How are phytoplankton important to whales?
O A. They are eaten by some whales.
O
B. They provide calcium carbonate for whales.
O
C. They provide the whales with shelter.
о
D. They recycle wastes into materials whales can eat.

Answers

Answer 1

Answer:

A

Explanation:

They are the foundation of the aquatic food web, they get eaten by zooplankton and then they get eaten by fish and whales.

Answer 2
The correct answer would be A

Related Questions

The text describes several organelles in eukaryotic cells that seem to operate like bacterium. What relationship does this suggest between prokaryotes and eukaryotes? This suggests an endosymbiotic relationship between prokaryotes and eukaryotes caused eukaryotes to evolve from prokaryotes. Tell me how this evolution happened and what evidence supports this theory.

Answers

Answer:

Answer

Explanation:

Eukaryotes are the cells that make up our bodies, plants and animals and all cellular organisms that contain their genetic material in a nucleus, have a cytoskeleton and contain organelles, such as mitochondria or cytoplasts. Eukaryotes are thought to have evolved from prokaryotes. Bacteria and archaea are classified as prokaryotes, a group of simple, single-cell organisms. Prokaryotes usually contain a single, circular deoxyribonucleic acid, DNA, molecule and lack a nucleus and intracellular organelles.

what are compulsory vaccinations?​

Answers

Answer:

compulsory Vaccination is the health policy a government adopts in relation to vaccination .

Mendel concluded that one out of every four f2 pea plants is going to be short. How did he perform his experiment to come to that conclusion?.

Answers

Mendel reasoned that one in every four F2 pea plants would be short, so he self-pollinated the heterozygous Tt tall F1 plants. The correct option is 1.

What is Mendelian Principle?

Mendel proposed that the inherited factors must separate into reproductive cells during reproduction.

He'd noticed that allowing hybrid pea plants to self-pollinate produced offspring that looked nothing like their parents.

The principles of Mendelian inheritance were named after and first derived by Gregor Johann Mendel, a Moravian monk who developed his ideas after conducting simple hybridization experiments with pea plants in the nineteenth century.

Mendel reasoned that one out of every four F2 pea plants would be short, so he self-pollinated the Tt tall heterozygous F1 plants.

Thus, the correct option is 1.

For more details regarding Mendelian Principle, visit:

https://brainly.com/question/29526798

#SPJ1

Your question seems incomplete, the missing options are:

A- He self-pollinated the heterozygous Tt tall F1 plants.

B- He cross-pollinated the homozygous TT tall F1 plants.

C- He self-pollinated the homozygous tt short F1 plants.

D- He cross-pollinated the heterozygous Tt tall F1 plants.

The skeleton is comprised of bones, cartilage, ligaments, are all which of the following structures?

connective tissue

erythrocytes

bursae

Triphosphate

Answers

The bones, cartilage, and ligaments that make up the skeleton are all examples of connective tissue components.

In what connective fibres does the skeleton consist?

The main structural component of your body is the skeleton system. It is made up of bones and fibrous tissue, such as ligaments, tendons, and cartilage. Another name for it is the muscular system. There are several different kinds of connective tissue, including elastic connective tissue, dense fibrous connective tissue, and loose connective tissue.

What is the skeleton system's structure?

The axial skeleton and the appendicular skeleton are the two components of the skeletal skeleton. The cranium, vertebrae, ribs, and sternum make up the axial skeleton, which is the body's main structural component. The bones in the limbs make up the appendicular skeleton.

To know more about connective tissue visit:-

https://brainly.com/question/17664886

#SPJ1

monocytes differentiate into _________when the cells migrate to tissues.

Answers

Monocytes differentiate into macrophages when the cells migrate to tissues.

Monocytes are a type of white blood cell that circulate in the bloodstream. They are part of the innate immune system and play a crucial role in defending the body against pathogens and foreign substances. Monocytes are produced in the bone marrow and are released into the blood.

When there is an infection or inflammation in the body, monocytes are recruited to the affected tissues. Once monocytes migrate from the bloodstream into the tissues, they undergo a process called differentiation, where they transform into macrophages.

Macrophages are specialized immune cells that have a wide range of functions. They are involved in phagocytosis, the process of engulfing and digesting foreign particles or dead cells. Macrophages also play a crucial role in antigen presentation, cytokine production, and tissue repair.

The differentiation of monocytes into macrophages is an essential step in the immune response, as macrophages are better equipped to handle pathogens and contribute to the clearance of infections and tissue healing.

learn more about monocytes HERE:

https://brainly.com/question/16975664

#SPJ11

Which zone of the reef is closest to the shore?
The reef____is a zone closest to the shore or the lagoon where the surrounding water is relatively calmer.

Answers

Answer:

https://www.usclassifiedinfo.com/forum/biology/which-zone-of-the-reef-is-closest-to-the-shore

Explanation:

This is where the answer is for the question

back reef

Explanation:

The back reef is the part of the reef closest to shore, while the fore reef is farther out to sea.

what part of the cell cycle represents cell division?
PLEASE HELP

Answers

Answer: The mitotic phase.

Explanation:

The replicated DNA and cytoplasmic contents are separated, and the cell divides.

Explanation:

cell cycle is divided into two phases called as

1)interphase

2)Mphase

interphase= a period of preparation of cell division.

Mphase= the actual period of cell division.

hope it helped you......

How does carbon move through Earth's spheres in the slow carbon cycle? Be sure to include carbon sinks and sources and the movements between them in your explanation.

Answers

Answer:

Respiration is a necessary process conducted by animals and plants in efforts of  getting rid of carbon dioxide. When fossil fuels are burned, that is when the carbon  moves towards the atmosphere. Carbon enters the atmosphere in forms of carbon  dioxide gas when humans burn fossil fuels through processes such as powering  factories and driving cars.

Explanation:

Name the six kingdoms of living things.

Answers

Plants, Animals, Protists, Fungi, Archaebacteria, Eubacteria

Explain to Jean what the possible causes of her poor self concept are

Answers

Ongoing stressful life situation, such as a failed relationship or money problems. Bad treatment, such as being in an abusive relationship, from a partner, parent, or caregiver.

What is a low sense of oneself?

When someone lacks confidence in both their abilities and themselves, they have low self-esteem. They frequently feel inadequate, unwanted, or incompetent. Individuals with low self-esteem frequently worry about making errors or disappointing other people.

Which four variables affect one's self-concept?

Age, sexual orientation, gender, and religion are just a few of the variables that might have an impact on one's self-concept. Moreover, a mix of self-esteem and self-image make up the self-concept.

To know more about treatment visit:-

brainly.com/question/9004624

#SPJ1

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

What is the average rate of change between 50 and 150

Answers

Answer:

Your input: find the average rate of change of f(x)=x2 on the interval [50,150].

The average rate of change of f(x) on the interval [a,b] is f(b)−f(a)b−a.

We have that a=50, b=150, f(x)=x2.

Thus, f(b)−f(a)b−a=(150)2−((50)2)150−(50)=200.

Answer: the average rate of change is 200.

Explanation:

Calculate the average rate of change. x from x = π to x = 2 π (where x is measured in radians). Calculate the average rate of change. Determine the average rate of change for the function below, from t = − 2 to t = 8 . Calculate the average rate of change. Determine the average rate of change for the function below, from x = − 6 to x = − 3 .

What is meant by the statement “ Viruses are cell specific” ?

Answers

Answer:

Viruses can infect only certain species of hosts and only certain cells within that host. The molecular basis for this specificity is that a particular surface molecule

So they are cell specific

Explanation:

Answer:

They only go after certain cells

Explanation:

An example is when virus first attack White Blood Cells when they enter the bloodstream.

Which relationship represents an example of mutualism?

Which relationship represents an example of mutualism?

Answers

Answer:

You are correct :)

Explanation:

What are the specialized structures made from microtubules that are involved in cellular motility?

Answers

The specialized structures made from microtubules that are involved in cellular motility are cilia and flagella. Both cilia and flagella have a similar microtubule-based structure called the axoneme, which is responsible for their movement.

This movement is powered by a motor protein called dynein, which uses ATP to generate force and slide the microtubules against each other, resulting in the bending and motion of these structures.

1. Cilia: These are short, hair-like projections on the surface of some cells. They are made up of microtubules arranged in a 9+2 pattern, meaning there are nine pairs of microtubules surrounding a central pair. Cilia move in a coordinated, wave-like motion to propel substances across the cell surface, such as mucus in the respiratory tract.

2. Flagella: These are longer, whip-like structures extending from the cell surface. Like cilia, flagella also consist of microtubules arranged in a 9+2 pattern. They are involved in the movement of single-celled organisms like sperm cells and certain bacteria by propelling the cell through its environment in a whip-like motion.

Learn more about cilia and flagella here:

https://brainly.com/question/226194

#SPJ11

What is the difference between u.s. customary and metric?

Answers

The customary system is the system of measurement primarily used in the United States. Units in this system include the inch, foot, mile, pound, and cup. The metric system is the system of measurement primarily used in science and in countries outside of the United States.

In the name Staphylococcus aureus, aureus is the Group of answer choices species. domain name. genus. kingdom. family name.

Answers

In the name Staphylococcus aureus, "aureus" is the species. The name consists of two parts: "Staphylococcus," which is the genus, and "Aureus," which is the species.

In the name Staphylococcus aureus, aureus is the species' name. Species is a fundamental unit of biological classification, representing a group of organisms that share similar characteristics and can interbreed to produce viable offspring. The name Staphylococcus represents the genus, which is a group of related species that share common characteristics. The genus is a taxonomic rank used in biological classification, and it is used to group together species that share similar physical, genetic, and evolutionary characteristics.

Learn more about species: https://brainly.com/question/25939248

#SPJ11

The serous membrane is a double-layered membrane created by two separate membranes. True or false?.

Answers

The given statement "The serous membrane is a double-layered membrane created by two separate membranes" is True

This because?

A cavity holding serous fluid separates the two serous membrane layers. This fluid permits organs to move freely across cavity walls including one another while performing their usual duties. The serous membrane is a two-layered membrane made up of two distinct membranes.

Which of the two serous membrane layers?

Each serous membrane is made up of a secretory epithelium layer on top and just a connective tissue layer on the bottom. The mesothelium epithelial layer is made up of a single layer comprising avascular flat nucleated cells (simple squamous epithelium) which it create the lubricating serous fluid.

Why is the serous membrane two layers thick?

In general, the serous membrane forms an airtight seal surrounding the bodily cavity. The mesothelium cells generate glycosaminoglycans and other lubricating compounds. Because of the small layer of fluid here between two distinct membranes, the two mesothelium layers can easily glide across each other.

To know more about serous membrane visit:

https://brainly.com/question/12993358

#SPJ4

Identify each element as existing at STP as solid, liquid, gas, or unknown of bromine

Answers

The element as existing at STP as solid, liquid, gas, or unknown of

Bromine at STP: Liquid.

What is Bromine?

Bromine is a chemical element with symbol Br and atomic number 35. It is a member of the halogen group, and is the second-lightest halogen after fluorine. Bromine is a pale reddish-brown liquid at room temperature and has a strong, disagreeable odor. Bromine is highly reactive, and is used as a source of reactive radicals in organic synthesis. It is also a potent oxidizing agent, and is used mainly in compounds such as bromates and bromides. Bromine is found naturally in the environment in seawater and in some salt deposits. In animals, it is present in trace amounts in the blood and is essential for proper thyroid function.

To learn more about Bromine

https://brainly.com/question/30396586

#SPJ9

What are Tectonic Plates made of and what do they do?

Answers

Answer:

They move

Explanation:

Answer:

A tectonic plate (also called lithospheric plate) is a massive, irregularly shaped slab of solid rock, generally composed of both continental and oceanic lithosphere.Plate tectonics move because they are carried along by convection currents in the upper mantle of the planet (the mantle is a slowly flowing layer of rock just below Earth's crust). Hot rock just below the surface rises and when it cools and gets heavy, it sinks again.

Explanation:

1. A car traveled at 75 km/h for 3.0 hours. How far did it travel?

2. Joseph walked 4.0 km/h .How long did it take him to travel 12 km?

Answers

Answer:

1. The car traveled 225km in 3 hours

2. It took him 3 hours to travel 12 km



According to Figure 9 of Chapter 14, approximately how many amino acid differences are
there between
a duck and a pig?
(1 Point)

Answers

32 amino acid particles

Answer:

No differences!

Explanation:

There are approximately 22 amino acids and whilst the pig can synthesise the majority of these, there are a number it cannot.

Ducks are from bird origin which mainly consists of 22 amino acids.

Therefore there are no differences between amino acid in a pig and duck.

Imagine you accidentally knocked a vase off a table and onto the floor. Describe the forces that would act on the vase before and during its fall!​

Answers

The forces which acts on the vase before the fall include:

Force exerted by the table.Force of gravity.Drag

What is Force?

This is described as an influence which changes the motion of an object. The force exerted before motion is that which is exerted by the table , drag and force of gravity.

During fall, all other forces act except that exerted by the table thereby making it the most appropriate choice.

Read more about Force here nhttps://brainly.com/question/12970081

A good example of a natural phenomena causing geographical isolation is the
-Mississippi River
-Sahara Desert
-Grand Canyon
-Great Pyramid​

Answers

Answer:A

Explanation:because

Please Help its Biology

Please Help its Biology
Please Help its Biology

Answers

Picture 1: digestive
Picture 2: integumentary
Picture 3: integumentary
Picture 4: circulatory
Picture 5: immune
Picture 6: muscular
Picture 7: reproductive
Picture 8: reproductive
Picture 9: respiratory

Are there any parts of the human body that get oxygen directly from the air and not from the blood? Are there nuclear reactions going on in our bodies?​

Answers

Answer:

The cornea is the only part of a human body that has no blood supply; it gets oxygen directly through the air. The cornea is the fastest healing tissue in the human body, thus, most corneal abrasions will heal within 24-36 hours.

Nuclear reactions do indeed occur in the human body, but the body does not use them.

where in the respiratory tract is the air filtered warmed and moistened

Answers

Answer:

The nose

Explanation:

The air is warmed, moistened and filtered by mucous secretions and hairs in the nose. The larynx sits at the top of the trachea. It contains your vocal cords. Each time you breathe in or inhale, the air passes through the larynx, down the trachea and into the lungs.

Neurotransmitters can be blocked which
disrupts the __ impulse from traveling
through the target neuron.

A. synthetic
B. electrical
C. somatic
D. chemical

Answers

Neurotransmitters use electrical impulses to send signals/ rely info so the answer should be “B”.
the answer should be B.

the shivering mechanism in bumblebees often serves the same purpose as it does in mammals. during which conditions will the action of shivering most help a bumblebee to maintain homeostasis?

Answers

To raise the temperature of the flight muscles sufficiently to allow flight, the bumblebee shivers, much like we do when we are cold.

This is visible in a grounded bee, as her abdomen pumps to ventilate the flight muscles.

Shivering in bumblebees frequently serves the same purpose as it does in mammals: to maintain homeostasis. A lot of pests invade farms and destroy the crops that are present there, resulting in poor sales and, in the long run, revenue loss. It has been critical to eradicate these harmful pests that used to destroy crops just before they completely destroyed the plant.

Biological pest control entails using living organisms to reduce or eliminate pests on farms. Aphid, for example, derives its nutrition from sugary substances found in plant stems and leaves.

Learn more about " homeostasis " to visit here;

https://brainly.com/question/12221049

#SPJ4

Veins take blood back to the heart. Which gas would be most abundant in a vein that takes blood from muscle cells in the arm back to the heart?

carbon dioxide

oxygen

nitrogen

hydrogen

Answers

The correct answer is carbon dioxide

Carbon dioxide is the most abundant in a vein that takes blood from muscle cells in the arm back to the heart.

What is a Vein?

This is a blood vessel which carries deoxygenated blood towards the heart for oxygenation.

After which the arteries carry the oxygenated blood away from the heart to other parts of the body.

Read more about Vein here https://brainly.com/question/519036

Other Questions
In which triangle is the value of x equal to tan1(startfraction 3.1 over 5.2 endfraction)? (images may not be drawn to scale.) What is the location of D on the decimal number line below?Write your answer as a decimal.D2? A model of a car is built with a scale of 1 inch : 4 feet. If the length of the model car is 2.7 inches, then the length of the actual car is how many inches? What is the greatest common factor of 27 and 46? The probability that a male will be color-blind is .042. find the probabilities (to six decimal places) that in a group of 53 men, the following are true. (a) exactly 5 are color-blind. (b) no more than 5 are color-blind. (c) at least 1 is color-blind. Find all real square roots of 36 need fastSimplify the expression.the expression negative three fifths times k minus 9 plus the expression 6 plus one fourth times k negative 7 over 20 times k plus negative 3 7 over 20 times k plus negative 3 negative 2 over 9 times k plus negative 15 negative 17 over 20 times k plus negative 15 Parts of the Present-Day Marine Ecosystem Know each cratonicsequence. Know when it happened, and major identifyingcharacteristics: o Absaroka Sequence What is a "cyclothem"? In this problem, assume Newton's Law of Heating/Cooling applies. A pot with liquid at 23 C is placed in a cooler held at 2 C, and after 4 minutes the temperature drops to 19 C. How long until the liquid becomes 5 C? Give your answer to the nearest minute. An environmental research firm wants to estimate the proportion of cars in Jackson County, Missouri that would be considered SUVs. Using the county's vehicle registration records they randomly select 220 vehicles. From that list they determined that 90 of them were SUVs. The sample proportion is 0.409, and the 95% confidence interval for the proportion of cars in Jackson County that are SUVs is (0.344, 0.474). Select all of the following which would produce a confidence interval with a larger margin of error.If you created a 90% confidence interval instead of the 95% confidence interval the margin of error would?Answer 1If you had a random sample of 98 vehicles instead of 220 the margin of error would?Answer 2If you created a 99% confidence interval instead of the 95% confidence interval the margin of error would?AnswerIf you had a random sample of 320 vehicles instead of 220 the margin of error would? 1. Which option correctly describes the reactants and products of a chemical reaction?A The mass of the reactants must be equal to the mass of the products. The total number of moles of the reactants can be more or less than the total number of moles of the products.B The mass of the reactants can be more or less than the mass of the products. The total number of moles of the reactants must be equal to the total number of moles of the products.C The mass of the reactants can be more or less than the mass of the products. The total number of moles of the reactants can also be more or less than the total number of moles of the products.D The mass of the reactants must be equal to the mass of the products. The total number of moles of the reactants must also be equal to the total number of moles of the products. Element x decays radioactively with a half life of 13 minutes. If there are 830 grams of element x, how long, to the nearest tenth of a minute, would it take the element to decay to 45 grams?. Is This A Function??Will Give Crown!! helpppp asappppjdhsduahbdjdskajdksd A bacteria culture contains 1500 bacteria initially and doubles every hour. Find a function N that models the number of bacteria after t hours. Write out how many bacteria there will be for t = 0, 1, 2, etc. and think about how you are getting those values. Write to or too.I Im looking ___ buy my hamster a new cage.10points. No bit links or any links that dont work plz. What does this excerpt suggest about the importance of memories? I would appreciate the help on this problem. Three consecutive odd numbered lockers sum 711. What is the first locker in the group? The chart below shows the price of 4 different spaghetti sauces and how many ounces are in each jar. Determine which brand is the cheapest per ounce. Brand Ounces PriceMama Rossi's 26 $6.76Roma's Recipe 28 $7.28Marinara Marvel 30 $7.50Sammy's Sauce 32 $8.32 Started / poet / missing / her / after / photograph / her / mother / seeing