The sunspot cycle is directly relevant to us here on earth because coronal mass ejections and other activity associated with the sunspot cycle can disrupt radio communications and knock out sensitive electronic equipment.
What is the sunspot cycle?The sunspot cycle is directly relevant to us here on earth because it can cause coronal mass ejections and other activity that can disrupt radio communications and knock out sensitive electronic equipment. It also plays a major role in global warming, affects compass needles, affects plant photosynthesis, and strongly influences the earth's weather.
This means that the sunspot cycle can have a significant impact on our technology and communication systems, which are critical to our daily lives. Coronal mass ejections can cause major geomagnetic storms that have the potential to knock out power grids, damage satellites, and disrupt GPS signals. These storms can also create beautiful auroras that are visible in many parts of the world, but they can also have serious consequences for our infrastructure.
The sun's magnetic field, which plays a major role in the sunspot cycle, affects the compass needles that we use on earth. This means that the sunspot cycle can also have an impact on navigation systems, which are important for transportation and other industries.
Overall, the sunspot cycle strongly influences Earth's weather and can affect plant photosynthesis here on earth. This means that changes in the sunspot cycle can have a significant impact on our planet and our daily lives.
To learn more about the sunspot cycle follow
https://brainly.com/question/30615197
#SPJ11
how is an unmagnetized piece of iron different from the same piece of iron when it is magnetized?
An unmagnetized piece of iron differs from a magnetized piece of iron primarily in their internal structure and magnetic properties. In an unmagnetized iron, the individual magnetic domains are randomly oriented, which means that their magnetic fields cancel each other out, resulting in no net magnetic field.
On the other hand, when the iron becomes magnetized, the magnetic domains align in the same direction, thereby creating a net magnetic field. This process is typically achieved through the application of an external magnetic field or by placing the iron piece in close proximity to a strong magnet. The alignment of the magnetic domains causes the magnetized iron to exhibit magnetic properties, such as attracting or repelling other magnetic materials and generating a magnetic field.
In terms of practical applications, magnetized iron can be used in a variety of devices, such as electromagnets, transformers, and magnetic storage media. Unmagnetized iron, while not possessing these magnetic properties, still retains its inherent characteristics, like strength and ductility, making it suitable for structural and engineering purposes.
In summary, the main difference between an unmagnetized and magnetized piece of iron lies in the orientation of their magnetic domains and the resulting presence or absence of a net magnetic field. This difference gives rise to distinct magnetic properties, which ultimately determine their specific applications in various industries.
To know more about magnetic domains, refer to the link below:
https://brainly.com/question/27949287#
#SPJ11
How much kinetic energy does a 55 kg object have that is traveling 20m/s?
Answer:
11000 J
Explanation:
Apply the formula: K = 1/2.m.v²
K = 1/2.55.20²
K = 1/2.55.400
K = 55.200
K = 11000 Joules
A 2.0-g particle moving at 8.0 m/s makes a perfectly elastic head-on collision with a resting 1.0-g object. (a) Find the speed of each particle after the collision. (b) Find the speed of each particle after the collision if the stationary particle has a mass of 10 g. (c) Find the final kinetic energy of the incident 2.0-g particle in the situations described in parts (a) and (b). In which case does the incident particle lose more kinetic energy
The incident particle loses more kinetic energy in part (b) as compared to part (a). Therefore, in part (b), more energy is lost during the collision.Given information:Particle 1, mass m₁ = 2.0 gParticle 2, mass m₂ = 1.0 gInitial
velocity of particle 1, u₁ = 8.0 m/sInitial velocity of particle 2, u₂ = 0 (resting)1) Speed of each particle after the collisionThe law of conservation of momentum can be applied to solve this problem.
According to the law of conservation of momentum, the total momentum of a system remains constant if no external force is acting on the system.m₁u₁ + m₂u₂ = m₁v₁ + m₂v₂Where, v₁ and v₂ are the final velocities of particle 1 and 2 respectively.m₁u₁ = m₁v₁ + m₂v₂ ------- (1)Since the collision is perfectly elastic, both momentum and kinetic energy are conserved during the collision.m₁u₁ + m₂u₂ = m₁v₁ + m₂v₂ ... (From the law of conservation of momentum)The kinetic energy of a particle is given by the formula,K = ½ mv² ------ (2)For particle 1, K₁ = ½ m₁v₁²For particle 2, K₂ = ½ m₂v₂²Given m₁ = 2.0 g, m₂ = 1.0 g, u₁ = 8.0 m/s and u₂ = 0For particle 1,m₁u₁ = m₁v₁ + m₂v₂2.0 g × 8.0 m/s = 2.0 g × v₁ + 1.0 g × v₂16 = 2v₁ + v₂ -------
(3)Since the collision is perfectly elastic, the relative velocity of the two particles remains the same before and after the collision. Thus,v_rel = u₁ - u₂ = 8.0 m/s - 0 = 8.0 m/sAfter the collision, the particles move in opposite directions. Therefore, the relative velocity after the collision,v_rel' = v₂ - v₁The relative velocity is negative as v₁ > v₂v_rel' = -v_rel = -8.0 m/s
Equating the relative velocities before and after the collision,v_rel = v_rel'-8.0 m/s = v₂ - v₁v₂ = v₁ - 8.0 m/sFrom equation (3),16 = 2v₁ + v₂16 = 2v₁ + (v₁ - 8.0 m/s)16 = 3v₁ - 8.0 m/s3v₁ = 24.0 m/sv₁ = 8.0 m/sTherefore, velocity of particle 1 after the collision is 8.0 m/s in the same direction as before the collision.v₂ = v₁ - 8.0 m/sv₂ = 8.0 m/s - 8.0 m/sv₂ = 0Therefore, the velocity of particle 2 after the collision is 0.2)
Speed of each particle after the collision if the stationary particle has a mass of 10 g.Initial velocity of particle 1, u₁ = 8.0 m/sInitial velocity of particle 2, u₂ = 0 (resting)Given mass of particle 2, m₂ = 10 gFor particle 1, m₁ = 2.0 gFor particle 2, m₂ = 10 gAccording to the law of conservation of momentum,m₁u₁ + m₂u₂ = m₁v₁ + m₂v₂m₁u₁ = m₁v₁ + m₂v₂v_rel = u₁ - u₂ = 8.0 m/s - 0 = 8.0 m/sThe relative velocity of the two particles before the collision is 8.0 m/s.After the collision, the particles move in opposite directions.
Therefore, the relative velocity after the collision,v_rel' = v₂ - v₁The relative velocity is negative as v₁ > v₂v_rel' = -v_rel = -8.0 m/sEquating the relative velocities before and after the collision,v_rel = v_rel'-8.0 m/s = v₂ - v₁v₂ = v₁ - 8.0 m/sSince the collision is perfectly elastic, the total kinetic energy of the system is conserved.
Therefore,½ m₁u₁² = ½ m₁v₁² + ½ m₂v₂²v₂² = (m₁u₁² - m₁v₁²) / (2.0 × 10)From the law of conservation of momentum,m₁u₁ = m₁v₁ + m₂v₂v₂ = (m₁u₁ - m₁v₁) / m₂Substituting the value of v₂ in the kinetic energy equation,v₂² = (m₁u₁² - m₁v₁²) / (2.0 × 10)(v₁ - 8.0 m/s)² = (2.0 × 8.0² - 2.0 × v₁²) / (2.0 × 10)v₁² - 16v₁ + 64 = 16 - v₁²3v₁² - 16v₁ - 48 = 0(3v₁ + 8)(v₁ - 6) = 0v₁ = -8 / 3 or v₁ = 6Since velocity can never be negative,
the only possible solution is v₁ = 6 m/sFor particle 1, v₁ = 6 m/sFor particle 2, v₂ = (m₁u₁ - m₁v₁) / m₂v₂ = (2.0 g × 8.0 m/s - 2.0 g × 6 m/s) / 10 g = 0.4 m/sTherefore, velocity of particle 1 after the collision is 6 m/s in the opposite direction and velocity of particle 2 is 0.4 m/s in the same direction as particle 1.3)
Final kinetic energy of the incident 2.0-g particle in the situations described in parts (a) and (b)Given the mass of particle 1, m₁ = 2.0 gInitial velocity of particle 1, u₁ = 8.0 m/s
Initial velocity of particle 2, u₂ = 0 (resting)For part (a), v₁ = 8 m/s and v₂ = 0For particle 1,K₁ = ½ m₁u₁²K₁ = ½ × 2.0 g × (8.0 m/s)²K₁ = 64.0 mJFor particle 2,K₂ = ½ m₂u₂²K₂ = 0 J
Total kinetic energy after the collision,K = K₁ + K₂K = 64.0 mJFor part (b), m₂ = 10 gFor particle 1,K₁ = ½ m₁v₁²K₁ = ½ × 2.0 g × (6.0 m/s)²K₁ = 36.0 mJFor particle 2,K₂ = ½ m₂v₂²K₂ = 0.5 × 10.0 g × (0.4 m/s)²K₂ = 0.8 mJ
Total kinetic energy after the collision,K = K₁ + K₂K = 36.0 mJ + 0.8 mJK = 36.8 mJ
to know more about kinetic energy , visit
https://brainly.com/question/8101588
#SPJ11
T/F: a car traveling at 20 mph on a curved exit ramp has a constant velocity.
False.
A car traveling at 20 mph on a curved exit ramp does not have a constant velocity. This is because the car is changing direction as it navigates the curved ramp, meaning its velocity is constantly changing. Constant velocity requires both a steady speed and a straight path of travel.
False: A car traveling at 20 mph on a curved exit ramp does not have a constant velocity. This is because velocity is a vector quantity, which means it has both magnitude (speed) and direction. While the car may maintain a constant speed of 20 mph, its direction is changing due to the curve of the exit ramp, resulting in a changing velocity.
Learn more about :
constant velocity : brainly.com/question/29830843
#SPJ11
in the simple ac circuit shown on the right, c = 0.011 f, l = 0.6 h, r = 25 ω, δv = δvmaxsin(ωt), where δvmax = 51 v and ω = 15 rad/s.
The voltage across the capacitor is VC = 0 - j0.003654V.
The circuit given on the right is a series circuit comprising a resistor R, an inductor L, and a capacitor C. The applied voltage is given as δV = δVmax sin(ωt) where δVmax = 51V and ω = 15rad/s. The values of L, R and C are 0.6H, 25Ω and 0.011F respectively.
The complex impedance of the circuit is given as follows;
Z = R + jωL - j/ωC = 25 + j(15)(0.6) - j(1/15)(0.011)
= 25 + j9 - j0.000733=
25 + j8.99927Ω
The amplitude of the current in the circuit is given as;
I = V/Z where V is the amplitude of the applied voltage.
Substituting the values of V and Z;
I = δVmax/Z= 51/(25 + j8.99927)
The current in the circuit is thus;
I = 1.661 - j1.8355A.
The voltage drop across each component can be obtained by multiplying the amplitude of the current by the impedance of each component. The voltage across the resistor is given as;
VR = IR = (1.661)(25) = 41.525V
The voltage across the inductor is given as;
VL = jωLI = j(15)(0.6)(1.661) = j14.98V
The voltage across the capacitor is given as;
VC = -j(1/ωC)I = -j(1/15)(0.011)(1.661)
= -j0.003654V
The voltage across the capacitor is thus;
VC = 0 - j0.003654V.
To know more about voltage visit:
https://brainly.com/question/32002804
#SPJ11
What happens to the particles of an object when its temperature increases? *
The PE of the particles decreases.
The KE of the particles decreases.
The PE of the particles increases.
The KE of the particles increases.
Answer:KE
Explanation:
A single stranded sequence of a gene is shown below. An investigator wants to amplify and isolate this small gene using PCR. Design two PCR primers, each 15 nucleotides long, that can be used to amplify this DNA segment. (remember that DNA sequences are written 5' to 3' by convention) ACTTTCCAAACGCCCCGTGTCGATACTGAACGAATCGATGCACGCTCCC TTCCTTGAAAACGCATAAACATACAAGTGGGCAGATGATGCGTACGCCC CTCTAATACATCCAACACTCTACGCCCTCTTCAAGAGCTGGAAGGGCA CCCTGCACTTGGATAGGGGATTATCTCGTAAGGCAAGCTCGTACCGTC ATTCATGCGGAAGAGTTAACACGATTGGAAGTAGGGATAGTTTCGAA CCTCGGTTACTAGTCCTAATAAGGGAACGCTGTCTGAAGGATGAGTGT CAGCCAGTGTA Forward Primer Reverse Primer
The forward primer for PCR amplification of the given gene sequence is 5'-ACTTTCCAAACGCCC-3', and the reverse primer is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.
To design the PCR primers for amplifying the given gene sequence, we need to identify regions that flank the target segment. The primers should be complementary to the template DNA and positioned in such a way that DNA synthesis occurs in the desired direction.
Based on the provided gene sequence, the forward primer is designed to bind to the coding (sense) strand of DNA. It starts at position 1 (5'-end) and extends for 15 nucleotides. The forward primer sequence is 5'-ACTTTCCAAACGCCC-3'.
The reverse primer, on the other hand, is designed to bind to the non-coding (antisense) strand of DNA. It starts at a position near the end of the gene sequence (position 241) and extends for 15 nucleotides in the opposite direction. The reverse primer sequence is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.
These primers will anneal to their complementary sequences on the template DNA during the PCR amplification process. The resulting amplicon will span the target gene segment and can be subsequently isolated and studied further.
To learn more about amplification click here brainly.com/question/30300512
#SPJ11
When do scholars think kites were invented?
A. 2000 AD
B. 1000 BC
C. 12,000 BC
D. Never, there's no such thing as a kite
Answer:
kites where invented 2000 AD
so its A. 2000 AD
srry if it's wrong
Answer:
I guess no. A
Explanation:
approximately 2,800 years ago.
How many volts does it take to push 2 amperes of current through 20 ohms of resistance?
40V is needed to push 2 amperes of current through 20 ohms of resistance.
what is ohm's law?
It states that the current through a conductor between two points is directly proportional to the voltage across the two points.
V=I×R
Current equals Voltage divided by Resistance (I=V/R), Resistance equals Voltage divided by Current (R=V/I), and Voltage equals Current times Resistance (V=IR).
Given:
R=20Ω
I= 2amp
we know that,
V=I×R
V=2×20
V=40V
Thus,the voltage comes out to be 40V.
learn more about ohm's law from here: https://brainly.com/question/28238592
#SPJ4
How long will it take a car to cover 870 miles if the car travels 35 mi/hr?
Answer:
To find out how long it will take a car to cover 870 miles at a speed of 35 miles per hour, we can use the formula:
time = distance ÷ speed
Plugging in the given values, we get:
time = 870 miles ÷ 35 miles per hour
Simplifying the right side by dividing 870 by 35, we get:
time = 24.86 hours
Rounding to the nearest hour, the answer is:
time = 25 hours
Therefore, it will take the car approximately 25 hours to cover a distance of 870 miles at a speed of 35 miles per hour.
How much heat is required to raise the temperature of 2.0 kg of concrete from 10C to 30C? (The specific heat of concrete is 880 j/kg-C.)
A. 22 J
B. 88 J
C. 8800 J
D. 35200 J
Answer:B
Explanation:
What is the approximate number of wavelengths of light that can travel in 1 direction within a retroreflecting bead that has a diameter of 5 × 10-5 m? (Note: The speed of light = 3 × 108 m/s, and its frequency is approximately 1015Hz.)
0.6
1.7 × 10^2
1.5 × 10^4
3.3 × 10^6
The approximate number of wavelengths of light that can travel in one direction within a retroreflecting bead that has a diameter of 5 ×\(10^-^5\) m is 167.
Number of wavelengths of light in a retroreflecting bead with 5 × 10^-5 m diameter?
This calculation is based on the formula n = L/λ, where n is the number of wavelengths, L is the length of the object, and λ is the wavelength of light. To calculate the wavelength of light, we use the formula c = λf, where c is the speed of light and f is the frequency of light.
In this problem, we are given the diameter of the retroreflecting bead, which is assumed to be spherical. Therefore, its length is equal to its diameter, which is 5 × \(10^-^5\)m. We are also given the speed of light, which is 3 × \(10^8\) m/s, and an approximation of the frequency of light, which is \(10^1^5\) Hz.
Using the formula c = λf, we can solve for the wavelength of light:
λ = c/f = (3 ×\(10^8\) m/s)/\((10^1^5\)Hz) = 3 ×\(10^-^7\)m
Finally, we can use the formula n = L/λ to calculate the approximate number of wavelengths of light that can travel in one direction within the retroreflecting bead:
n = L/λ = (5 ×\(10^-^5\) m)/(3 ×\(10^-^7\) m) = 166.67 ≈ 167
Therefore, the approximate number of wavelengths of light that can travel in one direction within a retroreflecting bead that has a diameter of 5 ×\(10^-^5\) m is 167.
Learn more about wavelengths,
brainly.com/question/4112024
#SPJ11
The parent function `f\left(x\right)=\sqrt[3]{x}` is compressed vertically by a factor of `\frac{1}{3}` and then translated 3 units left and 7 units down. What is the transformed function `g\left(x\right)`?
Answer:
The answer is below
Explanation:
Given that f(x) = x√3.
A function can be vertically stretched or compressed by multiplying it by a positive constant. If the constant is greater than 1, it is vertically stretched and if the constant is less than 1 it is vertically compressed.
If a function f(x) = x is compressed or stretched by a constant a, then the new function g(x) = a f(x)
If a function f(x) = x is translated a units down, then the new function g(x) = f(x) - a
If a function f(x) = x is translated a units left, then the new function g(x) = f(x-a)
If f(x) = x√3 is compressed vertically by a factor of 1/3. The new function is
\(f(x)'=x\sqrt{3} *\frac{1}{3} \\\\f(x)'=\frac{x}{3} \sqrt{3}\)
If it is then translated 3 units left and 7 units down, the transformed function g(x) is:
\(g(x)=(\frac{x-3}{3}\sqrt{3} )-7\)
What is radiation produces a wave full energy.
Answer:
electromagnetic radiation hopefully
A spring with a spring constant of 400 n / M has a mass hung on it so it stretches 8 cm. calculate how much mass the spring is supporting.
Answer:
3.3kg
Explanation:
Given parameters:
Spring constant = 400N/m
Extension = 8cm = 0.08m
Unknown:
Amount of mass the spring is supporting = ?
Solution:
To solve this problem:
F = kE
F is the force
k is the spring constant
E is the extension
So;
F = 400 x 0.08 = 32N
Mass;
Force = mass x acceleration due to gravity
32 = mass x 9.8
Mass = 3.3kg
The mass the spring is supporting is 3.27 Kg.
We'll begin by calculating the force acting on the spring.
Spring constant (K) = 400 N/mExtension (e) = 8cm = 8 / 100 = 0.08 mForce (F) =?F = Ke
F = 400 × 0.08
F = 32 N
Finally, we shall determine the mass. This can be obtained as follow:
Force (F) = 32 NAcceleration due to gravity (g) = 9.8 m/s²Mass (m) =?m = F / g
m = 32 / 9.8
m = 3.27 Kg
Therefore, the mass the spring is supporting is 3.27 Kg
Learn more about spring constant:
https://brainly.com/question/13511965
Types of Spectra 5) Stars like our Sun have low-density, gaseous atmospheres surrounding their hot, dense cores. If you were looking at the spectra of light coming from the Sun (or any star), which of the three types of spectrum would be observed? Explain your reasoning.
The spectrum observed from the Sun (or any star) would exhibit an absorption spectrum. This is because the outer gaseous atmosphere of the star absorbs specific wavelengths of light, resulting in dark absorption lines in the spectrum.
In the cooler, lower-density outer atmosphere, where white light from the star travels, some atoms or molecules in the atmosphere absorb photons with particular energy. In the spectrum, these absorptions show up as black lines at specific wavelengths. The specific set of absorption lines that each element or molecule generates results in a distinctive pattern that can be used to identify the elements that are present in the star's atmosphere.
The absorption spectrum offers insightful data on the chemical make-up and physical characteristics of the star. Astronomers can ascertain the elements present, their abundances, and other characteristics like the temperature, pressure, and velocity of the star's atmosphere by examining the absorption lines.
To know more about absorption spectrum here https://brainly.com/question/10252035
#SPJ4
*it’s actually carpentry*
two basic types of scaffolds are
a. metal and wooden
b. fixed and portable
c. self-supporting and suspended scaffolds
d. assembled and delivarablr scaffolds
*it’s actually carpentry* two basic types of scaffolds are "self-supporting and suspended scaffolds." The correct option is c.
Self-supporting scaffolds are freestanding structures that do not require external support. They are commonly used in construction projects and are designed to provide stability and support to workers.
Suspended scaffolds, on the other hand, are suspended from an overhead structure or support system. They are typically used for tasks such as window cleaning or exterior building maintenance. They rely on ropes, cables, or other means to suspend the scaffold platform.
A. Metal and wooden: This option refers to the materials used to construct scaffolds. While metal and wooden scaffolds are indeed types of scaffolds, they do not categorize the scaffolds based on their structural characteristics or support mechanism.
B. Fixed and portable: This option categorizes scaffolds based on their mobility. Fixed scaffolds are permanently attached to a structure, while portable scaffolds are designed to be moved and set up at different locations. This categorization is based on the mobility aspect and does not provide information about the support mechanism or structural characteristics of the scaffolds.
C. Self-supporting and suspended scaffolds: This option correctly categorizes scaffolds based on their structural characteristics and support mechanism.
D. Assembled and deliverable scaffolds: This option does not provide a comprehensive categorization of scaffold types based on their characteristics. While scaffolds do need to be assembled, and some scaffolds may be delivered to the worksite, this categorization does not provide information about their support mechanism or structural characteristics.
Therefore, option c. self-supporting and suspended scaffolds is the correct option as it accurately classifies scaffolds based on their structural characteristics and support mechanism.
To learn more about scaffolds click:
https://brainly.com/question/30416664
#SPJ6
do you think it is important to wear seat belts while traveling in a car?why?
Answer:
yes, because the seat belts lock in place when a car crashes, locking your body with it so you don't go out flying out of the car and injury your self.
how to sketch the following?:Sketch ray diagrams for a spherical convex lens with objects at the following distances. (Submit a file with a maximum size of 1 MB.)Do > 2f2f > Do > fDo < f
1) Do > 2f
Do means object distance
2f means 2 x focal length
2 x focal length = radius of curvature
When an object is placed beyond the radius of curvature, a real image is formed between the radius of curvature and focus. The image size is reduced. The sketch is shown below
Draw a wave that has a wavelength of 3 cm and an amplitude of 1 cm. Label the wavelength, the amplitude, the rest position, and the crest and trough of your wave.
Answer:
Please find attached, the required wave drawn with MS Excel
Explanation:
Functions that represent waves is given as follows
A general form of the wave equation is A·sin(B·x) + D
Where;
B = 2·π/T
T = The period of the wave = 1/f
D = The vertical shift of the wave = 0
A = The amplitude of the wave = 1 for sine wave
v = The wave velocity
λ = The wavelength of the wave
f = The frequency of the wave
v = f·λ
At constant v, λ ∝ 1/f
∴ λ ∝ T
Where T = 3, we have;
B = 2·π/T
∴ B = 2·π/3
Therefore, we have the wave with an amplitude of 1 cm, and wavelength, 3 cm, given as follows
y = sin((2·π/3)·x)
Plotting the above wave with MS Excel, we can get the attached wave
a nearsighted man uses his ideally prescribed eyeglasses that have a refractive power of. he would like a prescription for contact lenses. what is the correct contact lens prescription if he normally wears his eyeglasses a distance of from his eyes
The power of the prescribed lens should be 3.37 diopters.
If the power of the lens of the near cited person is -3.6 diopters.
Then the relation between its power of the glasses and the focal length is given by,
P = 1/f
Putting values,
-3.6 = 1/f
f = -0.27 meters.
Here, minus sign indicates that the focal length of the glasses is present before the eye.
If the person normally wears his glasses 0.027 cm before his eyes.
Then it means that the distance of the focused image related to the eye is given by the focal length of the glasses added the distance between the glasses and the eyes.
F = 0.27+0.027
F = 0.297 m.
The power of the contact lens,
P = 1/0.297
P = 3.37 diopters.
To know more about power of lens, visit,
https://brainly.com/question/9757866
#SPJ4
Complete question- A nearsighted man uses his ideally prescribed eyeglasses that have a refractive power of -3.60 diopters. He would like a prescription for contact lenses. What is the correct contact lens prescription if he normally wears his eyeglasses a distance of 2.7 cm from his eyes?
What is the difference between kinematics and dynamics?.
Physics Suppose that, while in a squatting position, you stand on your hands, and then you pull up on your feet with a great deal of force. You are applying a large force to the bottoms of your feet, but no matter how strong you are, you will never be able to lift yourself off the ground. Use your understanding of force and motion to explain why this is not possible.
Explanation:
can you show me the answer of science
Explain why you cannot see your face on a plane paper.
Answer:
because white pieces of paper have a rough surface that means diffused reflection takes place.
Explanation:
Answer:
Because white sheets of paper have a rough surface, dispersed reflection happens. Therefore, you can't see your face on a white sheet of paper. The picture was lost as a result of the repeated reflections scattering the image's reflecting beams.
~~~~~~~~~~~~~~~~~~~~~
Hope it helps!
Have a good day!
A 150 Ohm resistor is in series with a 300 Ohm resistor and the power supply has 150 V. What is the
power used by the 150 Ohm resistor?
SHOW WORK AND NO TROLLING OR POINT FARMING
Answer:
Total resistance in parallel is 1.2703136679494.
Total resistance in series is 155.Total resistance in series is 155.
Explanation:
Answer:
P = I V = I^2 R
R = 150 + 300 = 450 Ω
I = 150 / 450 = .333 amps
P(150) = .333^2 * 150 = 16.7 W
a toy cork gun contains a spring whose spring constant is 18n/m. the spring is compressed 7.47 cm and then used to propel a 9 cork. the cork, leaves the spring from the spring's relaxed length. with what speed, in m/s, does the cork leave the spring?
The cork leaves the spring at a speed of 3.02 m/s.
We can use the conservation of energy to determine the speed at which the cork leaves the spring.
The initial potential energy stored in the spring is converted to the kinetic energy of the cork as it leaves the spring. Neglecting air resistance, the conservation of energy equation is:
(1/2) k x^2 = (1/2) m v^2
where k is the spring constant, x is the distance the spring is compressed, m is the mass of the cork, and v is the speed of the cork as it leaves the spring.
Substituting the given values:
(1/2) * 18 N/m * (7.47 cm / 100 cm/m)^2 = (1/2) * 0.009 kg * v^2
Solving for v:
v^2 = (18 N/m * (7.47 cm / 100 cm/m)^2) / 0.009 kg
v^2 = 9.119 m^2/s^2
Taking the square root of both sides:
v = 3.02 m/s
to know more about conservation of energy refer here:
https://brainly.com/question/2137260#
#SPJ11
what is the two example of velocity
PLEASEEE HELPP NEED DONE TNIGHT
Answer
a) A decrease in the two objects' mass
b) The gravitational force between two objects is inversely proportional to the square of the distance. Therefore, doubling the distance will multiply the gravitational force by 2^2 = 4, giving us a final gravitational force of 1200 x 4 = 4800 N.
c) A change in the distance between them
hope this helps ;)
A machining company needs to manufacture more than 20 fixtures in a day. The company uses five identical machines to make the fixtures. If each machine produces x fixtures, which inequality represents this situation?
A.
5x > 20
B.
5x < 20
C.
5x > 20 + 5
D.
5x < 20 + 5
a put a my boy
Explanation:
5x5=25 so it would be a
7) Find F1 and F2
HELP PLEASEEE
The force F1 is equal and opposite to the downward force thus, F1 is equal to 60 N. The force F2 is inclined to 30 ° from leftward force and it is equal to 38.97 N in magnitude.
What is force?Force is an external agent acting on a body to deform it or to change its state of motion or rest. Force is a vector quantity and it is characterised by its magnitude and direction.
If two forces acting on a body from the same directions, then the net force will be the sum of these two forces. If they are acting from opposite directions, they will cancel each other in magnitude.
The force F1 is equal and opposite to the force acting downward. Thus its magnitude is 60 N. The force F2 is inclined to 30 ° from horizontal direction.
F2 = 45 cos 30 = 38.9 N.
To find more on force, refer here:
https://brainly.com/question/28875770
#SPJ1