How does a monocot root differ from a dicot root? (select all that apply)
A. pith at the center of the vascular cylinder
B. xylem at the center of the vascular cylinder
C. fibrous root system
D. taproot system

Answers

Answer 1

Answer:

Angiosperms, flowering plants, are divided into two groups: monocots and dicots.

Features of monocot and dicot plants. Images from Purves et al., Life: The Science of Biology, 4th Edition, by Sinauer Associates (www.sinauer.com) and WH Freeman (www.whfreeman.com), used with permission.

Monocot seeds have one "seed leaf" termed a cotyledon (in fact monocot is a shortening of monocotyledon). Dicots have two cotyledons. Both groups, however, have the same basic architecture of nodes, internodes, etc.

Comparison of monocot (left, oat) and dicot (right, bean) gross anatomy. Image from Purves et al., Life: The Science of Biology, 4th Edition, by Sinauer Associates (www.sinauer.com) and WH Freeman

Explanation:

PLS

MARK

AS

BRAINLIEST


Related Questions

How do ribosomes create a mutation & how is this mutation controlled?

Answers

Ribosomes do not directly create mutations, but cellular mechanisms such as DNA repair and checkpoints help control and minimize the occurrence of mutations.

Ribosomes themselves do not directly create mutations. Mutations, which are changes in DNA sequence, can occur due to errors during DNA replication or from external factors like radiation or certain chemicals. However, the cellular machinery, including ribosomes, plays a role in the control of mutations through various mechanisms. DNA repair mechanisms help identify and correct errors or damage in the DNA sequence, reducing the likelihood of mutations. Additionally, cellular checkpoints and regulatory processes monitor and control cell division, ensuring that accurate DNA replication and distribution occur, minimizing the inheritance of mutations to daughter cells.

Learn more about ribosomes mutation

https://brainly.com/question/2517861


Which statement bestexplains the effect an adaptation has on an organism?
It increases an organism's chance to survive.

It increases an organism's size and weight.

It decreases an organism's chance to reproduce.

It decreases an organism's ability to find food.

Answers

A trait that evolved and was selected by natural selection for its current function is known as an adaptation. Any hereditary traits that improve an organism's likelihood of survival benefit from adaptations. Option C is the appropriate response in this case.

In order to survive in their environment and function better under the conditions there, plants and animals have modified their physical characteristics or behaviours. The strongest and most advantageous traits or adaptations are handed on to the following generation, ensuring the survival of the plants or animals. Examples of adaptations include a camel's capacity for water storage, polar bears' use of their white fur to blend into the ice, and chameleons' capacity to change colour to evade predators. The process of change that occurs to animal and plant species over a long period of time, or how plant and animal species have evolved from one another, is known as evolution.

Therefore, we can conclude that adaptations aid any hereditary traits that improve an organism's chances of survival.

LEARN MORE ABOUT EVOLUTION HERE:

https://brainly.com/question/13492988

#SPJ1

Why you think the human population has been to grow so much in the last 500 years. what are some of the things that have allowed this to happen​

Answers

more housing, better healthcare,

Which isn’t an example of a matrix in which organisms may become fossilized

Answers

Answer:

where's the options for this question?

Answer:

:/

there is no option?? ?

how does the gulf stream affect the air masses above ocean water

Answers

Answer:

Locally, particularly off the coast of North Carolina, the Gulf Stream can affect water temperatures, providing warmer ocean waters and balmy days, even in the height of fall and winter.

Explanation:

The Gulf Stream affects the air masses above ocean water by:

Providing the ocean with warmer waters even during cold seasons

The Gulf Stream is known as the strong current which occurs along the coast of Florida where there are warmer temperatures in the cold seasons and cooler temperatures in the warm seasons.

As a result of this, the Gulf Stream affects the air masses which are above the ocen water by making sure that the weather is more pleasant no matter the season of the year and it has also extended to parts of Europe.

Read more here:

https://brainly.com/question/17483768

compares and contrasts transformation, transduction, and conjugation

Answers

Answer:

In transformation, a bacterium takes up a piece of DNA floating in its environment. In transduction, DNA is accidentally moved from one bacterium to another by a virus. In conjugation, DNA is transferred between bacteria through a tube between cells.

Explanation:

help?ill mark brainlist

help?ill mark brainlist

Answers

Answer:

b seems r8 answer.........

your answer is B!!!!

A layer of cells called the endodermis surrounds the stele. Xylem is found towards the center of the stele and phloem towards the outside of the stele. 18) How does this compare to their arrangement in the stem? 19) The meristematic region is protected in the root by the presence of a root cap. How is the meristematic region protected in the stem tip? 20) In which of these regions would you expect to find the specialized cells of vascular tissue? 21) In which of these regions are the cells genetically identical? 22) Why?

Answers

Answer:

Epidermis layer is responsible for the protection of meristematic region.

Explanation:

Meristematic region is protected in the stem tip by epidermis which consist of dead layer of cells. Epidermis is the outer layer of stems, leaves, flowers and fruits which is responsible for the protection of inner part from damage. Vascular bundle such as phloem present near the boundary of the stem while the xylem is present in the inside of the stem. In the inside layer of the stem, all the xylem cells are genetically identical while the layer that is present at the edge of the stem is phloem in which all the cells are  genetically identical to each other.

What are the sources of energy for the providers of Chemical compound

Answers

Answer:

Experience gained from over 20,000,000 operating hours. Clean energy production with biomass gasification. wood gasifier. Combined heat and power. Biomass CHP. biomass gasification.

Answer:

1. Natural Gas

2. Natural Gas Liquids

3. Heavy Liquids

4. Electricity

5. Coal

6. Liquefied Petroleum Gas

e.t.c

Sperm is produced in the?

Answers

Answer:

testis

Explanation:

produced from the testicals

Answer:

testis

Explanation:

produced from the testicals

How would you explain the key concepts for the CWA in less than two minutes?

Answers

Answer:

Explanation:

vPoint Source - a source of water discharged to surface water through a discrete point - generally through a pipe, ditch, or channel.

Nonpoint Source - Nonpoint sources, such as parking lots or athletic fields, discharge runoff water to groundwater or surface water; runoff does not come from  a pipe, ditch, or channel. These sources may contain pollutants such as pesticides, motor oil, and soaps.

Navigable Waters of the United States  For the purposes of the Clean Water Act, the term "navigable waters" includes:

all waters used in commerce, including groundwater;

all interstate waters including wetlands, mudflats, and sand-flats; and

all other waters such as lakes, rivers, streams, wetlands and sloughs.

EPA policy states, "The majority of facilities in the U.S. have the potential to discharge to navigable waters."  The Supreme Court decision in (2006) requires the Army Corps of Engineers and the EPA to determine whether there is a "significant nexus" between a navigable waterway and an area a spill might affect.  In June of 2007, EPA and the Army Corps of Engineers released provisional interpretive guidance regarding the "significant nexus” question. According to this guidance, the agencies will assert jurisdiction over traditional navigable waters, wetlands adjacent thereto, and relatively permanent tributaries thereof. The agencies will generally not assert jurisdiction over swales and ditches that lack routine water flow. Finally, the agencies will apply the "significant nexus" requirement and make a case-by-case, fact-specific analysis on impermanent tributaries and other wetlands.

Additional executive orders were issued 2015 in 2019.  Under the 2019 proposal, traditional navigable waters, tributaries to those waters, certain ditches, certain lakes and ponds, impoundments of jurisdictional waters, and wetlands adjacent to jurisdictional waters would be federally regulated. It also details what are not "waters of the United States," such as features that only contain water during or in response to rainfall (e.g., ephemeral features); groundwater; many ditches, including most roadside or farm ditches; prior converted cropland; stormwater control features; and waste treatment systems.

Could the requirement for one or more NPDES Discharge Permit apply to my campus?

If your campus discharges pollutants directly to navigable waters of the United States through a point source, you must obtain an NPDES permit or redirect the flow of the waste.

Stormwater releases from certain activities require an NPDES permit. The most common activities on college campuses requiring NPDES permits for stormwater are construction activities disturbing more than 1 acre, hazardous waste storage areas operating under the Resource Conservation and Recovery Act permit system, steam-generating power plants, and airports. See Stormwater section below.

Regulations issued by local water authorities, or Publicly Owned Treatment Works (POTWs), not NPDES permits, govern discharges into sanitary sewer systems. See Sewer Use (POTW) section below for more information about requirements for using POTWs for commercial or industrial waste disposal.

What do I have to do related to NPDES Discharge Permits?

Determine where wastewater flows from buildings and processes on your campus. Any industrial or commercial operation (e.g., ice rink melt pits, floor drains, and vehicle wash stations) that discharge into a water of the United States may require an NPDES permit. If required, you must obtain such a permit from the appropriate regulatory agency, probably your state environmental agency.

French drains, dry wells, and septic system leach fields are different from point source discharges because they do not immediately affect surface water. Some state and federal environmental agencies manage these systems under the Underground Injection Control program, part of the Safe Drinking Water Act. See Safe Drinking Water Act for more information.

Details of NPDES

An ecological term that best describes the picture below would be
A. organism
B. population
C. community
D. ecosystem

An ecological term that best describes the picture below would beA. organismB. populationC. communityD.

Answers

An ecological term that best describes the picture below would be community. Thus, option C is correct.

In science, a community, also known as a biological community, is a conversing source of numerous species in a centralized place.

A biological community, for example, is a forest of trees and undergrowth plants inhabited by animals and rooted in soil containing bacteria and fungi.

Strong communities are crucial because they are a source of social connection and a sense of community for many people.Participating in a community united by attitudes, values, and goals is a necessary component of living a fulfilling life.

It includes elements like image, spirit, character, and pride, as well as processes like interaction, inter-group interaction, and networking. A community is made up of individuals with diverse interests, experiences, and backgrounds.

Thus, the correct option is C, as per the given scenario.

For more details regarding community, visit:

brainly.com/question/24220431

#SPJ2

what does it mean if urine is cloudy? ​

Answers

Answer:

If you notice that your urine looks cloudy instead of its usual clear, yellowish color, it could be due to infections, kidney stones, or other changes in your health. Sometimes pain or other symptoms go along with it. The sooner you learn the cause, the quicker you can get the treatment you need.

Explanation:

I’m am unsure of the steps to solve this and what to get for the answer

Im am unsure of the steps to solve this and what to get for the answer

Answers

Protein synthesis is the process by which information is taken from DNA, passed to RNA by a process called transcription and finally to protein by another process called translation.

Mutation 1

5' AGTTTGCACTTGTAGAGGATGAAGCCGCACGTACATCA 3'

Mutation 1 (transcription): With RNA we use uracil instead of thyimine. We also use the reverse complementary sequence. Since transcription occurs from 3' to 5'.

3' UCAAACGUGAACAUCUCCUACUUCGGCGUGCAUGUAGU 5'

Same sequence but from 5' - 3':

5' UGA-UGU-ACG-UGC-GGC-UUC-AUC-CUC-UAC-AAG-UGC-AAA-CU 3'

Mutation 1 (translation) Finally, the translation occurs from 5' to 3' and we can known the protein sequence using the next table:

Stop-Cys-Thr-Cys-Gly-Phe-Ile-Leu-Tyr-Lys-CysLys

It should be noted that each chain will give rise to different amino acid sequences.

Im am unsure of the steps to solve this and what to get for the answer


A car starts from rest and gains a velocity of 20 m/s in 10 s. Calculate acceleration and average velocity. ​

Answers

The acceleration of the car is 2 m/s².

The average velocity of the car is 2 m/s.

How to calculate acceleration ?

The equation acceleration = (final velocity - beginning velocity) / time can be used.

Given:

Initial velocity (u) = 0 m/s (since the car starts from rest)

Final velocity (v) = 20 m/s

Time (t) = 10 s

Using the formula, we can substitute the values:

acceleration = (20 m/s - 0 m/s) / 10 s

acceleration = 20 m/s / 10 s

acceleration = 2 m/s²

Therefore, the acceleration of the car is 2 m/s².

You can use the following equation to determine the average velocity: average velocity = total displacement / total time.

The initial position and the final position are identical since the automobile begins at rest. As a result, the displacement and the ultimate position are equal.

Given:

Displacement = 20 m

Time (t) = 10 s

Using the formula, we can substitute the values:

average velocity = 20 m / 10 s

average velocity = 2 m/s

Therefore, the average velocity of the car is 2 m/s.

Learn more about substitute here : brainly.com/question/26094713

#SPJ1

How might overfishing lead to more shark attacks?
There are fewer fish, so sharks are hungry.
Sharks become angrier toward humans.
People who eat seafood smell like fish.
Attacks only occur against fishing boats.

Answers

There are fewer fish so sharks are hungry

How does energy move through photosynthesis?

Answers

Answer:

Energy from the sun is absorbed by the chloroplasts in the leaves of a plant. The light energy is converted into chemical energy as the chloroplasts use the light to power the production of glucose from carbon dioxide and water. The glucose is used by the plant to produce energy and build new cells, and any excess glucose is stored as starch. Oxygen is also released as a by-product of photosynthesis.

Answer:

Explanation:

certain organisms convert solar energy (sunlight) into chemical energy, which is then used to build carbohydrate molecules. The energy used to hold these molecules together is released when an organism breaks down food. Cells then use this energy to perform work, such as cellular respiration.

three major functions of leaf.​

Answers

Answer:

Photosynthesis.

Transpiration.

Photosynthesis.

Explanation:

B. How does an Amoeba get its nutrition?
If answered correctly will be marked as brainliest.​

Answers

Answer

Nutrition in an Amoeba occurs through a process called phagocytosis 

Explaination

where the entire organism pretty much engulfs the food it plans on eating up. ... It involves the ingestion, digestion and egestion of food material. Amoeba does not have any specialized organ for nutrition.

The part of the cell that contains the living substance of the cell, excluding the nucleus, is the _____. cell membrane cytoplasm nucleus cell wall

Answers

Answer:

protoplasm, the cytoplasm and nucleus of a cell. The term was first defined in 1835 as the ground substance of living material and, hence, responsible for all living processes.

Answer:

cytoplasm

Explanation:

do you think cloning animals is a good thing? why or why not? (there is no right answer its your opinion)

Answers

No because mutations can lead to bad things

The best way to prevent shigellosis is

Answers

Answer: The best was to prevent the spread of Shigella is through basic personal hygiene and frequent handwashing.

Explanation: You should wash hands with soap carefully, especially after going to the bathroom, before preparing foods, and after changing diapers. Toddlers and small children should be supervised for proper handwashing.

Would the carrying capacity of an area for a species be effected by the other species that live in the same area?

No, each species is separate.
Only if the two species share food.
Only in the winter when food and shelter are more scarce.
Yes, all the populations in a community effect each other.

Answers

Answer:

I would say yes, all the populations in a community affect each other.

Explanation:

In biology, the concept of carrying capacity pertains to the number of organisms that can survive in a certain environment based upon their resources. So, if the species relies on the other species that live within the same environment, it would obviously affect that species.

What is the best to say about a runner who is running at a constant velocity

Answers

Answer and Explanation: Because the runner is running at a constant velocity, the velocity is not changing, this means the rate of change of velocity would be 0. So the answer is c) Their acceleration is zero.

:) Have a nice day^^

what is the main purpose of the pupil

Answers

Answer:

to adjust how much light is let into the eye

Explanation:

Answer:

The pupil is where light enters the eye. How much light is controlled by the iris which surrounds the pupil and opens and closes it like a camera lens aperture.

A plate on which
food is eaten.
This is my paper and if it is wrong just text me

A plate on whichfood is eaten.This is my paper and if it is wrong just text me

Answers

Answer:

dish

Explanation:

Answer:

dish

Explanation:

coz dishes are the only housewares that food can be served in

Do you think that the tryptophan in turkey is primarily responsible for making you sleepy after your Thanksgiving meals? Why or why not? (Does not necessarily need to be a yes or no answer!)​

Answers

The tryptophan in turkey is responsible for making someone sleepy after eating the meal, as the tryptophan can make the neurotransmitter serotonin, which is responsible for a good night's sleep.

What is the effect of eating foods containing tryptophan?

Tryptophan is an amino acid found in protein-rich foods, and it is responsible for the neurotransmitter serotonin, which controls sleep quality and promotes sleep by increasing the synthesis of serotonin in the brain, which can help to improve mood and relaxation.

Hence, the tryptophan in turkey is responsible for making someone sleepy after eating the meal, as the tryptophan can make the neurotransmitter serotonin, which is responsible for a good night's sleep.

Learn more about the amino acid tryptophan here.

https://brainly.com/question/28347414

#SPJ1

Many dietary supplements contain digestive enzymes the manufacturers claim are necessary to digest food properly. What will happen to these enzymes in the stomach? (Hint: Enzymes are proteins.) Will the enzymes continue to function once they have reached the small intestine? Why or why not?

Answers

The enzymes which are found in food supplements will be denatured in the stomach and lose their activity.

What are digestive enzymes?

Digestive enzymes are enzymes which aid in the process of digestion in the body.

The body produces the digestive enzymes required for the digestion of food.

Due to the acidic nature of the stomach, digestive enzymes in the stomach are synthesized as proenzymes to prevent denaturation.

Therefore, the enzymes which are found in food supplements will be denatured in the stomach and lose their activity.

Learn more about enzymes at: https://brainly.com/question/1596855

How are the animals in the Kingdom Animalia classified? Your answer should include groupings from both traditional methods (based on morphology) as well as molecular phylogenies (based on genetics).

Answers

There are six additional tiers of classification for the creatures in the kingdom Animalia based on comparable traits. The phylum, class, order, family, genus, and species fall under this category.

What is meant by Kingdom Animalia?Members of the Kingdom Animalia, commonly known as the Metazoa, include all living things. The Kingdom Monera, which contains bacteria and blue-green algae, and protists do not exist in this one (Kingdom Protista, includes unicellular eukaryotic organisms).Kingdom Animalia is a taxonomic kingdom that includes both living and extinct animals. Eukaryotic, multicellular, heterotrophic, without a cell wall, and primarily motile organisms make up this kingdom's members. Non-chordates comprise the phyla Porifera, Coelenterata, Ctenophora, Platyhelminthes, Aschelminthes, Annelida, Arthropoda, Mollusca, Echinodermata, and Hemichordata. Non-Chordates have the following characteristics generally: These are cylinder-shaped, triploblastic, coelomate, or pseudocoelomate creatures.Fish, amphibians, reptiles, mammals, and birds make up the five common classes of the phylum chordata, or group of vertebrate creatures.

To learn more about Kingdom Animalia, refer to:

https://brainly.com/question/26907358

Why is it so important for animals to keep the concentration of their body fluids constant

Answers

Answer:

Organisms in aquatic and terrestrial environments must maintain the right concentration of solutes and amount of water in their body fluids; this involves excretion (getting rid of metabolic nitrogen wastes and other substances such as hormones that would be toxic if allowed to accumulate in the blood) through organs.

Explanation:

Other Questions
what is the irony of duncan admiring the castle in act i of shakespeare's macbeth? Solving systems of linear equations by substituting an expression for a variable and then solving for the other variable is called ___. FILL IN THE BLANK. the ____ is defined as the total rate of change in a population's size per unit of time. which of the following is a true statement? while researchers found it difficult to reject the random walk hypothesis for exchange rates on empirical grounds, there is no theoretical reason why exchange rates should follow a pure random walk. while researchers found it easy to reject the random walk hypothesis for exchange rates on empirical grounds, there are strong theoretical reasons why exchange rates should follow a pure random walk. while researchers found it difficult to reject the random walk hypothesis for exchange rates on empirical grounds, there are compelling theoretical reasons why exchange rates should follow a pure random walk. none of the options read these sentances from patrick henrysspeech to the convention of delegates of how does he structure the arguement to make it clear and convincing What are the essential elements that must be proved before compensation may be awarded to Sethiena in terms of COIDA. Pls pls pls I need help for 25 and 26 before midnight!! Tax Drill - Corporate NCG or NCL Complete the following statements regarding the treatment of a corporation's net capital gain or loss. For corporations there net capital gain alternative tax rate. permitted against ordinary taxable income. Corporations may carry back net capital losses as capital losses for years; if losses still remain after the carryback, the remaining losses may carry forward 36. which of the following is a major goal of the program begun in 1995 to reintroduce the gray wolf into yellowstone national park? ASAP PLEASE!!!B. Complete the drawing for the sample reaction below to show the law of conservation ofmass, when XY is produced.+-> The amount of available energy changes between the trophic levels found in a food chain or energy pyramid. A food chain. Arrows point from one stage to the next. The stages are leaves, mouse, snake, hawk. Photos (left to right) by Mehmet Karatay, Jens Buurgaard Nielsen, Furryscaly, and Walter Siegmund How would the amount of available energy differ in the trophic level of the mouse compared to the trophic level of the hawk? a. Available energy would increase from the mouse to the hawk. B. Available energy would decrease from the mouse to the hawk. C. Available energy would initially increase from the mouse to the hawk, and then decrease over time. D. Available energy would remain the same from the mouse to the hawk. Please select the best answer from the choices provided A B C D. Which statements about the graphs of functions g(x) = 4x and f(x) = x are true? Select all that apply.A. g is wider thanB. fand g open in the same directionC. fand g have the same vertexD. fand g have the same axis of symmetry At 25C, HI breaks down very slowly to form H2 and I2. The rate law is given by rate = k[HI]2 and k at 25C is 2.4 10-21 L/mols. If 0.0100 mol of HI (g) is placed in a 1.0-L container, how long will it take for the concentration of HI to reach 0.00900 mol/L? a cup of sugar has a volume of 237.0mL. What is the mass of the cup of sugar if the density is 1.59g/mL? The stemplot is a quick way to graph data and gives an exact picture of the data. You want to look for an overall pattern and any outliers. An outlier is an observation of data that does not fit the rest of the data. It is sometimes called an extreme value. When you graph an outlier, it will appear not to fit the pattern of the graph. Some outliers are due to mistakes (for example, writing down 50 instead of 500) while others may indicate that something unusual is happening. It takes some background information to explain outliers, so we will cover them in more detail later.The data are the distances (in kilometers) from a home to local supermarkets. Create a stemplot using the data: 1.1; 1.5; 2.3; 2.5; 2.7; 3.2; 3.3; 3.3; 3.5; 3.8; 4.0; 4.2; 4.5; 4.5; 4.7; 4.8; 5.5; 5.6; 6.5; 6.7; 12.3 Do the data seem to have any concentration of values? translate some lessons to spanish do you think trading with Asia and Africa worth the difficulty? The price index was 120 in Year 1 and 126 in Year 2. What was the inflation rate Find a parametrization of the boundary curve as with positive orientation if 1. Sis the part of the surface of the paraboloid z = 6 - X^2 - y^2 above the plane z=-3 with a normal vector pointing upward. a (6 cos(t), V6 sin(t), 0) b (46 cos(t), 46 sin(t), -3) C (3 cos(t), 3 sin(t), -3) d (3 cos(t), 3 sin(t), -3) e (3 cos(t), 3 sin(t),0) a sequence of natural numbers is constructed by listing the first 4, then skipping the next 5, skipping 2 listing 6, skipping 3, and, on the nth iteration, listing n 3 and skipping n. the sequence begins 1,2,3,4,6,7,8,9,10,13. what is the 500,00th number in the sequence?