the diameter of the window is given in inches:

18 feet = 18 x 12 inches = 216 inches

Next, we can find the distance from the floor to the top of the window by subtracting the height of the door from the height of the wall and then dividing by 2 (since the window will be centered above the door):

Distance from floor to top of window = (216 inches - 80 inches) / 2 = 68 inches

Finally, we can use the Pythagorean theorem to find the distance from the ceiling to the top of the window. We can consider the triangle formed by the height of the wall, the distance from the floor to the top of the door, and the distance from the floor to the top of the window. We can let x be the distance from the floor to the top of the window, then we have:

x^2 + 80^2 = 216^2

Simplifying this equation, we get:

x² = 216² - 80²

x² = 43,296 - 6,400

x² = 36,896

x = \(\sqrt{36,896}\) = 192 inches

Therefore, the distance from the ceiling to the top of the window is:

Distance from ceiling to top of window = 216 inches - 192 inches = 24 inches

So the distance from the ceiling to the top of the window is 24 inches.

help me please and thanks

help me please and thanks

Answers

Answer:

Equation: y = -2x

Solution: y = 12

Step-by-step explanation:

y varies directly as x, can be expressed by the equation, y = kx. Where, k = constant of proportionality.

Given that when x = 2, y = -4, to find the value of k, plug in the values of x and y into y = kx.

Thus:

-4 = k(2)

Divide both sides by 2

-4/2 = k

k = -2

To write the equation for the information given, substitute k = -2 into y = kx.

✔️Equation: y = -2x

✔️When x = -6,

y = -2x

Plug in the value of x

y = -2(-6)

y = 12

very easy 5th grade question giving brainliest. look at photo and answer

very easy 5th grade question giving brainliest. look at photo and answer

Answers

Answer: 20 over 4

Step-by-step explanation: me smart

The mass of Earth is 5.97 x 1024 kilograms, and the mass of Venus is 4.87 x 1024 kilograms. What is the difference between the mass of the two planets?
A 1.084 x 1025 kilograms
B 3.6 x 1025 kilograms
1.1 x 1024 kilograms
D 2.91 x 1024 kilograms
INT

Answers

Answer:

1126.4

Step-by-step explanation:

5.97 x 1024 =6113.28

4.87 x 1024=  4986.88

6113.28-4986.88 =1126.4

Which set of values could be the side length of a 30 60 90 triangle? A. {5,5v3,10}

Answers

Therefore, the answer is A. {5, 5√3, 10}.

The set of values {5, 5√3, 10} could be the side lengths of a 30-60-90 triangle.

In a 30-60-90 triangle, the sides are in a specific ratio. The ratio is 1 : √3 : 2, where the shortest side (opposite the 30-degree angle) has length x, the side opposite the 60-degree angle has length x√3, and the hypotenuse (opposite the 90-degree angle) has length 2x.

Let's check if the given set of values satisfies this ratio:

   If x= 5, then the side opposite the 60-degree angle should be 5√3, and the hypotenuse should be 10. These values match the ratio, so the set {5, 5√3, 10} could be the side lengths of a 30-60-90 triangle.

For such more question on lengths

https://brainly.com/question/28322552

#SPJ8

An equation is shown below: 5(3x − 15) + 16 = 5x + 11 Part A: Write the steps you will use to solve the equation, and explain each step. (8 points) Part B: What value of x makes the equation true? (2 points)

Answers

The result of the unknown variable x is equivalent to 7

Solving linear equations

Linear equations are equation that has a leading degree of 1. Given the expression below:

5(3x − 15) + 16 = 5x + 11

Expand the expression

5(3x) - 5(15) + 16 = 5x + 11

15x - 75 + 16 = 5x + 11

15x - 5x - 59 - 11 = 0

10x - 70 = 0

10x = 70

Divide both sides by 10

10x/10 = 70/10

x = 7

Hence the value of x makes the equation true is 7

Learn more on linear equation here: https://brainly.com/question/2030026

#SPJ1

slope of line (-3,-2) and (-1,-5)

Answers

Answer:

−3/2

Step-by-step explanation:

Hope this helps

:D

Question 8
Which number sentence shows a pattern of +6?
A
3 x 2 = 6
B
6 x 0 = 0
С
7x1=7
D
4x6 =24
How do I get the answer

Answers

i believe the answer is A

8.5 x 6.5 i need help with this question

Answers

Answer:

55.25

Step-by-step explanation:

So, all you gotta do is get rid of the decimal, times them both, then add the decimal back into it, and how you do that is you see how many numbers are behind a decimal point in the first place, in this case, it's two (8.5, 6.5) and you got your answer!

Hope this helps! <D

Find the value of x.
72 + 24x = 288

Answers

Answer:

X = 9

Step-by-step explanation:

1. Subtract 72 from both sides.

24x = 216

2. Divide 24 on both sides

x = 9

Answer:

X = 9

Step-by-step explanation:

We have to separate the like terms

72 + 24x = 288

24x = 288 - 72

24x = 216

We then divide both sides by 24

X = 9

15 clothespins are placed on a clothesline at 2-foot intervals. How far is it from the first clothespin to the last one? (Hint: Draw a Picture)

Answers

There are 28 units in total between the first and last clothespin.

What is distance?

The resulting displacement may be measured using the distance. It represents the distance between the two places. It may be measured using a variety of units, including meters and centimeters.

The specified parameter is shown as intervals in the query. The phrase can be written as follows:

There are 15 total clothespins.

The distance between clothing pegs is 2 feet.

No, the following is the distance from the initial location to the last one:

0 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 = 28 units

There are 28 units in total between the first and last clothespin.

To learn more about the distance from the given link:

https://brainly.com/question/23848540

#SPJ9

12. A plot of land is used to grow flowers. of the land is allocated for orchids. 2 After the orchids have been planted, of the remaining land is allocated for roses. After orchids and roses have been planted, 0.75 of the remaining land is allocated for tulips. What fraction of the plot of land is not occupied by the flowers?​

Answers

The fraction of the plot of land not occupied by the flowers is 0.0625 or 1/16.

Let's calculate the fraction of the plot of land that is not occupied by the flowers.

Given that initially, 1/4 of the land is allocated for orchids, we have 1 - 1/4 = 3/4 of the land remaining.

After planting the orchids, 2/3 of the remaining land is allocated for roses. Therefore, the fraction of land allocated for roses is (2/3) * (3/4) = 2/4 = 1/2.

Subtracting the land allocated for roses from the remaining land, we have 3/4 - 1/2 = 1/4 of the land remaining.

Finally, 0.75 of the remaining land is allocated for tulips. Therefore, the fraction of land allocated for tulips is 0.75 * (1/4) = 0.1875.

To find the fraction of the plot of land not occupied by the flowers, we subtract the fractions of land allocated for flowers from 1:

1 - (1/4 + 1/2 + 0.1875) = 1 - 0.9375 = 0.0625.

Therefore, the fraction of the plot of land not occupied by the flowers is 0.0625.

For more questions on fraction

https://brainly.com/question/78672

#SPJ8

A box has a length of 5 cm, a width of 10 cm, and a helght of 2 cm. The volume of the box is 3 17 cm 3 100 cm 100 cm 17 cm​

Answers

Answer:

17 cm

Step-by-step explanation:

A box has a length of 5 cm, a width of 10 cm, and a height of 2 cm. the volume of the box is: 17 cm

29/6 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats.

Answers

Answer: 4.833333333 you can use a bar over the first 3 to show that it repeats

Step-by-step explanation:

Answer:

4.8(3)

Step-by-step explanation:

first 29 is numerator and 6 is denominator.29/6 can also written as 29÷6.then to convert this fraction to decimal you divide 29 by 6. then the result will be 4.8(3).


A solid cuboid of dimensions 12 cm x 18 cm
x 10 cm is cut into cubes of side 2 cm. How many
such cubes can be cut from the cuboid? Compare
the total surface area of the cube and cuboid

Answers

Answer:

270 first question's answer

Step-by-step explanation:

Solution at attachment box

Total surface area of cuboid is = 12x18x2 + 10x12x2 +18x10x2

=432+240+360

=1032

Surface of the 1 cube =2x2x2 = 8

Surface of the all cubes = 8x270 = 2160

A solid cuboid of dimensions 12 cm x 18 cmx 10 cm is cut into cubes of side 2 cm. How manysuch cubes

IN CASE YOU ARE LOOKING FOR THE ANSWER
A climber is standing at the top of Mount Kilimanjaro, approximately 3.7 mi above sea level. Earth has a radius of 3959 mi.

What is the climber's distance to the horizon?

Enter your answer as a decimal in the box. Round only your final answer to the nearest tenth.

IN CASE YOU ARE LOOKING FOR THE ANSWER A climber is standing at the top of Mount Kilimanjaro, approximately

Answers

Answer: The answer is 171.2 Miles

Step-by-step explanation: You can easily find a "Horizon finder" online. It helps for harder equations like this.

Also I just realized that you put 171.20. When a question asks for a nearest tenth, only put the first digit of the decimal.

3. Solve for x.
(x-2)(x+ 8) = 0

Answers

Answer:

x = 2, x = -8

Step-by-step explanation:

Since the equation equals 0, you know either (x-2) or (x+8) has to equal 0.

This means x = 2, and x = -8

Hope this helps!

Other Questions
which of the following sellers faces the least competitive pressure? a monopolist with no direct rivals one of 800 sellers in a market, each producing a differentiated product an oligopolist with a few direct rivals one of 800 sellers in a market, each producing identical products TRUE OR FALSE:-the water in a river is warmest at its headwaters. -the waters in an ocean are coldest in the neritic zone. -cities are usually colder than their surrounding regions. Use square roots to solvex2 - 10x + 25 = 144 need answers pls!!!! ?.7,000 dollars is placed in a savings account with an annual interest rate of 3%. If nomoney is added or removed from the account, which equation represents how muchwill be in the account after 7 years?A. M= 7,000(0.03)B. M= 7,000(1 + 0.03)(1 + 0.03)C. M= 7,000(1 - 0,03)D M= 7,000(1.03) Question 4 of 5Which option is an example of a genre?A. ThrillerB. PacingC. PamphletD. Setting 1. How does Dorris feel when she is first sitting at the counter? In dorris is coming 1. Given the double-stranded stretch of DNA below, determine the base sequence ofmessenger RNA strand produced using this gene as the template. *Hint: Only one of thetwo strands is used as the template.5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA 3'3' TACGGTAACG AATTCGCCCGTAAT ATGGTACT 5AUGCCAUUGCUU AAG-CGG-GCAULAUAU CCA UGAHow many amino acids will this protein contain? Consider the table, graph, and equation below. Which of the three has the greaterrate of change, if any? Explain your reasoning10 points86226doo12336912y=0.5x + 1FASHIDYF2A ChamondBAN 40N6zdoldY2RENVKhulo YeOA/formResponse Suppose you walk 18.0 m straight west and then 25.0 m straight north. How far are you from your starting point and what is the compass direction of a line connecting your starting point to your final position pls help quick 50 points32x+5x A firm has experienced a constant annual rate of dividend growth of 9 percent on its common stock and expects the dividend per share in the coming year to be $2.70. The firm can earn 12 percent on similar risk involvements. The value of the firm's common stock is ________. 100 POINTS + BRAINLIEST Which description properly describes a step involved in cellular respiration? A.) Glucose is created, then the energy gained is transferred to the energy molecule.B.) Carbon dioxide is combined with oxygen to make glucose.C.) Water is divided into carbon dioxide and glucose. D.)Oxygen is combined with the carbon atoms left from the glucose molecule. given a sales price of $375 per unit, variable cost of $125 per unit, and fixed costs of $100,000, the breakeven point in units is What are Individual rights? Students view two different cells under a microscope. They record their observations in the table shown. Part ABased on the organelles observed, which two help the students determine it is a plant cell?Part BThe function of these 2 organelles are and IS MY CLASE OF SCIENCE 8th HELP PLEASEE Consider the line and triangles in the diagram, which of the following statements explains the relationship between the slope of the line and features of the triangles? (brainliest) (help!) place each social class on the correct level in the diagram The Mayan's main food wascornraw fishpotatoespeanuts 1Which source on the writing of the U.S. Constitution would be considered a primary source?A a newspaper editorial written in 1887Ban encyclopedia article on the ConstitutionCharles Beard's book, An Economic Interpretation of the Constitution (1913)James Madison's Notes on the Constitutional Convention