HELP WILL GIVE 20 POINTS!!!!!!!!!!!!!!

HELP WILL GIVE 20 POINTS!!!!!!!!!!!!!!

Answers

Answer 1
Equations and science

Related Questions

Convincing science evidence and data suggests that evolution:

occurred in the past, and is still occurring today

is now occurring, but did not occur in the past

occurred in the past but is no longer occurring

Answers

Answer:

Occured in the past, and is still occuring today.

Explanation:

Evolution is always happening but at a very slow pace.

Each of the following exists as a molecule except
H20
02
He
C6H1206
CO2

Answers

Answer:

CO2

Explanation:

Its a compound with a molecular structure. The others are all molecules.

(C6H1206 is neither a molecule and compound)

(I hope this helps you) :)

which one of these is not a characteristic of enterics? group of answer choices gram negative spore forming rods facultative anaerobes ferment glucose

Answers

Spore forming rods is not a characteristic of enterics. Enterics are a group of gram-negative, facultative anaerobic bacteria that can ferment glucose.

For more question like Spore forming rods visit the link below:

https://brainly.com/question/31530542

#SPJ11

This interprets an RNA message into a string of amino acids called a polypeptide. Either single polypeptide or many polypeptides working together make up a protein. Called?

Answers

Answer:

The correct answer is - translation

Explanation:

The translation is the second process involved in the protein synthesis in which mRNA that was encoded the genetic information from the DNA code during the transcription process, produces the amino acid sequence with the help of ribosome and tRNA.

These RNA messages or codes are decoded by the ribosome that produces a specific sequence of codes that form specific amino acid decided by the triplet code they produces. These amino acids together form polypeptides chain and single polypeptide or many polypeptides working together make up a protein.

hii pls help i’ll give brainliest

hii pls help ill give brainliest

Answers

Answer:

They are unequal and act in the same direction. Also Reminder to be happy, go drink some water, eat some food and relax! You are loved :) <3

Explanation:

Name all types of variables (with a description)

Answers

Answer: In all there are six basic variable types: dependent, independent, intervening, moderator, controlled and extraneous variables. Independent and Dependent Variables In general, experiments purposefully change one variable, which is the independent variable.

Explanation:can i have a brainliest

points to whoever says pog

Answers

Answer:

Pog

Explanation:

Willing to give brainliest if you can help me out!

Willing to give brainliest if you can help me out!

Answers

From top to bottom:
Vacuole
Cytoplasm
Golgi

Labelling parts of plant cell :-

VacuoleCytoplasm Golgi apparatus

3. Through the enteric nervous system, stress causes:
a. A change in the composition and function of gut bacteria
b. Decreased sensitivity to stomach acid
c. Food allergies
d. Iron deficiency

Answers

Answer:

This will help you

Explanation:

In more serious cases, stress may cause a decrease in blood flow and oxygen to the stomach, which could lead to cramping, inflammation, or an imbalance of gut bacteria. It can also exacerbate gastrointestinal disorders, including Irritable bowel syndrome (IBS) Inflammatory bowel disease (IBD)

A student wants to know how different activities affect heart rate so she records the heart rate of another student after sitting for 5 minutes
and takes it again after the same student runs in place for one minute.
Which is the dependent and which is the independent variable?
Column A
Column B
1
Type of exercise
a. dependent variable
2
Heart rate
b. independent variable

Answers

dependent: heart rate independent: type of activity

One nutrient that is underconsumed by many elderly people is:

Answers

One nutrient that is underconsumed by many elderly people is calcium (Ca). Calcium is a mineral that is vital for strong bones and teeth, muscle and nerve function, and other bodily functions.

Elderly people are more susceptible to calcium deficiencies due to a variety of factors, including a decrease in stomach acid and intestinal function, decreased physical activity, and an increased risk of osteoporosis. Osteoporosis is a condition in which bones become thin, weak, and brittle, increasing the risk of fractures. It is essential for the elderly to consume more than 100% of the daily recommended intake of calcium to maintain healthy bones and prevent osteoporosis.

To know more about brittle  visit:

https://brainly.com/question/981208

#SPJ11

An unusually cold January in Florida destroyed entire fields of tomatoes. Florida’s growers are shipping only a quarter of their usual 5 million pounds a week. The price has risen from $6.50 for a 25-pound box a year ago to $30 now.
1.1. Make a graph to illustrate the market for tomatoes before the unusually cold January and in the same graph show how the events in the news clip influence the market for tomatoes. (0.5)
1.2. In April 2014, the money price of a carton of milk was $2.01 and the money price of gallon of gasoline was $3.63. Calculate the relative price of a gallon of gasoline in terms of milk. (0.5) Frigid Florida Winter is Bad News for Tomato Lovers An unusually cold January in Florida destroyed entire fields of tomatoes. Florida's growers are shipping only a quarter of their usual 5 million pounds a week. The price has risen from $6.50 for a 25 -pound box a year ago to $30 now. 1.1. Make a graph to illustrate the market for tomatoes before the unusually cold January and in the same graph show how the events in the news clip influence the market for tomatoes. (0.5) 1.2. In April 2014, the money price of a carton of milk was $2.01 and the money price of gallon of gasoline was $3.63. Calculate the relative price of a gallon gasoline in terms of milk. (0.5)

Answers

1.1. Graph to illustrate the market for tomatoes before the unusually cold January and in the same graph show how the events in the news clip influence the market for tomatoes

Here, the price is $6.50 and the quantity supplied is 5 million pounds per week. The equilibrium is at the intersection of the supply and demand curve at point E.

Now, the events of the news clip influence the market for tomatoes, causing a decrease in supply due to the destruction of entire fields of tomatoes, resulting in a shift of the supply curve from S1 to S2.

The new equilibrium is at point F where the price has increased to $30 and the quantity demanded and supplied have decreased to 1.25 million pounds per week.

1.2. In April 2014, the money price of a carton of milk was $2.01 and the money price of a gallon of gasoline was $3.63.

To calculate the relative price of a gallon of gasoline in terms of milk, we use the formula:

Relative price = Price of gasoline / Price of milk

Relative price = $3.63 / $2.01 = 1.81

Therefore, the relative price of a gallon of gasoline in terms of milk is 1.81.

Know more about Relative price

https://brainly.com/question/30770538

#SPJ11

Describe one of the three types of volcanoes we discussed today

Describe one of the three types of volcanoes we discussed today

Answers

Answer: Shield, Cinder Cone, and Composite volcano.

Explanation: A shield volcano is a volcano that is formed with lava is very runny and spreads to a wide area and then cools to form a shield volcano. These are common at Hawaii.

A cinder cone volcano is the smallest volcano. It's made from minor eruptions and cinders. They're short and usually erupt for a short period of time. Mexico's Parícutin volcano, is a cinder cone.

Composite or stratovolcanoes are the most common type of volcano. They form from thick, less runny lava. Since it is so thick, it cools then makes the volcano taller. Mount st helens, in Washington state is a stratovolcano.

What would a karyotype like this look like after meiosis?How did the organism get these chromosomes, and where did they come from?

What would a karyotype like this look like after meiosis?How did the organism get these chromosomes,

Answers

Answer:

If you looked at a karyotype of a germ cell - egg or sperm cell - you would see only 1 of each chromosome in a karyotype, not two!!! Germ cells have only half the number of chromosomes as a diploid cell one of each pair. The number of chromosomes is reduced from 46 (23 pairs) to 23 during the process of meiosis. The number of chromosomes is reduced from 46 (23 pairs) to 23 during the process of meiosis.

Explanation:

Karyotypes are like representations to indicate the number of chromosomes of a particular organism.

The karyotype shown after meiosis will be left with just 23 single chromosomes (not in pairs). They are haploid cells.

In meiosis I , all the chromosomes replicate and the homologous chromosomes then separate afterwards. Then in meiosis II, the chromosomes are the separated by their centromeres giving rise to 4 cells with 23 single chromosomes (haploid cells).

The organism got this karyotype from the contribution of the both parents nuclei (haploid egg cell and haploid sperm cell) fusing to give rise to a cell with diploid chromosomes.

Learn more: https://brainly.com/question/16249478

Henry wanted to know how fast his pet tortoise could walk.

First, he placed a nice leaf of lettuce at one end of his patio. Then, he placed his tortoise 5 meters away from the lettuce and recorded its position and time as it moved toward the lettuce.

The chart below shows Henry's observations.

After 24 seconds, how far away from the starting point was the tortoise?
A. 4 meters
B. 0 meters
C. 2 meters
D. 1 meter

Henry wanted to know how fast his pet tortoise could walk.First, he placed a nice leaf of lettuce at

Answers

Answer:

2 meters

Explanation:

on the table, the number to the left of 24 is 2, showing its 2 meters in 24 seconds

Find the area inside the cardioid =6−4cos(theta).

Answers

Numerous natural formations display the cardioid shape, which has biological relevance, which is determined by the equation r = 6 - 4cos().

The form of some animal hearts, including those of some cephalopods and sea gastropods, is one striking example. These species' cardioid-shaped hearts have developed to help them efficiently pump blood throughout their bodies. Their physiological demands are supported by the high blood flow that is maintained by the cardioid shape's narrowing apex. Additionally, certain flower species, such as several cyclamen species, have a cardioid-like arrangement of their petals. By offering an ideal landing site, its design helps to draw pollinators. The cardioid shape thus exhibits functional modifications for circulation and reproduction in biology.

To know more about reproduction, here

brainly.com/question/7464705

#SPJ4

--The complete Question is, What is the biological significance of the cardioid shape in nature? Explain any patterns or phenomena observed in biological structures that resemble or approximate a cardioid shape. How does the equation for the cardioid, given as r = 6 - 4cos(θ), relate to these biological structures? Discuss any potential implications of the equation for understanding the functions or adaptations of organisms that exhibit cardioid-like structures. Provide examples of organisms or biological systems where the cardioid shape is prominent and explain how this shape benefits their survival, reproduction, or other biological processes. --

Which best determines the health of a lake used as a source of freshwater?
A. its depth and width
B. its temperature and pH
C.its location and depth
D.its temperature and depth

Answers

Answer:

B

Explanation:

A measure of the natural populations of algae, plants, fish, and other wildlife provides evidence of the health of a body of water.

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

What are two tools that can be used to measure wind direction?

Answers

Answer:

it should be a wind vane and an anemometer.

Explanation:

The anemometer measures wind speed and the wind vane helps determine what direction the wind is coming from.

Explain why trends and discrepancies are useful in scientific study

Answers

Trends only encourage the creation of hypotheses and enable forecasts of what we should see.

Differences:

Encourage fresh research and a better comprehension of how the world functions.

In data science, trends, patterns, and correlations are all crucial. Most scientific discoveries start with an observation of some phenomena. The phenomenon that was noticed is then suggested as having a potential explanation. A hypothesis is what this is. A scientific theory must be testable, which means that it must be possible to determine by experiments whether it is true.In order to evaluate a hypothesis, data from experiments are gathered. While testing hypotheses, experiments are carefully planned so that the data collected yields the essential data. Afterwards, this data is examined to discover trends, patterns, and connections.

To know more about trends please check the following link

https://brainly.com/question/13710958

#SPJ4

which three of the following are advantages of using atp as an energy carrier in living systems?

Answers

Advantages of using ATP as an energy carrier in living systems include:

ATP releases energy quickly, facilitating the speed of enzymatic reactions.

ATP (adenosine triphosphate) is a crucial energy carrier in living systems. It provides readily available energy for various cellular processes. The advantages of ATP stem from its unique properties and role in energy transfer.

Firstly, ATP releases energy rapidly when hydrolyzed into ADP+P. This quick energy release enables enzymatic reactions to occur at a faster rate, promoting efficient cellular processes.

Secondly, the amount of energy released during ATP hydrolysis is typically well-matched to the energy demands of biological processes. Unlike breaking down an entire carbohydrate or fat molecule, which would release excessive energy, ATP provides an appropriate and controlled amount of energy for specific tasks, preventing wasteful energy consumption.

Lastly, the structure of ATP allows it to easily couple its breakdown to energy-requiring reactions. The phosphate group released from ATP can be transferred to other molecules, activating them and providing the necessary energy for cellular work.

Overall, ATP's ability to rapidly release energy, provide suitable amounts of energy, and easily couple its breakdown to energy-requiring reactions makes it an efficient and versatile energy carrier in living systems.

To learn more about ATP, here

https://brainly.com/question/174043

#SPJ4

The complete question is:

Which three of the following are advantages of using ATP as a energy carrier in living systems

1. ATP releases energy quickly, which facilitates the speed of enzymatic reactions.2. When ATP becomes ADP+P, the amount of energy released is usually just enough for a biological purpose. Breaking down an entire carbohydrate or fat molecule would be wasteful, because it would release much more energy than is needed.3. The structure of ATP allows its breakdown to be easily coupled to an energy-requiring reaction as described next.

a student wanted to observe dividing cells under a microscope
the student squashed the root tip of an onion plant on a microscope slide.
describe how the student should use a light microscope to view the squashed root tip

Answers

The student can view the squashed root tip through the microscope by;

placing the slide on the microscope stage and holding it in place using the stage clips Looking through the eyepiece lens and adjusting the objective lens until a clear image is obtained.

What is a microscope?

A microscope is an instrument used in the laboratory to view objects that cannot be seen with the unaided eye clearly.

These objects are in the microscopic size scale level.

Microscopes usually have two lenses; the objective lens and the magnification lens.

A proper adjustment of the objective lens and the eyepiece lens enables the clear visualization of a microscopic object.

Learn more about microscope at: https://brainly.com/question/820911

#SPJ1

A population of a wild animal is a frequent target for hunters. Hunters tend to hunt the larger animals with big horns. How might this affect the populations in the wild?
A.
Animals with average horns will increase in number.
B.
Smaller animals with a trait for short horns will become endangered.
C.
Traits for larger animals with big horns will be selected.
D.
Traits for smaller animals with short horns will be selected.
Reset

Answers

Answer:

D. Traits for smaller animals with short horns will be selected.

Explanation:

The process of natural selection will favour those individuals that possess the combination of characteristics that are most likely to survive and reproduce. As the hunters tend to target the larger animals with big horn, smaller animals with short horns will have better chances of survival so the traits for short animals with short horns will be selected.

Ch5 the cup-shaped socket of the hip bone into which the thigh bone fits is called the _________.

Answers

Answer:

Ball and Socket joint

a food web is shown below. Which of the following organisms compete for the mouse as a food source?

a food web is shown below. Which of the following organisms compete for the mouse as a food source?

Answers

Answer:

it should be the snake bc I have one and the mouse gets eat in by the snake

According to the food web in the diagram, the hawk and the snake are the organisms competing for the mouse as a food source.

FOOD WEB:

A food web is a interaction of many food chains. It shows the feeding pattern of different levels of organisms.

Ideally, producers are fed on by primary consumers, followed by secondary consumers, then tertiary consumers.

In the food web attached to this image, two arrows connects hawks and snakes to the mouse. This means that hawks and snakes are potential predators or consumers of mouse.

Therefore, the hawk and the snake are the organisms competing for the mouse as a food source.

Learn more about food web: https://brainly.com/question/20472214?referrer=searchResults

43) which evidence suggests that upper motor neurons in the primary cortex have a preferred direction?

Answers

One of the pieces of evidence that suggests upper motor neurons in the primary cortex have a preferred direction is the phenomenon of directional tuning.

Directional tuning refers to the fact that these neurons exhibit a higher firing rate when movement is directed in a specific preferred direction. Studies using single-neuron recordings in animal models have shown that when a monkey or other animals perform motor tasks, such as reaching or grasping objects in different directions, specific upper motor neurons in the primary cortex exhibit increased activity when the movement is in their preferred direction. Microstimulation studies in which small electrical currents are applied to specific areas of the primary cortex have also demonstrated that stimulating different locations can elicit specific movements in particular directions. This suggests that the upper motor neurons in those areas are organized according to a somatotopic map, with specific regions corresponding to different body parts and their preferred movement directions. The presence of directional tuning in upper motor neurons and the ability to elicit specific movements by stimulating different cortical areas provide evidence for the existence of a preferred direction in the primary cortex's upper motor neurons.
for more questions on neurons
https://brainly.com/question/11538106
#SPJ8

Upper motor neurons in the primary cortex have a preferred direction as evidence from the "direction tuning" concept suggests.

The direction tuning concept is based on the observation that the preferred directions of upper motor neurons in the primary motor cortex are not random. They are distributed in a way that makes sense anatomically, indicating that this organization reflects the underlying organization of the musculature.

The direction tuning phenomenon is the strongest evidence for the existence of the preferred direction of upper motor neurons. When the stimulus is delivered in the neuron's preferred direction, it will produce a stronger signal than when it is delivered in a different direction.

In summary, the evidence that suggests that upper motor neurons in the primary cortex have a preferred direction is the direction tuning concept.

To know more about cortex visit:

https://brainly.com/question/5817841

#SPJ11

Your body releases excess heat through evaporation of sweat. Which characteristic of life best explains this process?

Answers

Answer:

excretion is the characteristic that best explains the process

5. A solar cellis a device that collects energy from the sun to make electricity. What part of a plant is most similar to a solar cell and how does it function to provide energy? 6. . How does cell structure suggest cell function?

Answers

Answer:

5. The part of a plant that is most similar to a solar cell is the chloroplast. Chloroplasts are specialized organelles found in plant cells that contain chlorophyll, a pigment that absorbs sunlight. They function in photosynthesis, the process by which plants convert sunlight, water, and carbon dioxide into glucose (a form of energy) and oxygen.

In photosynthesis, chloroplasts capture light energy from the sun and use it to generate chemical energy in the form of glucose. This process occurs in the thylakoid membranes within the chloroplasts, where chlorophyll molecules absorb light energy and convert it into chemical energy through a series of complex reactions. The chemical energy stored in glucose is then utilized by the plant for various cellular processes, including growth, development, and metabolism.

So, just like a solar cell converts sunlight into electricity, chloroplasts in plants harness sunlight to produce chemical energy in the form of glucose.

Cell structure provides important clues about its function. The specific organization and components of a cell determine its capabilities and the tasks it can perform within an organism.

For example, the presence of specialized organelles like mitochondria suggests that a cell is involved in energy production, as mitochondria are responsible for cellular respiration, the process that generates ATP (adenosine triphosphate), the energy currency of cells.

Similarly, the presence of ribosomes indicates that a cell is involved in protein synthesis, as ribosomes are responsible for assembling amino acids into proteins.

The shape and structure of a cell can also suggest its function. For instance, nerve cells have long, branching extensions called dendrites that enable them to receive and transmit electrical signals over long distances. Muscle cells are elongated and contain specialized proteins that allow them to contract and generate force for movement.

Overall, the structure of a cell is intricately related to its function, and by examining its components, organelles, and shape, we can gain insights into the specific roles and capabilities of different cell types within an organism.

Explanation:

Which of the following people is most likely to develop varicose veins?

Which of the following people is most likely to develop varicose veins?
Which of the following people is most likely to develop varicose veins?
Which of the following people is most likely to develop varicose veins?

Answers

Answer:

An overweight, elderly woman who spends most of the day sitting. is correct

Explanation:

A DNA strand has the sequence ACCGAGCTT. Which is the complementary strand of RNA?

A DNA strand has the sequence ACCGAGCTT. Which is the complementary strand of RNA?

Answers

Answer:

the second one

Explanation:

it is UGGCUCGAA

Other Questions
Why did Patriot leaders decide to hold a meeting in Philadelphia Justify the rationale of having two different individuals forthe positions of the chairman and chief executive officer in acompany. Parents, teachers, and mentors should use a variety of different strategies, including book reading and code-focused teaching, in order to stimulate children's: Critics of the medical model of abnormal behavior argue that ADHD reflects a(n) ______.A. social construct rather than a psychological disorderB. psychological disorder rather than a social constructC. example of racial profiling of African-American childrenD. biological disorder rather than a psychological disorder CAN U HELP ME ILL GIVR BRAINLY!!!!!! CHALLENGE ACTIVITY Critical Thinking: Explain What if a new fiber was discovered that replaced cotton in clothing? What effect would this development have on cotton planters? Write a paragraph explaining how falling cotton prices might lead to less demand for farm workers Point I is between points G and H. GH=13 (x-1). IG=16+4x and HI=25. Find GH Write a possible polynomial with the following zeros 2, 3, -4. (Hint: write the function as factors) the graph of a fraction f is shown below After Lindy's team improves their department's data management by implementing rigorous data management processes, _____. Group of answer choices the quality of their data improves as well they realize that they still lack data governance measures to protect security are no longer required key business decisions must be delayed When a liquid freezes its particles get what? What gossip about Gatsby does Nick learn at the party?. the quantitative analysis of each type of acid sites is possible on the basis of extinction coefficients of the bands at 1450 and 1540 cm1. under the conditions where the amount of adsorbed pyridine is constant and no hydrogen-bonded pyridine exists, introduction of water converts lewis acid sites to brnsted acid sites. increase in the integrated absorbance for the band at 1540 cm1 and decrease in the integrated absorbance for the band at 1450 cm1 are observed. the changes in the integrated intensity relate with the absorptivity* (extinction coefficient) for the two bands as expressed by the following equat Sunscreen absorbs ultraviolet light while permitting visible light to pass. Why does this coating reduce the risk of chemical and genetic damage to the cells of your skin A neutral atom has 37 electrons. How many protons does theatom have? Which of these statements correctly describe the result of Mitosis ?????????????????????????????????? What is a risk premium? Multiple choice question. It is additional compensation for taking risk, over and above the risk-free rate. It is the return on risk-free securities. It is a numerical estimate of beta. It is a fee charged to investors by the SEC that allows them to invest in risky securities. kathy is searching education resource complete for her paper about how study abroad programs enhance language skills in college students. her first search (study abroad and students) returned too many results. kathy should: OZFind 4 consecutive odd integers such that the sum of the first and the last is the same as 9 less than the third