Pemphigus vulgaris (PV) is an autoimmune disease that affects the skin and mucous membranes. It is characterized by the presence of autoantibodies that target proteins involved in cell.
At the cellular level, PV involves a disruption of the normal adhesion between epidermal cells, specifically the desmosomes that provide mechanical stability to the skin. The pathophysiological pathways involved in PV include:
Desmoglein internalization: Anti-Dsg antibodies can initiate internalization of desmogleins from the cell surface. This process is mediated by endocytic mechanisms and involves the recruitment of specific cellular machinery.
Disruption of desmosomal adhesion: Antibody-mediated internalization of desmogleins weakens the adhesion between neighboring epidermal cells, leading to the detachment of cell layers. This disruption causes the formation of intraepidermal blisters.
Activation of proteases: In PV, autoantibody binding to desmogleins can trigger the activation of proteases, such as plasmin, which contribute to further cleavage of desmogleins and the breakdown of cell adhesion.
To learn more about Pemphigus vulgaris follow:
https://brainly.com/question/30464492
#SPJ11
microbe topic: Influenza Virus, Strain H1N1 (Swine Flu)
You must find a news article on your chosen microbe published in the last 12 months in a main stream, media-outlet based, mass-distributed news source where the general public (even Grandma or Aunt Sally) gets their daily news. This news article will be your main reference. You must read for understanding, then tell us about the news report in your discussion. You must write a review of the news article contents, discuss what type of microorganism it is, and if the organism is in nature or is used in industry or research or causes disease. If it causes disease you must discuss transmission, increasing incidence, factors contributing to the spread of the organism, lab culturing, etc. You may use government-based or other scholarly references only as secondary information, to explain details missing from your news article above, such as, what kind of organism it is, the gram reaction, how the organism affects us, or follow -up information not known at the time of the news release but has been provided since that time .
Your discussion should be well-written, in your own words, paraphrasing from only credible academic sources. You may not directly quote from your sources; minimum elaboration on the topic of a minimum of 300 words and maximum of 400 words.
The article that I am going to review discusses the influenza virus and its new outbreak in China. The article is published on the official website of BBC News, one of the mainstream media outlets.
The article that I am going to review discusses the influenza virus and its new outbreak in China. The article is published on the official website of BBC News, one of the mainstream media outlets. The article was published on the 1st of December 2020 and is titled "China reports first case of H1N3 bird flu virus in human". The article provides the necessary information regarding the new strain of influenza virus and the precautions that people need to take. Type of microorganism and its nature The H1N1 virus is an influenza A virus that affects humans, pigs, and birds. This microorganism is primarily present in nature, particularly in birds and is also used for research purposes. The virus is present in pigs and can cause respiratory illness in humans. According to the article, a new strain of the H1N1 virus, called H1N3, was identified in China. The virus was transmitted from birds to humans, and only one case has been reported so far, making it less severe. Transmission and causes of the spread The virus is mainly transmitted through respiratory droplets from the infected person and can also spread through contaminated surfaces. This can happen when a person comes into contact with an infected surface and then touches their face, mouth, or eyes. The risk of transmission is higher in crowded places, which can contribute to the spread of the virus. The article highlights the importance of taking precautionary measures such as wearing a mask, maintaining social distancing, and washing hands frequently.Lab culturingThe article does not provide any information about the lab culturing of the virus. However, the scientific community has been working on developing a vaccine for the H1N1 virus. This research is conducted in specialized laboratories that can handle such dangerous pathogens.ConclusionIn conclusion, the article provides essential information about the new outbreak of the H1N3 virus in China. The article explains the nature of the microorganism and how it is transmitted from one person to another. The article also highlights the importance of taking precautionary measures and provides the necessary information for people to protect themselves from the virus. The article lacks information on lab culturing of the virus. However, it is clear that the scientific community is actively working on developing a vaccine to fight this virus.
To know more about influenza virus visit: https://brainly.com/question/30744840
#SPJ11
what would happen to you, metabolically, if all your mitochondria were destroyed? group of answer choices you would have much less atp available to think, move muscles, etc. you would have many fewer electrons available to think, move muscles, etc. you would have much less oxygen available to think, move muscles, etc. you would have much less glucose available to think, move muscles, etc.
Mitochondria are cellular organelles that are involved in cellular respiration, which generates adenosine triphosphate (ATP).
ATP is responsible for the body's energy production, which is required for different metabolic functions. A lack of mitochondria would result in a significant impact on the body's metabolic processes.If all your mitochondria were destroyed, you would have much less ATP available to think, move muscles, etc. Metabolically, ATP is essential for the body's metabolic activities. ATP is produced via oxidative phosphorylation, which occurs in the mitochondria. Hence, if the mitochondria are destroyed, the body cannot produce ATP via oxidative phosphorylation, leading to an insufficient ATP supply. As a result, the body's metabolic processes will significantly slow down or stop.
Additionally, you would have much less oxygen available to think, move muscles, etc. Mitochondria are responsible for oxygen utilization in cellular respiration. If the mitochondria are destroyed, oxygen is not effectively used. Hence, less oxygen would be available to think, move muscles, etc.
Furthermore, you would have much less glucose available to think, move muscles, etc. Mitochondria are involved in the process of breaking down glucose during cellular respiration to produce ATP. If mitochondria are destroyed, glucose breakdown would be significantly reduced, leading to lower levels of ATP production. This would result in a lack of glucose available for the body's metabolic activities.
Therefore, a lack of mitochondria would have a considerable impact on the body's metabolic processes, leading to a shortage of ATP, oxygen, and glucose supply.
learn more about Mitochondria
https://brainly.com/question/14740753
#SPJ11
which cellular component of our body are involved in developing infection
Answer:
the white blood cells or leucocytes
Gause's experiments with populations of different species of Paramecium show that: a competitive exclusion can result in the extinction of a species b. species will always equally subdivide a limiting resource o character displacement will always prevent extinction of a species d. niche theory does not always hold true e. one species did not eat the same bacteria
Gause's experiments with populations of different species of Paramecium show that a competitive exclusion can result in the extinction of a species. The correct answer is a. Competitive exclusion can result in the extinction of a species.
Gause’s experiments were conducted with two different species of Paramecium (P. caudatum and P. aurelia) grown in isolation in a culture media consisting of the same bacterial species. The results of the experiment showed that P. caudatum died off when grown in competition with P. aurelia, which was attributed to competitive exclusion, resulting in the extinction of one species. The other species subdivided the resource equally.
As a result, a competitive exclusion can result in the extinction of a species. Competitive exclusion is the process by which two species compete for the same resource, leading to the extinction of one of the species. It is one of the fundamental concepts of ecology, and it plays a crucial role in shaping the structure and dynamics of ecosystems.
Learn more about Paramecium here:
https://brainly.com/question/30243559
#SPJ11
hardy weinberg equilibrium Non Examples:
Answer:
If the allele frequencies change from the original frequencies after one cycle of random mating, the population is not in Hardy-Weinberg equilibrium, and evolution has occurred within the population.
Question 4
Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has a
traditional start codon.
How many amino acids long is the peptide if we assume traditional start and traditional stop
codon?
5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
3
5
6
9
Transcription is mRNA synthesis, which occurs by complementing a segment of the DNA template strand. The translation is the protein growth, which occurs by adding amino acids coded by mRNA codons. C) the polypeptide is 6 amino acids long.
What are transcription and translation?The whole process of protein synthesis includes Transcription and translation.
TRANSCRIPTION
Transcription is the mRNA synthesis process and occurs in the nucleus.
The DNA template strand is read in direction 3'→ 5' to build the mRNA molecule in direction 5'→ 3'. The template strand is the one that is going to be complemented by the mRNA.
mRNA molecule has the same sequence as the DNA coding strand, but it carries uracil instead of thymine.
TRANSLATION
Translation is the process through which polypeptide grows. It occurs in the cytoplasm.
rRNA and tRNA read mRNA in the direction 5'→ 3' and add the correct amino acids to build the new protein.
Amino acids are coded by mRNA codons. Protein synthesis initiates in the AUG start codon -Metionin- and ends when reaching either of the stop codons UAA, UAG, or UGA.
In the exposed example, we have a DNA strand. We know that it is the coding strand, so it has the same sequence as mRNA molecule.
DNA coding strand5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
mRNA molecule5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
Kowing mRNA sequence, we can grow the protein.
So first, we need to find the initiation codon (AUG), begining from the mRNA 5' extreme. Then we need to find a stop codon (UAA, UAG, or UGA).
mRNA start codon5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
mRNA stop codon5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
So this protein begins in AUG and ends in UAA.
To grow the protein, we need to separate mRNA codons and find the corresponding amino acids.
mRNA codons ⇒ AUG ACC GUU UGG AAA CAC UAA amino acids ⇒ Met Thr Val Trp Lys His Stop Protein ⇒ Met-Thr-Val-Trp-Lys-HisAccording to this reasoning, the polypeptide is 6 amino acids long. Option C) is correct.
You can learn more about protein synthesis at
https://brainly.com/question/16305501
#SPJ1
suggest two features of humans that are caused by their genes and not affected by their environment
personality is one of them, i cant think of another sorry
Explanation:
Car dealer lisa kovach paid 83 percent of a card options totaling 3,098 she pains 85 percent on a base price of 15,480 the destination charge was 890 what is the dealers cost
The dealer's cost is $12,635.06.
To calculate the dealer's cost, we need to subtract the additional charges (such as options and destination charge) from the base price.
First, let's calculate the cost of the options. Lisa Kovach paid 83% of the options, which totaled $3,098. So, we can find the cost of the options by dividing $3,098 by 0.83:
Cost of options = $3,098 / 0.83 = $3,734.94
Next, let's calculate the base price plus the destination charge:
Base price = $15,480
Destination charge = $890
Total cost (base price + destination charge) = $15,480 + $890 = $16,370
Finally, we can find the dealer's cost by subtracting the cost of options from the total cost:
Dealer's cost = Total cost - Cost of options = $16,370 - $3,734.94 = $12,635.06
Therefore, the dealer's cost is $12,635.06.
You can learn more about cost at
https://brainly.com/question/28147009
#SPJ11
the endocrine system consists of various that create and release group of answer choices glands; hormones. neurons; neurotransmitters. glial cells; hormones. glands; acetylcholine.
The endocrine system consists of various glands that create and release hormones.
The endocrine system regulates the physiological functions of the body through the release of mediators known as hormones which are produced and secreted by the endocrine glands.
The endocrine glands are ductless specialized structures that secrete the hormones produced directly into the interstitial fluid surrounding the tissue from where it diffuses into the blood capillaries and then it reaches its target cell or organ.
Learn more about endocrine system in:
https://brainly.com/question/29771202
#SPJ4
The organelles that are both surrounded by a double membrane, have their own dna, are involved in energy metabolism, and have their own protein synthesis machinery are the.
The organelles that are both surrounded by a double membrane, have their own DNA, are involved in energy metabolism, and have their own protein synthesis machinery are Mitochondria, and Chloroplast.
Mitochondria- The majority of the chemical energy required to drive a cell's metabolic operations is produced by mitochondria, which are membrane-bound cell organelles (mitochondrion, singular). Adenosine triphosphate, a tiny molecule, serves as a storage container for the chemical energy generated by the mitochondria (ATP).
Chloroplast- Organelles found in plant cells called chloroplasts use the photosynthetic process to change energy from the sun into reasonably stable chemical energy. They maintain life on Earth in this way.
To know more about the Mitochondria, and Chloroplast, click on the below link
https://brainly.com/question/14740753
#SPJ4
these new hybrid grain varieties are so important because they are much more nutritious than the older ones. true false
These new hybrid grain varieties are so important because they are much more nutritious than the older ones. The given statement is False.
The primary importance of new hybrid grain varieties is not necessarily that they are more nutritious than the older ones, but rather that they often have higher yields, better resistance to diseases and pests, and improved tolerance to environmental factors such as drought or flooding.
These characteristics help to increase food production and contribute to global food security. While some hybrid varieties may have enhanced nutritional properties, the main focus is usually on improving the agricultural aspects of the crop.
The statement is false because the main importance of new hybrid grain varieties lies in their agricultural improvements, rather than being more nutritious than older varieties.
For more information on hybrid kindly visit to
https://brainly.com/question/28297500
#SPJ11
Which use of iron is due to its chemical properties?
producing colored sparks in fireworks
changing from liquid to gas at 2,862°C
conducting electricity and heat
changing from solid to liquid if heated to 1,538°C
Answer:producing colored sparks in fireworks and rusting in the presence of water and oxygen
Explanation:
Answer:
a on ed
Explanation:
how could a dog living now and a cat living thousands of years ago have in common
Answer:
They are both animals and both are mammals. I think that is what you mean.
Explanation:
how would the cdna created in the lab compare to the original dna?
The cDNA created in the lab would be complementary to the original DNA, as it is synthesized using reverse transcriptase to convert RNA to DNA. However, when comparing cDNA (complementary DNA) created in the lab to the original DNA, there are some key differences in origin, function, and introns.
Let us discuss these differences in detail.
1. Origin: cDNA is synthesized from an mRNA template using reverse transcriptase, while the original DNA is found in the organism's genome.
2. Introns: cDNA lacks introns as it's derived from processed mRNA, whereas the original DNA contains both introns and exons.
3. Function: cDNA is mainly used for cloning, gene expression studies, and the production of recombinant proteins, while original DNA holds the genetic information for an organism's development and function.
Overall, the cDNA is a useful tool for studying gene expression and can provide insight into the transcriptional activity of cells, but it is not an exact replica of the original DNA.
Learn more about DNA here:
https://brainly.com/question/30006059
#SPJ11
Arrange the steps of the scientific method in the correct order.
Ask questions.
Test the hypothesis.
Observe.
Construct a hypothesis.
Communicate the results.
Analyze the results and conclude.
↓
The correct order of the steps of the scientific methods is Ask questions, Conduct background research, Construct a hypothesis, Test the hypothesis, Analyze the results, Draw conclusions, and Communicate the results.
Ask questions: The scientific method begins with the formulation of a question or a problem that you want to investigate.Conduct background research: Before constructing a hypothesis, it is important to gather information and conduct research to understand existing knowledge and theories related to the question or problem.Construct a hypothesis: A hypothesis is an educated guess or a proposed explanation for the question or problem. It should be based on the background research and provide a testable prediction.Test the hypothesis: This step involves designing and conducting experiments or making observations to gather data that will either support or refute the hypothesis.Analyze the results: Once data is collected, it needs to be analyzed using appropriate statistical or analytical methods to identify patterns, trends, or relationships.Draw conclusions: Based on the analysis of the results, conclusions are drawn to determine whether the data supports or refutes the hypothesis. This step involves interpreting the findings and discussing their implications.Communicate the results: The final step involves sharing the findings with the scientific community and the public through oral presentations, scientific papers, or other means. This step allows for peer review, replication of the study, and further discussion among scientists.know more about hypothesis here:
https://brainly.com/question/31552999
#SPJ8
How does photosynthesis take place? need detailed explanation
Answer:
Photosynthesis takes place inside plant cells in small objects called chloroplasts. During photosynthesis, Plants get carbon dioxide from the air through their leaves, and water from the ground through their roots. Light energy comes from the Sun. Within the plant cell, the water is oxidized, meaning it loses electrons, while the carbon dioxide is reduced, meaning it gains electrons. This transforms the water into oxygen and the carbon dioxide into glucose.
Question 29 Marks: 1 Common causes of failure of septic tank seepage field systems include improper sizing, nonsuitable soil, nonservicing, andChoose one answer. a. insufficient nutrients in tank b. excessive use of laundry detergents c. leaking fixtures d. use of wetting agents
Common causes of failure of septic tank seepage field systems include improper sizing, non suitable soil, non servicing, and leaking fixtures. Therefore the correct option is option C.
Common causes of failure of septic tank seepage field systems include improper sizing, non-suitable soil, non-servicing, and leaking fixtures.
Leaking fixtures, such as toilets and faucets, can lead to excess water entering the septic tank and seepage field, which can overload the system and cause it to fail.
It is important to address any leaks promptly to avoid damage to the septic system and prevent contamination of the surrounding environment. Therefore the correct option is option C.
For such more question on leaking:
https://brainly.com/question/10226770
#SPJ11
how does an entire population become adapted to its environment
a. traits that help individuals survive and reproduce become more common in the population over successive generations
b. each new variation becomes an adaptation as the organisms learn to use it
c. a population chooses which traits will help it survive
d. individuals develop changes during their lifetime and pass good changes to their offspring
complementation has taken place of please choose the correct answer from the following choices, and then select the submit answer button. answer choices A. two recessive alleles at either of two different loci suppressed a phenotype. B. two recessive alleles inhibited the expression of an allele at a different locus.
C. an individual organism possessing two recessive mutations has a wild-type phenotype, indicating that the mutations are at non allelic genes. D. two recessive mutations occur at the same locus, producing a mutant phenotype.
Complementation has taken place of two recessive mutations occur at the same locus, producing a mutant phenotype.
What is complementation? Complementation is the production of a normal phenotype from two organisms that carry homozygous recessive mutations at different loci. When two homozygous recessive mutations occur at the same locus, the mutant phenotype is produced (i.e., there is no complementation).
Option D is correct because two recessive mutations occurring at the same locus will produce a mutant phenotype. The complementation of two mutant alleles is a common genetic technique utilized to test whether the mutant phenotypes arise from distinct or identical genetic events.
If the mutations are caused by distinct genetic events, the heterozygous offspring will express the wild-type phenotype because the two complementing genes will provide the necessary enzymatic activity or structural proteins.
To know more about Complementation, refer here:
https://brainly.com/question/13058328#
#SPJ11
one way mistakes during the cell cycle could result in problems (G2)
Answer:
If cells that aren't genetically correct don't conduct apoptosis, it could cause cancers. Tumors are chunks of genetically incorrect cells. They could be incorrectly copied during mitosis.
Which statements describe hydrotropism? Check all that apply.
Hydrotropism is a plant's response to light.
Hydrotropism is a plant's response to an external stimulus.
Hydrotropism causes cells to grow longer on one side of the roots.
Hydrotropism causes cells to grow longer on one side of the stems.
Hydrotropism causes a plant to grow toward light.
Hydrotropism causes a plant to grow away from light.
Answer:
B and C
Explanation:
Trust
for many years, biologists disagreed about whether giant pandas are more closely related to raccoons or bears. Which one of the following types of evidence was most useful in determining the evolutionary relationship of giant pandas to other animals:a-Diet; b-eating habit; c- method of reproduction; d-anatomical features; e-behavior; f-genetic sequences; g-location of natural habitat
anatomical - of or relating to the structure of the body; "anatomical features" anatomic. 2. anatomical - of or relating to the branch of morphology that studies the structure of organisms; "anatomical research" anatomic
Answer: D
Marty made a table to compare oxygen and ozone. What correction needs to be made?
Oxygen Ozone
O2 O3
Located in the atmosphere Located in the atmosphere
Used in respiration Produced by photosynthesis
Helps living things release energy from food Helps living things by absorbing harmful UV radiation
Oxygen is O3, ozone is O2.
Oxygen absorbs harmful UV radiation, ozone helps living things release energy from food.
Oxygen is produced by photosynthesis, ozone is not.
Ozone is not located in the atmosphere, but in the lithosphere.
Answer:
Oxygen absorbs harmful UV radiation, ozone helps living things release energy from food.
Explanation:
This because oxygen is release during photosynthesis which is use for cellular respiration. During cellular respiration oxygen is absorbed which breakdown food substances to release energy.
While ozone is a layer in the atmosphere that has ability to absorb harmful UV radiations preventing from getting into atmosphere.
Answer:
Oxygen is produced by photosynthesis; ozone is not.
please help!!
describing how our planet could have possibly developed with less water (or less water ingredients) in the past. Then hypothesize how that would have affected the development of life in general or specifically the human species.
One example would have been more sunlight then usual because the atmoshphere could have been intoxicating, this would decrease the human population because water is our primary source of nutrients and survival.
Hope that helps.
What would happen to the water cycle if the sun ceased to exist?
O The water cycle would slow down.
The water cycle would stop.
The water cycle would speed up.
O The water cycle would stay the same.
Answer:
it would stop
Explanation:
since the sun is there to help evaporate the water. and i'm sure that without the sun, the water cycle would be the least of your worries
how does an enzyme affect the biochemical reactions in the real world?
Answer:
"The enzyme speeds up the reaction by lowering the activation energy needed for the reaction to start." "compare the activation energy with and without the enzyme. Enzymes generally lower activation energy by reducing the energy needed for reactions to come together and react."
i need help with #3 bad please i’ll give u a brainliest if u give me the correct answer i promise
Answer:
Its A
Explanation:
If you look closeley at the modle you can start to notice a pattern. Therefore a repeating structure. And they arent moving freely since they are combined into a compound to create NaCi.
The ___the contour lines are
together the steeper the slope.
The steeper the slope, the ___ stream's velocity.
Answer:
hi
Explanation:
Need the answer for this emt questions 100% people answer this
Which of the following is a characteristic of the plasma membrane?
It is made up of one layer of phospholipids.
It doesn't contain any molecules aside from phospholipids.
The outward-facing phospholipid tails give it a rough quality.
It allows some molecules to pass through but prevents others from doing so.
Answer:
D. It allows some molecules to pass through but prevents others from doing so.
Explanation:
Plasma membrane or cell membrane is a selective permeable membrane which allows light molecules to pass and prevents heavy molecules.
Hope this helps ;)❤❤❤