HELP PLZZZ i put the screenshot below!!!!

HELP PLZZZ I Put The Screenshot Below!!!!

Answers

Answer 1

Answer:

4

Explanation:


Related Questions

How many grams are in 1.5moles of calcium

Answers

Answer: 60.117 g

Explanation: \(1.5 mol Ca = \frac{40.078g/mol}{1mol}\) multiply and quit all "mol" and you get the grams

If there are 3.0 liters of gas at a pressure of 2.0 atm at constant temperature, what is the pressure if the volume is reduced by one half?

Answers

Answer:

The pressure is doubled, 4.0atm

Explanation:

Based on Boyle's law, the pressure of a gas is inversely proportional to its volume at constant temperature. The equation that describes this law is:

P1V1 = P2V2

Where P is pressure and V volume at 1, initial state and 2, final state of the gas.

Computing the values of the problem:

P1 = 2.0atm

V1 = 3.0L

P2 = ?

V2 = 3.0L / 2 = 1.5L

Replacing:

2.0atm*3.0L = P2*1.5L

6.0atmL / 1.5L = P2

4.0atm = P2

The pressure is doubled, 4.0atm

what happens when ca no3 2 is heating it gives CaO ,NO2 and 02

Answers

Answer:

balanced equation:

2Ca(NO3)2 (aq)-----> 2CaO (s) + 4NO2 (g) + O2 (g)

So heating 2 moles of Ca(NO3)2 gives 2 moles of CaO, 4 moles of NO2 and 1 mole of O2. This is a heat decomposition reaction. It gives a white precipitate (CaO), and brown pungent gas (NO2).

Answer:

The balanced equation of the reaction is below.

Explanation:

2Ca(NO3)2 -----> 2CaO + 4NO2 + O2.



The product sodium chloride is dissolved in water to separate it from
titanium.
At 30 °C the solubility of sodium chloride is 36 kg per 100 dm³.
Calculate the minimum volume of water in dm³, at 30 °C, needed to dissolve
1989 kg sodium chloride.

Answers

According to the concept of solubility,  the minimum volume of water in dm³, at 30 °C, needed to dissolve 1989 kg sodium chloride is 5525 liters.

What is solubility?

Solubility is defined as the ability of a substance which is basically solute to form a solution with another substance. There is an extent to which a substance is soluble in a particular solvent. This is generally measured as the concentration of a solute present in a saturated solution.

The solubility mainly depends on the composition of solute and solvent ,its pH and presence of other dissolved substance. It is also dependent on temperature and pressure which is maintained.

Volume of water required is calculated by formula, mass of sodium chloride/solubility×100=1989000/36×100=5525 liters.

Learn more about solubility,here:

https://brainly.com/question/8591226

#SPJ1

need help
no link



in how many days does the life cycle of mosquito complete?​

Answers

Answer:

it can range from 4 days to as long as a month.

Answer:

8 to 10 days take to complete life cycle of mosquito.

What is the molarity of a HCl solution, if 28.6 mL of a 0.175 m NaOH solution is needed to neutralize a 25.0 mL sample of the HCl solution

Answers

The molarity of the HCl solution needed to neutralize 28.6 mL of a 0.175 M NaOH solution is 0.2002 M

We'll begin by writing the balanced equation for the reaction. This is given below:

HCl + NaOH —> NaCl + H₂O

From the balanced equation above,

The mole ratio of the acid, HCl (nA) = 1

The mole ratio of the base, NaOH (nB) = 1

From the question given above, the following data were obtained:

Volume of base, NaOH (Vb) = 28.6 mL

Molarity of base, NaOH (Mb) = 0.175 M

Volume of acid, HCl (Va) = 25 mL

Molarity of acid, HCl (Ma) = ?

The molarity of the acid, HCl can be obtained as follow:

MaVa / MbVb = nA / nB

(Ma × 25) / (0.175 × 28.6) = 1

(Ma × 25) / 5.005 = 1

Cross multiply

Ma × 25 = 5.005

Divide both side by 25

Ma = 5.005 / 25

Ma = 0.2002 M

Therefore, the molarity of the acid, HCl needed for the reaction is 0.2002 M

Learn more: https://brainly.com/question/25573711

Examples of the surface area change the rate of chemical reactants applied in industry or products, materials?

Answers

What's the effect of surface area change

We know

Pressure is indirectly proportional to area

If surface area increases pressure decreasesIf pressure decreases volume increasesIf volume increases no of moles increasesSo production increases.

Nuclear energy is currently used in which three kinds of vehicles?

Answers

Answer:

A. cars, submarines, spacecraft

Explanation:

I took the test.

Complete the following radioactive decay problem.

234 U → 4^He +
92. 2

Answers

The complete radioactive decay equation is as follows:

234/92 → 4/2He + 230/90 Th

What is a radioactive decay?

Radioactive decay is a several processes by which unstable nuclei emit subatomic particles and/or ionizing radiation and disintegrate into one or more smaller nuclei.

According to this question, uranium with the mass number 234 and atomic number 92 undergoes a radioactive decay as follows:

234/92 U → 4/2 He + 230/90 Th

Uranium-234 nuclei decay by alpha emission to thorium-230, except for the tiny fraction (parts per billion) of nuclei that undergo spontaneous fission.

Learn more about radioactive decay at: https://brainly.com/question/1770619

#SPJ1

what type of reaction is performed with the elephant toothpaste demonstration?

Answers

The reaction performed with the elephant toothpaste demonstration is known as a decomposition reaction.

Decomposition Reaction:

The process of breaking down a chemical compound into smaller molecules, atoms, or ions is known as a decomposition reaction. It is also known as analysis or disintegration. A reaction in which a single substance is broken down into two or more simpler substances is known as a decomposition reaction. The elephant toothpaste demonstration is a simple chemical reaction in which hydrogen peroxide breaks down into oxygen gas and water in a matter of seconds.

The formula for hydrogen peroxide is H₂O₂. It is a pale blue liquid that contains hydrogen, oxygen, and water. When you add yeast, soap, and food coloring, the reaction is more exciting. The yeast acts as a catalyst, breaking down hydrogen peroxide into water and oxygen gas. The oxygen gas created causes the soap to foam up, creating the "elephant toothpaste" effect. The chemical reaction that takes place during the elephant toothpaste demonstration can be written as follows:

2H₂O₂(liquid) → 2H₂O (liquid) + O₂ (gas)

This reaction is an example of a decomposition reaction.

To know more about decomposition reaction visit:

https://brainly.com/question/32864042

#SPJ11

The experimental mass is 51.5 grams and the theoretical mass is 50 grams what is the percent error ? Show your work below round your answer to two digits

Answers

Answer:

3%

Explanation:

as error occurred is 1.5(error value) so 1.5 is 3%of 50(original value)

Molecules in a substance move differently when a substance changes phase?

Answers

Yes, molecules in a substance move differently when a substance changes phase. This is because the molecules have different amounts of energy in each phase, which affects their motion. For example, in a solid phase, molecules are held in place by strong intermolecular forces, while in a liquid phase, molecules are free to move around.

Mrs. Sikora purchases chlorpheniramine over-the-counter for her allergies. Which side effect would Mrs. Sikora likely experience

Answers

Answer:

drowsiness

Explanation:

How far will an insect travel in 20s if it is moving 0.3m/s?

Answers

Speed = 0.3 m/s

Time = 20 s

We know, Speed = Distance/ Time

or, Distance = Speed × Time

Therefore, the distance travelled by the insect

= (0.3×20) m

= 6 m

The insect will travel 6 m.

Please do mark me Brainliest.

Cuantas moléculas de K² Cr ² 0⁷ hay en 0.5 dm³ de una solución de dicromoto de potasios de 30% en p/p y una densidad relativo de 1.15? (Coronel R., 2018)

Answers

Answer:

El número de moléculas de K₂Cr₂O₇ presentes en la solución es de aproximadamente 3,52058347 × 10²³ moléculas

Explanation:

Los parámetros dados de la solución de dicromato de potasio son;

El volumen de la solución, V = 0,5 dm³ = 0,0005 m³

El porcentaje en masa de dicromato de potasio en la solución = 30% p / p

La densidad relativa de la solución, RD = 1,15

Por lo tanto, la masa de dicromato de potasio en la solución, m = 30% de la masa de la solución.

El RD de la solución = (La densidad de la solución) / (La densidad del agua)

La densidad del agua = 997 kg / m³

Por lo tanto, tenemos;

RD = 1,15 = (La densidad de la solución) / (997 kg / m³)

La densidad de la solución, ρ = 1,15 × 997 kg / m³ = 1,146,55 kg / m³

La masa de la solución, m = ρ × V

∴ m = 1.146,55 kg / m³ × 0.0005 m³ = 0,573275 kg

La masa de dicromato de potasio en la solución, m₁ = 0.3 × m

∴ m₁ = 0.3 × 0.573275 kg = 0.1719825 kg = 171.9825 g

La masa de dicromato de potasio en la solución, m₁ = 171,9825 g

La masa molar del dicromato de potasio, K₂Cr₂O₇ = 294,185 g / mol

El número de moles de dicromato de potasio, K₂Cr₂O₇ en la solución, n = (Masa, m) / (Masa molar)

∴ n = 171,9825 g / (294,185 g / mol) = 0,584606625 moles

∴ El número de moléculas de K₂Cr₂O₇ presentes en la solución = n ×

Dónde;

= Número de Avogadro = 6.0221409 × 10²³ mol⁻¹

Por lo tanto, tenemos;

El número de moléculas de K₂Cr₂O₇ presentes en la solución = 0.584606625 moles × 6.0221409 × 10²³ mol⁻¹ = 3.52058347 × 10²³ moléculas

El número de moléculas de K₂Cr₂O₇ presentes en la solución ≈ 3.52058347 × 10²³ moléculas

How many cans are on each palet

How many cans are on each palet

Answers

Answer:

1440

Explanation:

32 cans/bundle and there are 45 bundles 32 x 45 = 1440

A sealed piston holds 22.4 L of gas at 2.50 atm, 0.0°C. If the piston is allowed to expand to 44.8 L what is
the final pressure assuming the final temperature is 273°C?

Answers

The final pressure assuming the final temperature is 273°C is 5.00 atm.

To find out the final pressure when a sealed piston holding 22.4L of gas is allowed to expand to 44.8L with a final temperature of 273°C, we will have to apply the combined gas law.

The combined gas law is a gas law that combines Charles's law, Boyle's law, and Gay-Lussac's law. It states that:

\($$\frac{P_1V_1}{T_1} = \frac{P_2V_2}{T_2}$$\)

Where, P₁ is the initial pressure of the gas

V₁ is the initial volume of the gas

T₁ is the initial temperature of the gas

P₂ is the final pressure of the gas

V₂ is the final volume of the gas

T₂ is the final temperature of the gas

We know that:

P₁ = 2.50 atm V₁ = 22.4 L T₁

= 0°C + 273°C = 273 K P₂ = ?

V₂ = 44.8 L T₂

= 273°C + 273°C = 546 K

Substitute the values into the combined gas law equation.

\($$\frac{(2.50\text{ atm})(22.4\text{ L})}{273\text{ K}} = \frac{P_2(44.8\text{ L})}{546\text{ K}}$$Multiply both sides by 546 K to solve for P₂. $$P_2 = \frac{(2.50\text{ atm})(22.4\text{ L})(546\text{ K})}{(273\text{ K})(44.8\text{ L})}$$Simplify. $$P_2 = 5.00\text{ atm}$$.\)

for such more questions on  pressure

https://brainly.com/question/24719118

#SPJ8

i need this answer today help pls

i need this answer today help pls

Answers

Answer:

A. 28 days

Explanation:

Answer:

about 29.53 days

So, 28 days.

Explanation:

If you want the exact, It takes 27 days, 7 hours, and 43 minutes. Yes, i was bored so i calculated it. I'm good with astrology.

Use the formula to answer the following question4Li + Pb(SO4)2->2Li₂SO4 + PbHow many moles of Pb(SO4)2 are needed to produce 330 g Li₂SO4?

Answers

ANSWER

The number of moles of Pb(SO4)2 is 1.5 moles

EXPLANATION

Given that;

The mass of Li2SO4 is 330g

Follow the steps below to find the moles of Pb(SO4)2

Step 1; Write the balanced equation of the reaction

\(\text{ 4Li + Pb\lparen SO}_4)_2\rightarrow\text{ 2Li}_2SO_4\text{ + Pb}\)

Step 2; Find the number of moles of Li2SO4 using the below formula

\(\text{ Mole = }\frac{\text{ mass}}{\text{ molar mass}}\)

Recall, that the molar mass of Li2SO4 is 109.94 g/mol

\(\begin{gathered} \text{ mole = }\frac{\text{ 330}}{\text{ 109.94}} \\ \text{ mole = 3.00 moles} \end{gathered}\)

The number of moles of Li2SO4 is 3.00 moles

Step 3; Find the number of moles of Pb(SO4)2 using a stoichiometry ratio

In the above equation of the reaction, 1 mole Pb(SO4)2 reacts to give 2 moles LiSO4

Let the number of moles of Pb(SO4) be x

\(\begin{gathered} \text{ 1 mole Pb\lparen SO}_4)_2\text{ }\rightarrow\text{ 2 moles Li}_2\text{SO}_4 \\ \text{ x moles Pb\lparen SO}_4)_2\text{ }\rightarrow\text{ 3.00 moles Li}_2SO_4 \\ \text{ Cross multiply} \\ \text{ 1 mole Pb\lparen SO}_4)_2\text{ }\times\text{ 3 .00 moles Li}_2SO_4\text{ = 2 moles Li}_2SO_4\text{ }\times\text{ x moles Pb\lparen SO}_4)_2 \\ \text{ Isolate x} \\ \text{ x = }\frac{\text{ 1 mole Pb\lparen SO}_4)_2\times3moles\cancel{Li_2}SO_4}{2moles\cancel{Li_2}SO_4} \\ \text{ x = }\frac{1\text{ }\times\text{ 3}}{2} \\ \text{ x = }\frac{3}{2} \\ \text{ x = 1.5 moles} \end{gathered}\)

Therefore, the number of moles of Pb(SO4)2 is 1.5 moles

A genetic mutation is always observable in an organism physical appearance True or false

A genetic mutation is always observable in an organism physical appearance True or false

Answers

Answer:

false

Explanation:

false, only a small percentage of mutations cause genetic disorders—most have no impact on health or development. For example, some mutations alter a gene's DNA sequence but do not change the function of the protein made by the gene.

What Kind of model is shown?

What Kind of model is shown?

Answers

Answer:

Mathematical

Explanation:

It shows how to find the hypotenuse

Mathematical

Brainliest

why is carbon monoxide used to reduce zinc oxide to zinc in the zinc extraction process and not carbon directly?​

Answers

Answer:

The chemical reaction involving the reduction of ZnO by CO is not feasible thermodynamically: This is because the standard free energy of formation ( ) of CO2 from CO is higher than that of the formation of ZnO from Zn. Thus, CO cannot be used to reduce ZnO to Zn.

How Many Manganese Atoms Are Liberated If 54.8 Moles Of Mn3O4 React With Excess Aluminum

Answers

The number of manganese atoms liberated when 54.8 moles of Mn3O4 react with excess aluminum is 9.91 x 10^26 atoms. To determine the number of manganese atoms liberated in this reaction, we first need to write a balanced chemical equation.

The reaction between Mn3O4 and aluminum can be represented as, 3 Mn3O4 + 8 Al → 9 Mn + 4 Al2O3. From this equation, we can see that for every 3 moles of Mn3O4, we get 9 moles of manganese atoms. Therefore, to find the number of manganese atoms liberated, we need to convert 54.8 moles of Mn3O4 to moles of manganese atoms using a mole ratio, 54.8 mol Mn3O4 x (9 mol Mn / 3 mol Mn3O4) = 164.4 mol Mn.

Next, we can convert the moles of manganese atoms to the number of atoms using Avogadro number, 164.4 mol Mn x 6.022 x 10^23 atoms/mol = 9.91 x 10^26 atoms. Therefore, 9.91 x 10^26 manganese atoms are liberated when 54.8 moles of Mn3O4 react with excess aluminium.

To know more about manganese atoms visit:

https://brainly.com/question/13994580

#SPJ11

Cyclohexane (C6H12) is one of the components of crude oil. Which shows the
balanced combustion reaction for cyclohexane?

Cyclohexane (C6H12) is one of the components of crude oil. Which shows thebalanced combustion reaction

Answers

Answer:

D. C6H12+9O2 -> 6CO2+6H2O+heat

Explanation:

got it right on ap ex

The combustion reaction is the reaction between reactants and oxygen. The balanced combustion reaction for cyclohexane is, C₆H₁₂ + 9O₂ → 6CO₂ + 6H₂O + heat. Thus, option D is correct.

What is a combustion reaction?

A type of reaction that includes the release of energy and heat when the oxygen reacts chemically with the reactant. The presence of oxygen as one of the reactants is a characteristic property of the combustion reaction.

As a result of the reaction carbon dioxide and water is produced along with heat in the reaction. The balanced combustion reaction of cyclohexane (C₆H₁₂) is given as,

C₆H₁₂ + 9O₂ → 6CO₂ + 6H₂O + heat

Here, the number of carbon is six on both sides, twelve hydrogen on both sides, and eighteen oxygen on the left and right sides of the reaction.

Therefore, option D. C₆H₁₂ + 9O₂ → 6CO₂ + 6H₂O + heat is the balanced combustion reaction.

Learn more about combustion reaction here:

https://brainly.com/question/14335621

#SPJ2

It refers to a group of cells which perform essentially the same function. *​

Answers

Answer:

Tissue

Explanation:

A Group of cells which perform thesame function according to the organization of life is called Tissue

What happens to the reactivity of metals right to left in a period?.

Answers

Metals' reactivity declines from right to left on a periodic table. A tabular representation of the chemical elements is known as the periodic table, or periodic table of the (chemical) elements.

It is commonly regarded as an icon of chemistry and is utilized extensively in physics, chemistry, and other sciences. The chemical makeup and the circumstances surrounding the interaction determine the reactivity of metals in periodic table. The names of the metals and their degrees of reactivity with the aforementioned elements are listed in a table referred to as the "reactivity series" of metals. Metal Series Reactivity Chart. The reactivity of metals rises in the reactivity series from bottom to top.

Learn more about periodic table here

https://brainly.com/question/11155928

#SPJ4

Give one paragraph of what the word Xenocryst mean? ​

Answers

Answer:

Explanation:

Xenocryst is a crystal in an igneous rock that is not derived from the original magma. This means that its origin is from a rock so itʻll be something thats on a rock that has a crystal base.

i hope this helps!

what is the difference between polyatomic and monatomic compounds??

Answers

Answer:

Monatomic ions are made up of only one atom per ion, whereas polyatomic ions are made up of numerous atoms per ion.

Explanation:

Monatomic contains one atom and polyatomic contains two or more atoms

Which of the following transitions (in a hydrogen atom) represent absorption of the smallest frequency photon? A. n = 5 to n = 6 B. n = 1 to n = 3 C. n = 5 to n = 4 D. n = 1 to n = 2 E. n = 4 to n = 1

Answers

The smallest frequency photon corresponds to the smallest energy difference between the initial and final states. This energy difference is given by the formula E = hc/λ, where h is Planck's constant, c is the speed of light, and λ is the wavelength of the photon. Since frequency is inversely proportional to wavelength (ν = c/λ), the smallest frequency photon corresponds to the longest wavelength photon, which has the smallest energy.

Using the formula for the energy levels of hydrogen (E = -13.6 eV/n^2), we can calculate the energy differences for each transition:
A. n = 5 to n = 6: ΔE = (-13.6 eV/6^2) - (-13.6 eV/5^2) = 0.377 eV
B. n = 1 to n = 3: ΔE = (-13.6 eV/3^2) - (-13.6 eV/1^2) = 10.2 eV
C. n = 5 to n = 4: ΔE = (-13.6 eV/4^2) - (-13.6 eV/5^2) = 0.194 eV
D. n = 1 to n = 2: ΔE = (-13.6 eV/2^2) - (-13.6 eV/1^2) = 3.4 eV
E. n = 4 to n = 1: ΔE = (-13.6 eV/1^2) - (-13.6 eV/4^2) = 10.2 eV

From these calculations, we can see that the transition with the smallest energy difference (and hence the smallest frequency photon) is C. n = 5 to n = 4.

To know more about smallest frequency visit:-

https://brainly.com/question/31386030

#SPJ11

L.
Use a pencil and draw a line in the sequences below for
species A and species B to show where the catalyst
would cut the DNA.
Species A AATTGGCCTAATTAATTCGG CCTAG
Species B: AATTCCTACGG CCTAGCCTTTAATT

Answers

The catalyst BamH1 will cut the DNA as follows:

Species A: AATTG | GCCTAATTAATTCG | GCCTAG

Species B: AATTCCTACG | GCCTAGCCTTTAATT

What are restriction endonucleases?

Restriction endonucleases or restriction enzymes are enzymes that cleave DNA into pieces at or close to particular recognition regions inside molecules called restriction sites.

EcoRI, BamH1, and smaI are some examples of restriction endonucleases.

BamHI is a type II restriction enzyme that recognizes the DNA sequence "GGATCC" and cuts the DNA at in between G and G.

Learn more about restriction endonucleases at: https://brainly.com/question/1127662

#SPJ1

Other Questions
Carla Eppelstein is saving her babysitting money to buy a bicycle. She usually babysits a total of 11 to 16 hours per week and charges $4.50 per hour. If the bicycle she wants is $147, in about how many weeks will she be able to pay for it Llam is setting up folding chairs for a meeting. If he arranges the chairs In 7 rows of the same length, he has 5 chairs left over. If he arranges the chairs in 5 rows of that same length, he has 23 left over. How many chalrs does Llam have? A car that travels 20 miles in 1/2 hour at constant speed is traveling at the same speed as a car that travels 30 miles. In how many hours (at a constant speed) the product of a number and 7 as an expression in problems 16, use the method of variation of parameters to determine a particular solution to the given equation. 1. y-3y 4y = e2x 2. y-2y y = x 3. z 3z-4z = e2x Assume you have $1,000 in a savings account at the beginning of the year and the price level is equal to 100. If the price level is equal to 115 at the end of the year, the real value of your savings is closest to $885. a. O b. $1,150. $870. C. O d. $1,115. ) if a good is labor intensive it means that the good is produced What is the result of 58889? 4What is the Z-score of an individual who pays $150 per night at a hotel when theaverage price is $120 and the standard deviation is $5?A 6B 1/60.6D) 30 sort the fractions into the appropriate bins by their estimates Use the law of sines or cosines to find the remaining sides/angles of the triangle. Round answers to the nearest tenth. What is the range of f/x )= A x? In an elite-mass dichotomy system, a small number of people hold a great deal of power over others. According to __________, this kind of system was ideal if ___________ status was based on a ___________ system, while _________ saw these systems as inherently _________. A company has a total fixed cost of 4,000 and each item it produces costs 10.00. Each items sells for 15.00. How many must be sold for profits to be at least 15,000? (Provide your answer rounded UP to the nearest unit. Example--> 25.2 becomes 26) A high-speed bullet train accelerates and decelerates at therate of 10 ft/s210 ft/s2. Its maximum cruising speed is 105 mi/h105mi/h. (Round your answers to three decimal places.)(a) What is the maxScore on last try: 0 of 1 pts. See Details for more. You can retry this question below A high-speed bullet train accelerates and decelerates at the rate of 10 ft/s. Its maximum cruising speed is 105 miranda v. arizona (1966) was important because it lproduced rules that must be use In today's videos we saw that any full rank 2x2 matrix maps the unit circle in R2 to an ellipse in R2 We also saw that any full rank 2x3 matrix maps the unit sphere in R3 to an ellipse in R2. What is the analogous true statement about any 3x2 matrix? a. Any full rank 3x2 matrix takes a circle in a plane in R3 to an ellipse in R2. b. Any full rank 3x2 matrix takes the unit circle in R2 to an ellipsoid in R3 c. Any full rank 3x2 matrix takes the unit circle in R2 to a sphere in R3. O d. Any full rank 3x2 matrix takes the unit circle in RP to an ellipse in a plane inside R3. A new CFD method for determination of translational added mass coefficients of an underwater vehicle What is 5 7/20 written as a decimal? If you are a seller's designated agent, youO must disclose your status to buyers prior to preparing an offer.O must obtain a signed agency disclosure form prior to closing.O must have an agency contract.O may or may not be the managing broker.