How does a virus cause other viruses to form?

Answers

Answer 1
Viruses infect a host by introducing their genetic material into the cells and hijacking the cell’s internal machinery to make more virus particles.

Related Questions

Look at sucrose, a disaccharide, and cellulose, a polysaccharide, on the carbohydrate page. How do you think these two molecules were formed?

Answers

Answer:

don't worry i help you

Explanation:

Glucose and fructose are linked to form sucrose.

Cellulose is a polymer of glucose.

Sucrose and cellulose monomers are linked through a glycosidic bond to form disaccharides and polysaccharides respectively.

9. Estimate (your best guess) what percent of the Amazon jungle is indigenous territory.

Answers

Answer:

Approx. 35%

Explanation:

Inside the Amazonian forest, over 3,000 indigenous domains have been established. 35 percent of the Amazon forest reflects these regions. 49.4 % of the ecosystem seems to be under form of control and conservation when nature reserves are applied to this figure.

Where does diffusion in the kidney diffuse from and where does it diffues to?

Answers

Answer:

Being Passive in the Kidney. Firstly, small soluable molecules can passively diffuse into the liquid in Bowman's Capsule from the Glomerulus. These molecules are usually molecules of glucose, urea, salts and water and diffuse from the capillaries into the solution of plasma without the use of energy.

Explanation:

have good day

Male organisms are more susceptible to genetic disorders linked to the sex chromosome then female because they have _______, and therefore, the law of dominance doesn’t apply

Answers

Because male creatures contain X and Y chromosomes, which are sex chromosomes, the law for dominance does not apply to them and they more susceptible to sex-related genetic diseases than female species.

Why are sex-related features more prevalent in males than females?

Males only inherited one X chromosome, hence they only have one chance to receive the "good" allele because females contain two versions of an x-linked allele whereas males only carry one. Males are more likely than females to exhibit X-linked characteristics.

Why are sex-related genetic diseases exclusively inherited by women?

That's because X-linked diseases are typically brought on by a lack of functional copies of a gene found on the X chromosome. Males are born with just one X chromosome. Hence, they just require one malfunctioning .

To know more about chromosomes visit :

https://brainly.com/question/1596925

#SPJ1

100 points + brainlist
Jim is investigating the idea that the transfer of thermal energy when two components of different temperature are combined within a____ He uses a calorimeter to accurately measures the transfer of thermal energy by measuring changes in the ____of the system. The calorimeter allows him to study how the temperature changes when mixing liquids at different initial temperatures as well as how it changes when adding objects at different temperatures to water. In both. cases the____ substance transfers thermal energy to the____ until the substances reach____ Place the terms below in order that they should appear in the paragraph above.
temperature
closed system
cooler
warmer
equilibrium ​

Answers

Jim is investigating the idea that the transfer of thermal energy when two components of different temperature are combined within a closed system. He uses a calorimeter to accurately measures the transfer of thermal energy by measuring changes in the temperature of the system. The calorimeter allows him to study how the temperature changes when mixing liquids at different initial temperatures as well as how it changes when adding objects at different temperatures to water. In both cases, the warmer substance transfers thermal energy to the cooler until the substances reach equilibrium.

What is the transfer of thermal energy about?

Investigating the transfer of thermal energy when two components of different temperature are combined within a closed system involves studying how heat flows between the two components until they reach thermal equilibrium.

Hence,  In a closed system, the total energy remains constant, but the energy can be transferred between the components in the form of heat. This process is governed by the laws of thermodynamics, which describe the relationships between heat, energy, and work.

Learn more about thermal energy  from

https://brainly.com/question/9459470

#SPJ1

Answer:

anyone yanking their thang rn

Explanation:

dige
Background
Layout -
Theme
Transition
8
4
1.1.5
A Closer Look at:
PHOTOSYNTHESIS
Vocabulary
Picture What it means
Word
carbon dioxide

Answers

Answer:

che

Explanation:

cvdfsdfsfs che

what is inferior to tibia​

Answers

Answer:

The bottom (inferior) of the tibia rests on the top and to the medial aspect of the talus. The fibula rests on the lateral portion of the tibia against the fibular notch and extends down over the talus. The three bones make up the largest part of the ankle.

Explanation:

Which of these is not an advantage of genetically engineered crop plants?

A. They can produce their own pesticides.
B. They can grow larger than unmodified crops.
C. They cannot cause an allergic reaction.
D. They can contain extra nutrients.

Answers

Answer:

   b

Explanation:

GMO foods are designed to be healthier and cheaper to produce. The advantages of GMO foods include added nutrients, fewer pesticides, and cheaper prices. Disadvantages of GMO foods can be allergic reactions or increased antibiotic resistance

True or false the carrying capacity is the minmum number of individuals in a species that an environment can support

Answers

Its true!! If you look it uo theres many facts supporting the claim

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

what are the reactants of reaction b

Answers

What is reaction b being portrayed as? There’s no image

In the late 1980s and early 1990s, the percentage of Icelandic children whose bacterial infections were caused by bacteria resistant to penicillin rose at an alarming rate. After public health officials initiated a campaign to reduce the use of penicillin, resistance dropped off. This observation is consistent with the hypothesis that ________.

Answers

Answer:

The correct answer would be - "bacterial populations evolve in response to the selection pressure imposed by antibiotics".

Explanation:

The given information provided in the question about the bacterial infection supports the hypothesis that the bacterial population shows the evolution in response to the selection pressure caused by the antibiotics due to the fact that bacteria increased resistance gradually with time. This resistance towards antibiotics increased the percentage of bacterially infected children in the late 1980s and early 1990s.

In this case, the population of bacteria having resistance genes is selected to evolved selected to increase their offsprings.

Which bacterial and viral pathogens cause most foodborne illnesses?

Answers

Answer:

Campylobacter

Clostridium perfringens

E. coli

Listeria

Norovirus

Salmonella

Other important bacteria and viruses that cause foodborne illness include:

Bacillus cereus

Botulism

Hepatitis A

Shigella

Staphylococcus aureus (Staphylococcal [Staph] Food Poisoning)

Vibrio Species Causing Vibriosis

PLEASE HELP ANSWER THESE TWO QUESTIONS! Thanks

1. Briefly describe the process of the dehydration synthesis for carbohydrates illustrated above:

2. Briefly describe the process of the hydrolysis reaction for carbohydrates illustrated above:

PLEASE HELP ANSWER THESE TWO QUESTIONS! Thanks1. Briefly describe the process of the dehydration synthesis

Answers

Explanation:


Dehydration Synthesis : Two monosaccharides (simple sugars) are joined together to form a disaccharide (double sugar) molecule. During this reaction, a molecule of water is removed, and a covalent bond is formed between the two monosaccharides. One monosaccharide loses a hydroxide group (-OH) from its carbon atom, while the other monosaccharide loses a hydrogen ion (H+), and the two react to form a covalent bond between the two carbon atoms. This process requires energy to occur.

Hydrolysis : Opposite process of dehydration synthesis, and it is the chemical reaction by which a disaccharide is broken down into two monosaccharides. During hydrolysis, a molecule of water is added to the disaccharide, causing the covalent bond between the two monosaccharides to break. One monosaccharide molecule gains a hydroxide group (-OH), while the other gains a hydrogen ion (H+), which were previously lost during dehydration synthesis. This process releases energy in the form of ATP

What happens to a more dense plate when it collided with a less dense plate?

Answers

Answer:

the plate that is more dense goes under the less dense plate. Trenches and volcanic mountains form.

Explanation:

what makes this meal unbalanced

what makes this meal unbalanced

Answers

Answer:

The correct answers are:

protein serving is too large

grains are not represented

and the vegetable serving should be larger.

Explanation:

How is selective pressure related to evolution?
A. Selective pressure can be a driving force of evolution.
B. Selective pressure is the same as evolution.
C. Selective pressure ensures that evolution has an end product.
D. Selective pressure causes evolution to proceed randomly.

Answers

Selective pressure can be a driving force of evolution; option A.

What is selective pressure?

Selective pressure refers to external forces which affect an organism's ability to survive in a given environment.

Selective pressure can either decrease or increase the occurrence of a trait.

Therefore, selective pressure can be a driving force of evolution.

Learn more about selective pressure at: https://brainly.com/question/1538410

#SPJ1

Describe how the conservation of matter and energy is applied to stellar formation. In your answer discuss the early components of stars and what happens at the end of stellar lifecycles. Think about the matter in a star and what happens to it.

Answers

Answer:

                                             

Explanation:

What are the stages of bee development (eggs,larvae,pupae)

Answers

The stages of bee development are egg, larva, pupa, and adult. Eggs hatch into larvae, which then transform into pupae. Finally, adult bees emerge and undergo further maturation.

The stages of bee development are:

1. Egg: The bee life cycle begins when the queen bee lays an egg in a honeycomb cell.

2. Larva: The egg hatches into a larva, which is a legless, grub-like creature. The larva is fed a special diet called royal jelly, which stimulates its growth.

3. Pupa: The larva undergoes metamorphosis and transforms into a pupa. Inside the sealed cell, the pupa undergoes various changes, developing into an adult bee.

4. Adult Bee: After completing the pupal stage, the fully developed adult bee emerges from the cell. The bee then undergoes further maturation, such as its exoskeleton hardening, wings expanding, and adult coloration appearing.

It's important to note that there are three castes of bees: queen, worker, and drone. The development process for each caste is similar, but the diet and size of the cells they are raised in differ, leading to their distinct roles within the colony.

For more questions on bee development:

https://brainly.com/question/28696131

#SPJ8

Function of loop of Henle is (A) conservation of water (B) formation of urine (C) filtration of blood (D) passage of urine

Answers

Answer:

D

Explanation:

Choose the correct option
An Insect that live in colony is
1) Ants
2) Dragon fly
3) House fly

Answers

The answer is 1) Ants

(50 points) Describe in your own words how do mitosis and cell differentiation work together to produce and maintain a complex organism?

(50 points) Describe in your own words how do mitosis and cell differentiation work together to produce

Answers

In multicellular organisms individual cells grow and then divide via a process called mitosis, thereby allowing the organism to grow. Cellular division and differentiation produce and maintain a complex organism, composed of systems of tissues and organs that work together to meet the needs of the whole organism.

Mitosis is a type of cell division which results in two daughter cells each having the same number and kind of chromosomes as the parent nucleus.

What is diiferentiation?

Mitosis occurs in multicellular organism. Cellular differentiation is referred to as process by which a less specialized cell develop into a more specialized cell type.

Differentiation occurs many times during the development of a multicellular organism as the organism transform from a simple zygote to a complex system of tissues. Thus, mitosis and cell differentiation work together closely.

Differentiation is a usual process in adults and adult stem cells divide and develop into fully-differentiated daughter cells during tissue repair and during normal cell turnover.

Differentiation rapidly changes a cell's shape, size membrane potential, metabolic activity, and responsiveness to signals.

For more details regarding, mitosis visit:

https://brainly.com/question/19058180

#SPJ2

Which of the following best describes how the process of crossing over during meiosis leads to an increase in genetic diversity?

A) During prophase II, fragments of DNA break off of chromosomes and attach to the ends of other chromosomes, resulting in different gene sequences.

B)During prophase I, DNA segments are exchanged between homologous chromosomes, resulting in different combinations of alleles.

C) During prophase I, DNA replication takes place, and homologous chromosomes trade places with each other before lining up in preparation for metaphase.

D) During prophase II, sister chromatids separate from each other, and as they travel to opposite ends of the cell, DNA segments of nearby chromosomes are exchanged.

Answers

Crossing over is described as a process that occurs during prophase I, where DNA segments are exchanged between homologous chromosomes, resulting in different combinations of alleles, as shown in option B.

What is crossing over?It is a process that occurs during meiosis.It is a process that occurs with the breakdown of homologous chromatids.It is the exchange of fragments between homologous chromatids.

Crossing over is a very important genetic process as it is capable of promoting high genetic diversity and creating new and different traits.

This process occurs during meiosis, in the phase known as prophase I. In this phase, homologous chromatids are formed and each one of them has its genetic structure.

However, crossing over promotes the breakage of these chromatids and the exchange of fragments between them. Thus creating a genetic structure different from the expected one and coaching changes in the formation of the organism.

Read more about crossing over:

https://brainly.com/question/27256451?

#SPJ1

Answer:

the one above me is correct i got it right on my test

Explanation:

Which of the following best describes how the process of crossing over during meiosis leads to an increase

What is relationship between genes dna and proteins

Answers

Answer:

genes are created by proteins. dna is created by genes

Explanation:

Most genes contain the information require to make proteins. The journey from gene to protein is one that is complex and controlled within each cell and it consists of two major steps – transcription and translation. Together, these two steps are known as gene expression.


Which diagram(s) represents the bonding pattem of
metals?

Answers

Answer: You didn’t provide the diagrams

Explanation:

you didn’t provide any pictures or diagrams option b is correct answer c is incorrect


Part D

Next, you'll use your spreadsheet to create a graph. The graph will help you visualize how the actual temperature changed from 1900 to 2025.

Question 1

Which type of graph (bar graph, pie chart, scatter plot, for example) do you think would be best for this task? Explain your reasoning.

Part DNext, you'll use your spreadsheet to create a graph. The graph will help you visualize how the

Answers

Line-graphs are used to express how changes in the recorded data occur through time or distances. In the exposed example, it would be best to use a line-graph to visualize how the actual temperature changed from 1900 to 2025.

What are line graphs?

Line graphs are representations of how the recorded data changes through time or distance. These graphs are used to show events that change in a continuous interval or time-lapse. They allow analyzing how these changes occur.

This representation is set in a cartesian graph, placing one of the variables on the horizontal axis and the other variable on the vertical axis. Usually, time or distance (the continuous variable) is placed on the X-axis, while the associated variable is placed on the Y-axis.

Dots are drawn in the intersection between the two variables, and a continuous line is drawn joining these dots to show the change of values between time (or distance) intervals.

In the exposed example, we need visualize how the actual temperature changed from 1900 to 2025. We can use a line graph to do it.

You can learn more about line-graphs at

https://brainly.com/question/11878298

#SPJ1

If you ended up with 30 blue, 25, black, 25 brown, 6 yellow, and 4 orange invertebrates, what does this tell you about the type of predator?

Answers

The distribution of invertebrates among different colors suggests that the type of predator targeting them might have color preference or selectivity.

The fact that there are significantly more blue invertebrates (30) compared to black (25), brown (25), yellow (6), and orange (4) indicates that the predator might have a preference for blue-colored prey. This preference is evidenced by the higher number of blue invertebrates captured compared to other colors.

Additionally, the predator seems to show a relatively equal preference for black and brown invertebrates since their numbers are the same. However, it is important to note that the sample size of the invertebrates may affect the observed distribution, and further investigation would be required to draw definitive conclusions.

Understanding the predator's color preference can provide insights into its visual perception and hunting strategies. It could indicate that the predator has developed adaptations to target specific color morphs or that certain colors are more conspicuous or attractive to the predator's visual system.
For more questions on invertebrates
https://brainly.com/question/3481345
#SPJ11

Which type of macromolecule contains phosphorus, and where in the molecule are phosphorus atoms located

Answers

Answer:

Nucleic acids, which include DNA (deoxyribonucleic acid) and RNA (ribonucleic acid), are the macromolecules that contain phosphorus. Phosphorus is an important component of the nucleotides that make up nucleic acids.

In DNA, the phosphate group is located on the 5' carbon of the sugar molecule, which is connected to the nucleotide base via a phosphodiester bond. The phosphate groups of adjacent nucleotides form the backbone of the DNA molecule.

In RNA, the phosphate group is similarly located on the 5' carbon of the sugar molecule, but RNA has a ribose sugar instead of a deoxyribose sugar. RNA also typically contains single-stranded nucleotides, rather than the double-stranded structure of DNA.

Overall, phosphorus plays a critical role in the structure and function of nucleic acids, which are responsible for storing and transmitting genetic information.

_____ are a collection of infected hair follicles that often occur on the back of the neck, the upper back, and lateral thighs that form a mass that evolves into an erythematous, painful, edematous mass, which drains through many openings.
a. Erysipelas
b. Furuncles
c. Carbuncles
d. Boils
c. carbuncles

Answers

(c) Carbuncles are a collection of infected hair follicles that often occur on the back of the neck, the upper back, and lateral thighs that form a mass that evolves into an erythematous, painful, edematous mass, which drains through many openings.

Hair follicles are a small tube like opening or pore that inhabit the roots of the hair strand. The top two layers of the skin together form the hair follicle. Around 20 types of cells together form the hair follicle.

Erythematous refers to the redness of the skin or the mucous membrane due to the accumulation of blood in the dilated capillaries of that region. The condition can arise either due to some injury or due to infection.

To know more about hair follicles, here

brainly.com/question/12050451

#SPJ4

Water absorbs heat when it evaporates, allowing organisms to_____to release excess heat.

Answers

Water absorbs heat when it evaporates, allowing organisms to maintain a steady temperature to release excess heat.

Does water absorb or release heat when it evaporates?In the case of evaporation, the substance absorbs the energy, whereas in the event of condensation, the substance releases heat. As wet air is raised and chilled, for instance, water vapor finally condenses, releasing enormous amounts of latent heat energy that feed the storm.The process of turning a liquid into a gas is called vaporization. Another name for it is evaporation. Since a gas's particles move more quickly than a liquid's, a liquid needs to be given energy in order to turn into a gas. Heat is the most typical kind of energy addition to a liquid system.

To learn more about  vaporization  refer,

https://brainly.com/question/26306578

#SPJ1

Other Questions
Need help ASAP I need the right answers Which negative angle is equivalent to 285 degrees?A.-85 degreesB.-95 degreesC.-65 degreesD. -75 degrees Which of the following is an example of a service or program paid for byfederal income taxes?A. Local public educationB. Home repairsC. The United States militaryD. Private health insurancePlease help!!! Which level of the food web is impacted by littering plastic in Canada? and why? The value of the function f(x) = 5x +7 at 3 is guillaume has a windows 10 personal laptop. he wants to ensure that the microsoft store apps on his computer are kept updated. what can guillaume do to ensure this? Sort the phrases into the appropriate categories. Here it was, half a century after the first segregation law, and there were 50,000 African Americans in Montgomery. More of us rode the buses than Caucasians did, because more whites could afford cars. It was very humiliating having to suffer the indignity of riding segregated buses twice a day, five days a week , to go downtown and work for white people. Revenue= $120 million, Costs of goods sold= $60 million, Operating expenses=$13 million, and Depreciation =$7million, and Interest paid = $2million. The company has 200,000 preferred shares and 500,000 common shares. The company pays $6 in preferred dividend per share and $2 in common dividend per share. A 40% corporate tax rate applies. Common stock is currently selling for $50.Complete the income statement.Fill in and show work:The EBITDA isThe EPS isThe Cash Flow (EATSCH + DEP) =P/E Ratio is The Carbondale Hospital is considering the purchase of a new ambulance. The decision will rest partly on the anticipated mileage to be driven next year. The miles driven during the past 5 years are as follows:Year12345Mileage3,1003,9503,4503,8503,700a) Using a 2-year moving average, the forecast for year 6 = ? miles (round your response to the nearest wholenumber).b) If a 2-year moving average is used to make the forecast, the MAD based on this (round your response to one decimal place). (Hint: You will have only 3 years of matched data.)?c)The forecast for year 6 using a weighted 2-year moving average with weights of 0.40 and 0.60 (the weight of 0.60 is for the most recent period) = miles (round your response to the nearest whole number).?The MAD for the forecast developed using a weighted 2-year moving average with weights of 0.40 and 0.60 (round your response to one decimal place). (Hint: You will have only 3 years of matched data.)?d) Using exponential smoothing with alpha ? 0.30 and the forecast for year 1 being 3,050, the forecast for year 6 (round your response to the nearest whole number).? Which description characterizes Hector as an epic hero? Prompt: In your opinion, is it better to be perceived as "weird" or "normal"? Answer the question in the form of a full-length essay. Be sure to support your response with evidence from stories, movies, real world events, or experiences from your life. What are the three main types of forest found in Nepal over the three gegraphical regions? what were the consequences to Civil War breaks out in ethnicallydivided Nigeria. The electric potential in a region of space is V=250Vmx2+y2, where x and y are in meters.What is the strength of the electric field at (x,y)=(2.6m,1.7m)? Professor warburton is interested in memory processes and how retrieval of information is influenced by current schema activation. which field of psychology does he study? The Protestant Reformation was the Blank 1 -century religious, political, intellectual and cultural upheaval that splintered Catholic Europe, setting in place the structures and beliefs that would define the continent in the modern era.Answer A) 14thAnswer B )15th Answer C)16thAnswer D)17th If you do work on a skateboard loaded with friends in one-third the usual time, you expend A) three times the usual power. B) the usual power.C) one third as much power. D) need more information HELP PLS THIS IS DUE TODAY I WILL GIVE BRAINLIEST I will put the link of book in the comments1. Compare and contrast shale and sandstone. Include what they are made of and how they form. Put the answer in your own words. What pages provided the evidence for your answer.2.What are the three major kinds of sedimentary rocks? What page was this information found?3.What are two important organic sedimentary rocks? What page was this information found?4.The Amazon is a great river that flows through the tropical forests of Brazil. The river dumps huge amounts of fresh water, made cloudy by particles of sediment, into the South Atlantic Ocean. Would you expect to find coral reefs growing in the ocean near the mouth of the Amazon? Explain using C-E-R.5.Once the sediment has been deposited, what processes change it into sedimentary rock? What page was this information found?6.What are the three types of coral reefs? What page was this information found?(BEWARE ANY NONSENSE ANSER WILL BE REPORTED after the collision, the stick and puck will rotate about their combined center of mass. how far is this center of mass from the point at which the puck struck? Stare decisis the definition