I need help on my biomedical, I don’t understand any of this.

I Need Help On My Biomedical, I Dont Understand Any Of This.

Answers

Answer 1

The karyotype from a fetus:

The procedure that could have been used to produce this karyotype is called a karyotype analysis. Based on the karyotype, the fetus has an extra chromosome 21.

What is Karyotype analysis?

1. Karyotype analysis is a procedure that is used to study the chromosomes in a cell. The chromosomes are the structures that contain the genetic material of the cell. In order to perform a karyotype analysis, a sample of cells is taken from the fetus and then the cells are cultured in a laboratory. The cultured cells are then treated with a chemical that stops the cells from dividing. The cells are then stained and examined under a microscope. The chromosomes are arranged in pairs and the number of chromosomes in each pair is counted.

2. This condition is called Down syndrome. Down syndrome is a genetic disorder that is caused by the presence of an extra copy of chromosome 21. People with Down syndrome have a range of physical and intellectual disabilities. The severity of the disabilities varies from person to person.

Find out more on Karyotype analysis here: https://brainly.com/question/9491785

#SPJ1


Related Questions

7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA would
you see on the electrophoresis gel?

BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'

5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 3
3’TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5

Answers

Based on their recognition sequences, two DNA bands will be produced by Bam1 and three DNA bands will be produced by EcoR1.

What are restriction sites?

Restriction sites are sequences of nucleotides which are recognized by restriction enzymes and are acted upon by the restriction enzymes.

Restriction enzymes cuts DNA at recognition sites based on their recognition sequences.

Examples of restriction enzymes are Bam1 and EcoR1.

For Bam1, the recognition sequence is (CCTAGG) --- 5' CCTAGG 3'

Two bands will be produced using Bam1 as shown below:

5'ACGAATTCAGTATTATCCTAGG 3'

3'TGCTTAAGTCATAATAGGATCC 5'

5'TATCCGCCGCCGAATTCTCATCA 3'

3'ATAGGCGGCGGCTTAAGAGTAGT 5'

For EcoR1, the recognition sequence is (GAATTC) --- 5'GAATTC 3'

Three bands will be produced using with EcoR1 as shown below:

5'ACGAATTC 3'

3'TGCTTAAG 5'

5'AGTATTATCCTAGGTATCCGCCGCC 3'

3'TCATAATAGGATCCATAGGCGGCGG 5'

5'TCATCA 3'

3'AGTAGT 5'

Therefore, two DNA bands will be produced by B-am1 and three DNA bands will be produced by Eco-R1.

Learn more about restriction sites at: https://brainly.com/question/8886948


The question In the picture

The question In the picture

Answers

Answer:

It is important to recycle because it is one of the simple ways to save our planet. The act of recycling also promotes the trait of not being wasteful and promotes one's creativity, which can further be implemented on other aspects of life. It also let's us control the amount of waste that may be harmful to the environment, and allows us to have a deeper connection with nature, and therefore live a meaningful and clean life.

Explanation:

hope it helps ✌️

What is unique about obtaining water from an artesian well?
O The water is heated by magma or hot rocks.
O The water is found in an impermeable layer.
O The water is under pressure naturally and no pump is needed.
O Amechanical pump must be installed to bring water to the surface.

Answers

Answer:

c-The water is under pressure naturally and no pump is needed.

Explanation:

Water from Artesian well is the water is under pressure naturally and no pump is needed.

What is Artesian well?

A well from which water flows under natural pressure without the need for pumping is known as an artesian well.

It is excavated or drilled whenever a gently sinking, permeable rock layer (such as sandstone) collects water at a level higher than the ground surface at the well site.

Water goes down into the aquifer (water-bearing layer) at the outcrop, but is blocked from escaping by impermeable rock layers above and below it (such as shale).

Water is forced to the surface of a well drilled down into the aquifer by the weight of the water (hydrostatic pressure) the pressure for the continuous up flow is maintained by the continued penetration of water into the aquifer at the intake region.

The ability to collect water is what distinguishes artesian wells.

The water is under pressure naturally and no pump is needed.

Pumping water isn't essential because there isn't any pressure in the water.

Hence, the correct option is C.

To know more about artesian well here

https://brainly.com/question/8881413

#SPJ2

You are studying a plant whose seeds persist in the soil for a long time, normally only germinating when the seeds are brought to the surface in full sun by a disturbance such as a tree fall. However, in one of your experimental lineages you find that many seeds germinate when the surface is in full sun even if the seeds are buried too deep to grow to the surface before exhausting their reserves. You suspect that this lineage has a mutation that inhibits:

Answers

Answer:

The conversion of Pfr to Pr.

Explanation:

If the seeds germinates properly  when the surface is in full sun and persist to germinate when buried deep into the soil, this shows that this lineage of seeds  has a mutation that inhibits the conversion of Pfr to Pr

the vestibular branch of the vestibulocochlear nerve functions in hearing while the cochlear branch is involved in equilbirum

Answers

The vestibulocochlear nerve's vestibular branch is responsible for hearing, while the cochlear branch is involved in equilibrium. This claim is untrue.

The vestibular nerve, which innervates the semicircular canals of the inner ear and is involved with equilibrium, coordination, and orientation in space, and the cochlear nerve, which innervates the cochlea and supports hearing, are both parts of the vestibulocochlear nerve, which has two components within a single trunk.The vestibulocochlear nerve, which divides into the cochlear nerve and vestibular nerve, is primarily made up of bipolar neurons.A vestibular branch and a cochlear branch make up the vestibulocochlear nerve. Balance is controlled by the vestibular branch, and hearing is controlled .

To know more about vestibulocochlear nerve please click on the link brainly.com/question/10670218

#SPJ4

This is the part of the business cycle in which output, or Real GDP has stopped its slide.
Recovery
Trough
Peak
Expansion

This is the part of the business cycle in which output, or Real GDP has stopped its slide.RecoveryTroughPeakExpansion

Answers

The part of the business cycle when the slide in output or Real GDP stops is b. Trough.

The trough is usually the fourth phase of the business cycle. The business cycle starts with peak, recession or contraction, trough, expansion. During the trough, the economy transits from its contraction phase to the expansion phase before attaining its peak.

Factors Determining Business Cycle:GDPInterest ratesTotal employmentConsumer spending.

Thus, the part of the business cycle in which output or Real GDP stops its slide is Trough. It marks the lowest ebb in the business cycle.

Learn more about the business cycle here: 25960322

How does irrigation affect ecosystem health? (A) (B) (C) (D) P Irrigation uses much of the world's freshwater supplies and can also contribute to soil depletion and alter weather patterns. Irrigation is necessary to ensure the large harvests that the global population requires, and its use will only increase in the future. Irrigation can release harmful greenhouse gases such as methane and carbon dioxide into the air, contributing to climate change. Irrigation can increase the content of nitrogen and phosphorous in soil and water to dangerous levels, harming animals and plants in the ecosystem.​

Answers

Option (D) is the proper response because irrigation can raise the amounts of nitrogen and phosphorus in soil and water to risky levels, affecting ecosystem animals and plants.

What impact does irrigation have on the environment?

The potential over-extraction of groundwater for irrigation has the potential to have direct detrimental environmental effects (withdrawing water in excess of the recharge rate). This may cause the water table to drop, land to sink, water quality to deteriorate, and saltwater intrusion in coastal areas.

What impact does irrigation have on water use?

Compared to sprinkler irrigation, flood irrigation loses less water to evaporation, but more water may be lost through runoff in the fields. The major reason we parameterize the irrigation techniques is to reflect their unique water use effectiveness.

To learn more about irrigation visit:

brainly.com/question/30090075

#SPJ9

Identify organelles in a plant cell with the diagram below.

Identify organelles in a plant cell with the diagram below.

Answers

Answer:

A - cloroplast

b- vacuole

c- cell wall

d- nucleus

Explanation:

I found the same picture online. I just looked up organelles in a cell plant and it was one of the first ones

Answer:

A - cloroplast

b- vacuole

c- cell wall

d- nucleus

Explanation:

i got the answers from this image (kepp this image because it might also help you) and please brainlest

Identify organelles in a plant cell with the diagram below.

what type of cell is unicellular?​

Answers

Answer:

Unicellular organisms are made up of only one cell that carries out all of the functions needed by the organism, while multicellular organisms use many different cells to function. Unicellular organisms include bacteria, protists, and yeast.

Explanation:hope this helped

Answer: well there isn't really a unicellular cell but theres a unicellular organism

Explanation:

a unicellular organism is a organism that only has one cell

Please hurry!!
During DNA replication, which enzyme breaks the hydrogen bonds between nitrogenous bases to unwind DNA?


Primase


Ligase


Helicase


DNA polymerase

Answers

Answer:

enzyme helicase

Explanation:

My professor helped me with this one

Order the steps of protein synthesis.

Answers

initiation, elongation, and termination.

Transfer RNA molecules pick up amino acids
which are free in the cytoplasm and carry them to

Answers

they carry them to the ribosome

If the moon moves farther away from the earth the earths oceans will experience what? 

Answers

Answer:

flatten out, less waves, become more calm, no more tides

Explanation:

Sorry I don’t get I hopefully you get helped though

This is a symbiotic relationship in which one of the organisms gains
something and the other loses something in the process
A competition
B mutualism
C parasitism
D commensalism

Answers

The answer is C

Parasitic relationships: one species benefits and the other suffers

The graph shows the results of a photosynthesis investigation on algae.
Which question was the scientist most likely studying? (SC.7.N.1.4)

A. Why is the rate of photosynthesis different in high light intensity from low light intensity?

B. Why does increasing the light intensity increase the rate of photosynthesis in algae?

C. How is the rate of photosynthesis in algae at two light intensities affected by different temperatures?

D. How does increasing the rate of photosynthesis in algae change its temperature?

Answers

A. The rate of photosynthesis is different in high light intensity compared to low light intensity primarily due to the availability of energy for the photosynthetic process.

In high light intensity, there is an abundance of light energy, specifically photons, reaching the photosynthetic pigments in plant cells.

B. Increasing light intensity increases the rate of photosynthesis in algae primarily because the light is a crucial factor in the light-dependent reactions of photosynthesis.

Algae, like plants, contain pigments such as chlorophyll that absorb photons of light energy. When light intensity increases, there is a higher influx of photons available for absorption by these pigments.

C. The rate of photosynthesis in algae at two light intensities can be affected by different temperatures. Generally, temperature influences the enzymatic reactions involved in photosynthesis.

At lower temperatures, the enzymatic activity tends to be slower, which can limit the overall rate of photosynthesis. As the temperature increases within an optimal range, enzyme activity and reaction rates typically rise, leading to an increase in the rate of photosynthesis.

D. Increasing the rate of photosynthesis in algae can change its temperature due to the metabolic processes involved. Photosynthesis is an endothermic process, meaning it absorbs energy from the environment.

As the rate of photosynthesis increases, more energy is absorbed from the surroundings in the form of light.

Know more about photosynthesis:

https://brainly.com/question/29764662

#SPJ1

HELPP ASAP PLEASEEE!!!!!!!!!!!
If a nation is suffering famine as a result of changing conditions reducing their wheat crop, which area of scientific specialization would be the area
most likely to be involved in finding a solution?
O pomologists
O arborists
O agronomists
botanists

Answers

Answer:

Agronomist

Explanation:

An agronomist studies soil and how well plants can grow in that specific soil. Pomologists and botanists study the fruit itself, while arborists take care of trees. If you wanted to know how to make your plants regrow, you would contact an agronomist.

Answer:

I believe its agronomists

Explanation:

they study plants and crops and how to modify/grow them

Describe the role of GA in a-amylase production and in germination. Provide evidence for your claim

Answers

Gibberellic acid (GA) plays a crucial role in a-amylase production and germination. GA stimulates the synthesis and release of a-amylase enzymes, which hydrolyze starch into sugars during germination. Experimental studies have demonstrated that the application of GA accelerates a-amylase production and enhances germination in various plant species

In terms of a-amylase production, GA stimulates the synthesis and release of this enzyme. a-amylase is responsible for breaking down starch into simpler sugars, which are then utilized by the plant for growth and development.

Studies have shown that applying GA to plant tissues or seeds results in an increased production of a-amylase, facilitating the conversion of stored starch into energy-rich sugars.

Regarding germination, GA is involved in breaking seed dormancy and promoting the growth of the embryonic plant.

It stimulates the production of hydrolytic enzymes like a-amylase, which enable the hydrolysis of starch reserves in the endosperm, providing the energy needed for germination and seedling establishment.

Additionally, GA helps in cell elongation and division, promoting the growth of the embryo and the emergence of the radicle.

Evidence for GA's role in both processes includes studies where the exogenous application of GA to seeds or plant tissues has been shown to enhance a-amylase production and promote germination.

Conversely, inhibiting GA synthesis or action results in reduced a-amylase activity and impaired germination. These findings support the critical involvement of GA in both a-amylase production and germination processes in plants.

For more such answers on Gibberellic acid

https://brainly.com/question/15609011

#SPJ8

You are out hiking and walk past a great outcrop of granite that is part of an exposed batholith. Looking closer you notice pieces of sandstone within the batholith. Which rock is OLDER, the granite or the sandstone?

Answers

Answer:

Sandstone is younger than the granite rocks

Explanation:

As the rocks layer found at the bottom are the oldest and closer to the ground surface are the younger. This is due to the law of superimposition and as when looking at the outcrops you will notice pieces of sandstone within the batholith that indicates that the base is formed by granite and is later cemented by sandstone rock

select all the ways rosalba carriera emphasizes the positive shapes in the portrait of gustavus hamilton. multiple select question. by limiting the number of positive shapes by using texture to define positive shapes by changing the color of the shapes by limiting the color of the ground

Answers

To emphasize positive shapes in a portrait, an artist may use techniques Such as: Limiting the number of positive shapes, Using texture to define Positive shapes, Changing the color of the shapes, Limiting the color of The ground.

Limiting the number of positive shapes: By reducing the number of Positive shapes in the composition, an artist can draw the viewer's Attention to the remaining shapes.

Using texture to define positive shapes: By using different textures to Create positive shapes, an artist can add depth and visual interest to the Composition. This can also help to distinguish the positive shapes from Negative space.

Changing the color of the shapes: By using contrasting colors to define Positive shapes, an artist can create a sense of vibrancy and energy in the Composition. This can also help to draw the viewer's attention to the Positive shapes.

Limiting the color of the ground: . This can help to emphasize the positive Shapes and create a sense of Balance in the composition.

To learn more about Positive shapes

https://brainly.com/question/6283400

#SPJ4

What is the flexibility of spider silk determined by the structure of its molecules

Answers

The flexibility of spider silk determined by the structure of its molecules is quite strong.

The components that make up spider silk are what give it its flexibility. Proteins called fibroins, which are made up of amino acids organised in a certain sequence, make up spider silk. The arrangement of amino acids in fibroin proteins results in a helical structure, which is held together by hydrogen bonds between the amino acids.

The fibroin protein chain's exact arrangement of amino acids and hydrogen bonds produces a special blend of strength and flexibility. The silk is flexible enough to stretch and absorb energy without breaking and robust enough to resist significant stress. Spider silk is a fantastic material for many uses, including clothes, medical equipment, and even bulletproof vests, thanks to its unique mix of qualities.

Read more about spider silk on:

https://brainly.com/question/31059418

#SPJ1

what determines whether regeneration or fibrosis occurs?

Answers

Answer:

Whether regeneration occurs depends on (1) the regenerative capacity of involved cells (ie, their ability to divide), (2) the number of surviving viable cells, and (3) the presence of a connective tissue framework that will provide a base for restoration of normal tissue structure.

(1 point)
3. What kind of scientist examines rocks to learn about Earth's history and
structure
COO
Obotanist
O chemist
O geologist
Obiologist

Answers

Answer:

Geologist

Explanation:

Geo means earth

Which statement differentiates between prokaryotic cells and eukaryotic cells?

Answers

Answer: The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not. The nucleus is where eukaryotes store their genetic information.

Explanation:

Answer:

definettly 12345678900000101010101010110001110101

why did the researchers add filtrate which macerated moss had been removed to control microcosms?(worth 5marks)​

Answers

The researchers in question opted to remove the macerated moss from the control group in order to guarantee that the results were accurate.

The experiment in question consists of:

Placing volcanic rock samples into two glass containersAdding to one container the mixture of macerated moss and waterThe other container is the control, it receives only waterThe goal is to measure the release of minerals from the rocks.

When performing an experiment, the control group is of vital importance. The presence of a control group ensures the accuracy of an experiment.

Given that moss is grown on rocks and will erode the rock over time, the researchers opted to remove it from the control sample. Minerals present in the rock might mistakenly be measured as minerals released from the volcanic sample, thus making the results of the experiment inaccurate.

To learn more visit:

https://brainly.com/question/1073731?referrer=searchResults

why did the researchers add filtrate which macerated moss had been removed to control microcosms?(worth

Can someone feel this chart out and give explanations. It’s on Benedict’s test, iodine test, Sudan test, and biuret test.

Can someone feel this chart out and give explanations. Its on Benedicts test, iodine test, Sudan test,

Answers

The biuret test is used to detect the presence of proteins in a sample. Biuret reagent is added to the sample, and if proteins are present, the copper ions in the reagent will bind to the peptide bonds in the protein, causing the solution to turn from blue to purple. The intensity of the color change is proportional to the amount of protein present in the sample.

What are Benedict’s test, iodine test, Sudan test, and biuret test?

Benedict's test is used to detect the presence of reducing sugars, such as glucose and fructose, in a sample. To perform the test, the sample is mixed with Benedict's reagent and heated in a water bath. If reducing sugars are present, the solution will change from blue to green, yellow, orange, or red, depending on the concentration of reducing sugars.

The iodine test is used to detect the presence of starch in a sample. Iodine is added to the sample, and if starch is present, the iodine will bind to the starch molecules, forming a blue-black color.

The Sudan test is used to detect the presence of lipids or fats in a sample. Sudan III or Sudan IV dye is added to the sample, and if lipids are present, the dye will bind to the lipids, causing them to appear as red droplets in the sample.

Learn more about Benedict’s test and Sudan's test at:

#SPJ1

What type of atmospheric conditions does weather describe? Average Current O Global Long tem​

Answers

Answer:

Average current

e.g convectional currency

Answer: aVerAge

Explanation: I tOoK tHE tEST!

Please someone to help me out​
Brainliest reward for the helper

Please someone to help me outBrainliest reward for the helper

Answers

Answer:

It stimulates appetite and energy storage.

Explanation:

Ghrelin is your "hunger hormone", being responsible for that hungry feeling. It also induces energy storage in the form of fat.

Answer:

stimulates appetite and energy storage

Please help ASAP
(30points)
What happens to the glucose molecule during the process of cellular respiration?

A) It gets broken down.

B) It forms oxygen.

C) It builds muscles.

D)It uses up energy.

Answers

the answer is A, a glucose molecule is gradually broken down into carbon dioxide and water. i hope this helps

Answer:

During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water. so A

Explanation:

What you know about photosynthesis

Answers

Answer:

1. Plants use photosynthesis.

2. Photosynthesis uses water, carbon dioxide, and sunlight to make sugar.

3. Photosynthesis makes oxygen for animals to breathe.

Explain a standard curve and mention what is its use

Answers

A standard curve is a tool that allows us to estimate the DNA concentration of unknown samples by comparing them to standards with known DNA concentrations.

Other Questions
_____is 1/1000 oF an ampere, the current used for facials and scalp treatments. You have been called in to value a dental practice by an old friend and have been provided with the following information: The practice generated pre-tax income of $ 550,000 last year for the dentist, after meeting all office expenses. The income is expected to grow at 2% in perpetuity, with no reinvestment needed. The tax rate is 40%. The dentist currently spends about 20 hours a week doing the accounting and administrative work. You estimate that hiring an external accounting service will cost you $25,000 annually. As an alternative to private practice, the dentist could work at a dental hospital nearby at an annual salary of $ 150,000. (Neither was considered when estimating the income above) The office is run out of a building owned by the dentist. While no charge was assessed for the building in computing the income, you estimate that renting the space would have cost you $75,000 a year. The unlevered beta of publicly traded medical service companies is 0.80 but only one-third of the risk in these companies is market risk. The dental practice has no debt. (You can use a riskfree rate of 4.25% and a risk premium of 4%). a. Estimate the cost of capital that you would use in valuing this practice. (1 point) b. Estimate the value of the practice for sale in a private transaction to another dentist who is not diversified. EASY 5TH GRADER WORK!Describe the sediment of the Iroquois Nation towards the British. Ms. Lopez wants to buy an ipod. The ticket price shows $225. But she only brought $146.50 to the store. What percent discount would she need so that the ipod sells at the exact amount she has in her pocket? PLEASE HELP ME!!!! HOMEWORK DUE IN 30 MIN!!!!!! find the maximum and minimum values of the function y = 4 x2 1 x on the interval [0, 2]. (round your answers to three decimal places.) maximum minimum How is hydrogen isolated from water what is the probability that there will be fewer than 2 arrivals in a given minute? choose all the functions of the enteric nervous system. multiple select question. to regulate the secretion of digestive enzymes to regulate the respiratory rate to regulate the formation of gametes to regulate motility through the digestive tract to regulate salivation a standoff between nato and russia concerns events surrounding what eastern european nation, which has experienced an armed conflict since 2014? Calculate the speed of light in an unknown substance whose index of refraction is 1.65. Would you expect the light to bend toward the normal or away from the normal when it passes from air into the substance? Inflationary fiscal policies Provide the policy action for consumption, Investment, and Government expenditure Indicate policy outcomes in terms increase or decrease Consumption Investment Governm. true or false? What is the characteristic of the music Hudhud?. Qual seria o consumo mensal de energia eltrica de um chuveiro de potncia de 7000W quel funciona cerca de 10 minutos por dia?? Market entry mode which doesn't have the drawback of training potential competitors is:a.greenfield wholly-owned manufacturing.b.joint venture.c.licensing.d.contract manufacturing. Margaret walks to the store using the following path 0. 630 mi west, 0. 370 mi north, 0. 180 mi east. Assume north to be along the +y-axis and west to be along the -x-axis. What is the magnitude of her total displacement? Simplify 2x^3 3x^2 short essayExplain how HRM plays a strategic role within anorganisation. Which intervals are most appropriate for a histogramdisplaying the mileage ratings?The list shows the mileage rating (in mpg) for some 2019vehicles with all-wheel or four-wheel drive.11, 13, 14, 14, 15, 15, 15, 16, 16, 16, 17, 17, 17, 17, 18,18, 18, 18, 19, 19, 19, 19, 20, 20, 20, 20, 20, 21, 21, 21,21, 21, 21, 22, 22, 22, 22, 22, 23, 23, 23, 23, 23, 24, 24,24, 24, 24, 24, 25, 25, 25, 26, 26, 26, 27, 27, 27, 28, 29,30, 31, 32, 33, 34O 0-15, 15-30, 30-45O 020, 20-40, 40-60O 10-15, 15-20, 20-25, 25-30, 30-35O 0-5,510, 10-15, 15-20, 25-25, 25-30 the amino acid selenocysteine is one of the components of selenoproteins, more than 20 of which have been identified so far in human cells. structure in the structure of this interesting amino acid, how many of each type of hybrid orbital illustrated here are present?