I need help with.
Imagine you are on a cooking show. Write what you are doing to cook the dish using present tense verbs.

Answers

Answer 1

Today on the cooking show, I am preparing a delicious chicken stir-fry with vegetables. First, I am heating up the pan with some oil. Then, I am chopping up the chicken into small bite-sized pieces and adding them to the pan. While the chicken is cooking, I am chopping up some fresh vegetables such as peppers, onions, and broccoli. Once the chicken is cooked through, I am adding the vegetables to the pan and stirring everything together. To add some flavor, I am seasoning the stir-fry with some soy sauce, garlic, and ginger. Finally, I am letting everything cook together for a few minutes until the vegetables are tender and the chicken is fully cooked. And there you have it, a delicious and healthy chicken stir-fry ready to be served!

Related Questions

resumen largo de el libro manzanas rojas

Answers

Answer:

Explanation:NEED HELP I SUCK AT ELA(+BRAINLEST)(+5 STARS)(+THANKS ON PROFILE)

I need some help. With thank and make brainliest the correct answer

I need some help. With thank and make brainliest the correct answer

Answers

Answer:

1 could be: mis, sus, or tus

2 could be: nuestra, mi, or tu

Explanation:

I really don't like how it could be all of these even though you can only pick one, I do speak spanish and these three would all make sense for 1 and the other three I have selected for 2 would also make sense. I wish you luck and hope this helped some.

Answer all blank spaces. Thank you

Answer all blank spaces. Thank you

Answers

A)
1. veía
2. eran
3. éramos, íbamos
4. vas, ves
5. eran, era, iban

B)
1. De pequeño era un niño alegre, me gustaba jugar con mis juguetes y veía mucho la televisión.
2. Íbamos a diferentes ciudades en Estados Unidos y paseábamos, íbamos a restaurantes y a museos.
3. De niño veía mucho caricaturas como Bob Esponja.

what type of investigation is laura studying

Answers

Answer:

Sinkhole.

Explanation:

Answer:

Sinkhole

Explanation:

Yo ________ de la casa, si yo no tuviera que cocinar. A. saliría B. saldrías C. salerías D. saldría

Answers

Answer:

D

Explanation:

porque estas hablando sobre si podrias salir

Answer:

saldría.

Explanation:

The sentence is in the conditional tense, expressing a hypothetical situation or a condition that is contrary to fact. The missing word should be conjugated in the first person singular (yo) to match the subject of the sentence.

The verb "salir" means "to go out" or "to leave," so the correct option is "saldría," which is the conditional form of "salir" for the first person singular. The sentence translates to "I would go out of the house, if I didn't have to cook."

Read and choose the option with the correct article to complete the sentence.

Ella tiene ________.

un labio roja
un labio rojos
una labio rojas
unos labios rojos

Answers

Answer:

- Unos labios rojos.

Explanation:

- Ella tiene unos labios rojos.

...

1. Te_______el pez grande.

O gustan
O gusta

Answers

the correct answer would be gustan
Gutsan is correct ♥︎..

23. ¿Por qué se negó a jugar Francisco? (83)

Answers

Answer

Porque tenia que vender pan

Explanation:

If you play Genshin Impact which Archon is better:

Venti

Zhongli

Raiden Shogun

Nahida

Answers

venti is better than the ones listed

I love all of them, zhongli makes team better, venti is good for abyss, and Raidens burst is so amazing, nahida is very aesthetically pleasing with her attacks and idle

Mi amigo y yo _____ café en la cafetería​

Answers

Explanation:

Disfrutan del café.................................

disfrutamos un café en la cafetería

Question 3(Multiple Choice Worth 1 points)
(04.07 LC)
Read and choose the correct option to complete the sentence.
En el parque, las hermanas se divierten en
O el columpio
O el trompo
O la cometa
O la canica

Answers

Answer: El columpio

Explanation: Bc is asking in what not of what

Answer:

En el parque, las hermanas se divierten en el columpio

Hope this helps :)

Pls brainliest...

Which part of a car is used to drive in a certain direction?

A.
la palanca de cambio
B.
el maletero
C.
el volante
D.
el asiento

Answers

Answer: C. El Volente

Explanation: Transmite el movimiento de direccion a las ruedas.

Translation: Transmits the steering movement to the wheels.

Easy grammar should be easy for speakers please help ❗️

Easy grammar should be easy for speakers please help

Answers

Answer:

it would be es

Explanation:

Answer:

yeah its es

Explanation:

5. ¿Cómo se llama el lugar donde trabaja el presidente de Argentina, que está al lado de la Plaza de Mayo? Se llama ______ 6. ¿Qué tienen en común el Barrio de La Boca de Buenos Aires (Argentina) y el Barrio Reus, de Montevideo (Uruguay)? Tienen______ ​

Answers

De acuerdo con la información podemos inferir que los término que completan las oraciones son: Plaza de Mayo y Patrimonio cultural y artístico.

¿Qué términos completan las oraciones?

Para identificar el término el lugar donde trabaja el presidente de Argentina, que está al lado de la Plaza de Mayo, se llama Casa Rosada. Es la sede del Poder Ejecutivo y es el lugar donde el presidente lleva a cabo sus funciones y actividades oficiales.

¿Qué tienen en común el Barrio de La Boca de Buenos Aires y el Barrio Reus?

Tanto el Barrio de La Boca en Buenos Aires, Argentina, como el Barrio Reus en Montevideo, Uruguay, comparten características culturales y artísticas significativas. Ambos barrios son conocidos por su vibrante vida cultural, sus calles coloridas, su arquitectura distintiva y su conexión con el mundo del arte.

Además, ambos barrios son famosos por ser cunas del tango, un género musical y de baile icónico de la región. Estos elementos culturales en común hacen que tanto La Boca como Reus sean destinos turísticos populares y centros de interés cultural en sus respectivas ciudades.

Aprenda más sobre Argentina en: https://brainly.com/question/5332756
#SPJ1

¿Cuánta gente hay en el aeropuerto?

Hay mucha gente.
Hay mucho gente.
Hay muchas gente.

Answers

Answer:

hay mucha gente

Explanation:

Answer:

О  Hay mucha gente.                      

Explanation:

¿Cuánta gente hay en el aeropuerto?

О Hay mucha gente.

...

DANIELA ¡Hola! Mucho gusto. Yo (2) 2 of 6 Daniela y ella (3) 3 of 6 Mónica. ¿De dónde (4) 4 of 6 (tú), Juan?

Answers

De acuerdo con la información, podemos inferir que las oraciones correctas son: (2) Me llamo Daniela. (3) Ella se llama Mónica. (4) ¿De dónde eres tú, Juan?

¿Cómo son las oraciones completas?

Para saber cómo son las oraciones completas debemos tener en cuenta la información disponible para poder identificar la información faltante. En este caso podemos inferir que en la conversación, se establece que:

La hablante se llama Daniela (2)La otra persona se llama Mónica (3)Cuando se se pregunta sobre la procedencia de Juan (4). La respuesta utiliza pronombres y verbos correspondientes para indicar los nombres y acciones correctos en la conversación.

Aprenda más sobre oraciones en: https://brainly.com/question/28325101
#SPJ1

1. ¿A quién se debe llamar o con quién se debe consultar en estas situaciones? ¡OJO! Incluya el artículo definido (el, la).
Hay más de una respuesta posible en algunos casos.
Please be correct

1. A quin se debe llamar o con quin se debe consultar en estas situaciones? OJO! Incluya el artculo definido

Answers

Answer:

1. Al plomero

2. Al asegurador

3. Al psicólogo

4. Al albañil

5. Al periodista

Explanation:

Read and choose the option with the correct word or words to complete the sentence.

Yo miro con ________.

los dedos
las orejas
los ojos
las manos

Answers

Answer:

c. los ojos

is correct I did it

Explanation:

Yo miro con ________.

los dedos

las orejas

los ojos

las manos

The complete sentence is: Yo miro con los ojos. The Option C.

¿Con qué parte del cuerpo suelo mirar?

La respuesta correcta para completar la frase es "los ojos". En nuestra capacidad visual, los ojos son la herramienta principal que utilizamos para observar y percibir el mundo que nos rodea.

A través de la captura de la luz y la formación de imágenes en la retina, nuestros ojos nos brindan la experiencia visual que nos permite comprender y apreciar nuestro entorno. Los demás elementos mencionados, como los dedos, las orejas y las manos, cumplen otras funciones sensoriales y táctiles, pero no están directamente relacionados con el acto de mirar.

Read more about complete sentence

brainly.com/question/27952797

#SPJ3

What is the correct answer?

What is the correct answer?

Answers

Answer:

Blank 1 me

Blank 2 gusta

Explanation:

I believe this is right but it could be wrong

me
gusta
Hope this will help

Which phrase correctly completes this sentence?

El Carnaval en Ecuador se celebra con _______________________.

A.
visitas al cementerio
B.
procesiones religiosas
C.
la fiesta rosada
D.
desfiles coloridos

Which phrase correctly completes this sentence?El Carnaval en Ecuador se celebra con _______________________.A.

Answers

Answer:

Carnival in Ecuador is celebrated with colorful parades.

El Carnaval en Ecuador se celebra con desfiles coloridos. (Amusement Park)

Holiday: El Carnaval en Ecuador se celebra con la fiesta rosada.

(Option D) or (Option C)

What is Carnival?

A carnival is an event that brings people together, typically around a number of movable rides and carnival games.

In several nations, CARNEVALE serves as Mardi Gras. Because they will soon enter Lent and be required to give up a lot of meat, it is a time when people celebrate with a large feast that includes masquerades, fancy dress, and parties.

#SPJ2

Answer:

D. desfiles coloridos.

Explanation:

El carnaval en Ecuador se celebra con desfiles coloridos.

,

1.) Estadounidense, es (el, la, or un) nacionalidad de ella.
2.) Es (el, uno, or la) mapa de los Estados Unidos.
3.)Ellos son (aleman, puertorriqueno, or japoneses)
4.)(unos, los, or las) chicas so intelligent (es, os, or as)
5.)Marie es de Francia. Ella es (espanola, Francesca. or francesca)
6.) La ciudad de México es (uno, una, or un) (grande, bueno, gran) ciudad.
Thank you!

Answers

Answer:

1.)  American, is (he, the, or a) her nationality.

2.) It is (the, one, or the) map of the United States.

3.)   They are (German, Puerto Rican, or Japanese)

4.)  (some, los, or las) girls so intelligent (es, os, or as)

5.)  Marie is from France. She is (Spanish, Francesca. Or Francesca)

6.) Mexico City is (one, one, or one) (great, good, great) city.

Thank you!

Read and choose the correct option to answer the question.

La dosis del jarabe para la tos es dos cucharadas cada día. Toma la medicina cada cuatro horas.

For which scenario would the directions best apply?

A person with the flu
A person with questions for the pharmacist
A person who has an open wound
A person who has twisted an ankle

Answers

Answer:

A person with questions for the pharmacist

Explanation:

Answer:

A person with the flu

Explanation:

Took test, got it right

Ivkjcfv
Gbvghhgghgvv c vhb hhdhruururuhrhrhfhfhfhdhdhfuurufuufuu if djdo ci ci c7os f8 c7os tv f dj it to ur dg tr dj hgt
m bi Co ci ci f8

Answers

what is it for?

it's just Random letters

Answer:

Ivkjcfv

Gbvghhgghgvv c vhb hhdhruururuhrhrhfhfhfhdhdhfuurufuufuu if djdo ci ci c7os f8 c7os tv f dj it to ur dg tr dj hgt

m bi Co ci ci f8   means gavy gave huffy a cicicle

Explanation:

you just have to add the words and put them upside down

i know words codes

pls mark brainlest for real pls pls

3 Argumente la conveniencia o no de regirse
siempre por las normas al hablar.

Answers

Answer:

Argumentos a favor de regirse siempre por las normas al hablar:

Comunicación efectiva: Al seguir las normas gramaticales y lingüísticas al hablar, se comunica con mayor claridad y precisión, lo que ayuda a evitar malentendidos y confusiones.Profesionalismo: En algunos contextos, como en el ámbito profesional, es importante demostrar un alto nivel de habilidad lingüística y un dominio del lenguaje, lo que puede marcar la diferencia en la calidad del trabajo y en la percepción de los demás sobre la competencia y la credibilidad.Preservación de la lengua: Las normas gramaticales y lingüísticas son una parte importante de la cultura y la identidad de una comunidad lingüística. Seguir estas normas contribuye a mantener y preservar la riqueza y la diversidad de la lengua a lo largo del tiempo.

Argumentos en contra de regirse siempre por las normas al hablar:

Creatividad: Seguir estrictamente las normas lingüísticas puede limitar la capacidad de expresión creativa y originalidad. Al permitirse cierta flexibilidad y experimentación en el uso del lenguaje, se puede enriquecer el discurso y crear nuevas formas de comunicación.Contexto y audiencia: Las normas lingüísticas pueden ser diferentes según el contexto y la audiencia. En algunos casos, las normas pueden ser irrelevantes o incluso contraproducentes, lo que dificulta la comunicación efectiva.Exclusión: El énfasis excesivo en las normas lingüísticas puede crear barreras para aquellos que no tienen acceso a una educación formal o que no hablan el idioma como lengua materna. Esto puede excluir a ciertos grupos de la sociedad y reforzar las desigualdades lingüísticas y culturales.

Negro Sin Nada En Tu Casa
…Y siempre tu sudor que no termina
de caer en la tierra.
Tu sudor tan antiguo, pero siempre tan nuevo
tu sudor en la tierra.
Agua de tu dolor que fertiliza
más que el agua de nube.
Tu sudor, tu sudor. Y todo para aquél
que tiene cien corbatas, cuatro coches de lujo,
y no pisa la tierra.
Sólo cuando la tierra no sea tuya,
será tuya la tierra.

This excerpt is an example of which elements of Cabral’s poetry?

Answers

Answer:

The excerpt presented is an example of the social and political criticism that permeates Cabral's poetry. Cabral's work often denounced the exploitation of the working classes, the oppression of the indigenous peoples, and the effects of colonization on African societies.In this excerpt, Cabral is criticizing the exploitation of poor farmers who sweat and toil to cultivate the land but are ultimately robbed of their labor by wealthy landowners who profit from their hard work. Cabral is also expressing the idea that true ownership of the land can only be achieved when the people who work on it can enjoy its benefits.

Drawing from your culture lessons and at least one Spanish language resource, write a one paragraph summary report on a significant event, movement, or historical figure from either Peru, Costa Rica, Bolivia, or Argentina. You may search the internet for articles, newspapers, books, other media, use books from the library, or any other Spanish language source you choose.

In your summary report you should also discuss what you learned or realized from your research. Also, be sure to cite your Spanish sources of information.

Your response must contain at least 5 detailed and complete sentences in Spanish.

You will be graded on (a) appropriate use of grammar and vocabulary, (b) completeness and detail of the response, and (c) overall quality of the response.

Answers

An important figure in Peru was the indigenous leader Tupac Amarú who rebelled against the Spanish crown in the Viceroyalty of Peru.

Who was Tupac Amaru?

José Gabriel Condorcanqui Noguera (1738-1781) better known as Túpac Amaru II was a prominent indigenous leader of mestizo origin who led the Great Rebellion against the Spanish crown in the year 1780.

Tupac is important to the history of America and Peru because he was the first to carry out an independence rebellion in America. In his ideas it was noted that he radically rejected the abolition of taxes and sought to abolish black slavery for the first time.

Learn more about Tupac Amaru in: https://brainly.com/question/24418448

#SPJ1

Answer:

An important figure in Peru was the indigenous leader Tupac Amarú who rebelled against the Spanish crown in the Viceroyalty of Peru.

Who was Tupac Amaru?

José Gabriel Condorcanqui Noguera (1738-1781) better known as Túpac Amaru II was a prominent indigenous leader of mestizo origin who led the Great Rebellion against the Spanish crown in the year 1780.

Tupac is important to the history of America and Peru because he was the first to carry out an independence rebellion in America. In his ideas it was noted that he radically rejected the abolition of taxes and sought to abolish black slavery for the first time.

Explanation:

What is Día de los Muertos, the Day of the Dead?

Answers

Answer:

it is a mexican national holiday

Explanation:

you honor the people who has passed

Yo soy un ESTUDIANTE. (inteligente)

Answers

Answer:

Explanation:

I am a student. (smart/intelligent)

What can you put in a bolsa?
dinero
hijo
buey
fregadero

Answers

Dinero
Meaning money

Answer:

О  Dinero.                  

Explanation:

What can you put in a bolsa?

(¿Que puedes poner en una bolsa?)

О dinero.

...

How many conjugated reflexive verbs are there? Count each individually even if it’s repeated more than one time.

How many conjugated reflexive verbs are there? Count each individually even if its repeated more than

Answers

Answer:

There are 10  conjugated reflexive verbs

Answer:

there is 15!

Explanation:

1.tienen

1. despiertan

2. comen

3. visten

4. juegan

5. miran

6. duermen

7. comen

8. van

9. aprenden

10. comen

11. banan

12. cepillan

13. acuestan

14. duermen

Other Questions
Angel typically orders a 12-ounce Frappuccino that has 430 calories. If she orders the 20 ounce version, how many calories does ithave? Round to the nearest whole number.Answer: ___ calories each year in the united states, more than _______ girls have a child before their eighteenth birthday. A feedback intervention was implemented to improve accuracy at a car manufacturing plant Monday through Friday. Baseline data was collected, and on day 6 the feedback system was implemented. The goal was set for 70% and data was collected everyday. Accuracy Percentages Baseline: 15% 20% 22% 30% 25% Feedback: 55% 68% 65% 71% 76% Use the information above to plot accuracy performance for the car manufacturing plant. Be sure to include all of the appropriate labels and items necessary for a complete graph Choose the word which best completes the sentence.He told me keep my foot towards the rear, or_____, of my board.a.nosec.trucksb.taild.snapPlease select the best answer from the choices providedABCD 6) John just turned 15 years old. His parents started saving $300 each month for hiscollege education when he was born. His parents want to save at least $150,000 bythe time he turns 18 to cover tuition expenses at a 4-year college. How much wouldthey need to save each month for the next 3 years to reach their goal?A.$300OB.$700C.$2,700D.$5.400 . What is the difference between single and three phase AC supply? 7. What are the different types of gears? What are their advantages and disadvantages? 8. How to vary the mixing speed and direction? 9. How to avoid the splash from mixing? 10. How to ensure the easiness to assemble and disassemble? Which of the following statements regarding supply chain customer service is most accurate?a. The most common form of supply chain is the collaborative-response efficiency strategy.b. In order for a supply chain to work effectively, key decisions should be made by a third-party logistics provider.c. The longer the supply chain the greater the economies of scale and the better the profit margins.d. Supply chains should consider the needs of consumers provided those needs are consistent with marketing strategies.e. Supply chain managers often need to make trade-offs between efficiency and responsiveness. what is Methanobrevibacter ruminantium's effect on digestion in cattle? Beneficial Pathogeni Neither helps nor hurts mike markel. technical communication, e-book --11th edition, bedford/st. martins, 2015 Exercise 1 Circle the gerund or gerund phrase in each sentence.The whistling of the wind makes the house seem lonely. WOUND CARE MAINTENANCE Scenario A: A cross country runner was on his way back from his daily run and he slipped on a rock. The rock ended up slicing the lateral aspect of his RIGHT lower leg from the ankle to the knee causing a deep cut in the middle of the leg. He finishes running to the athletic training room with a lot of blood dripping down his leg and onto the floor. 1. What type of injury is described What infection is caused by the bacterium Staphylococcus aureus? Jennifer is going to line the perimeter of her swimming pool with tile. What is the distance around her pool that needs to be tiled? a 36.56 b 44.56 c 38.28 d 30.28 Consider the following DNA fragment from four different suspects in a crime: Suspect 1 - ACGTACGGTCCGACCTT Suspect 2 - ACCTACGGCGGCGGTCCGACCTT Suspect 3 - ACATACGGTCCGACCTT Suspect 4 - ACGTACGGCGGTCCGACCTT Select all of the true statement(s) about these suspects and their DNA. Check All That Apply This stretch of DNA contains one SNP. This stretch of DNA contains two SNPs. Suspect 2 has three copies of an SNP. Suspects 1 and 3 have the same number of copies of an STR. Suspect 2 has three copies of an STR. Select the most ancient mtDNA haplogroup and the most ancient Y chromosome haplogroup. Check All That Apply T A L N A retail store had sales of $46,000 in April and $55,800 in May. The store employs eight full-time workers who work a 40-hour week. In April the store also had six part-time workers at 9 hours per week, and in May the store had seven part-timers at 13 hours per week (assume four weeks in each month). Using sales dollars as the measure of output, what is the percentage change in productivity (dollars output per labor hour) from April to May Can anyone help me answer this question?Let A, B, C e sets. Which of the following properties is the cumulative law?a. A B = B A b. A B = B Ac. A B = B Ad. (A B) C = A (B C) Suppose a fossil was buried thousands of years ago. Describe how the fossil changed over time and how scientists can determine the age of the fossil. A Which of the following is NOT a reason for US imperialism?B Open markets for American businessKeep out competitors from new territoriesC Gain more American workersD Improve other people by teaching them to be more like Americans Radioactive element A decays over time to element B. Element A has a half-life span of 5 days. If you started with 20 grams of A and 0 grams of B, how many grams of B would there be after a total of 10 days? 1) 0 grams2) 2.5 grams3) 5 grams4) 7.5 grams5) 10 grams6) 12.5 grams7) 15 grams8) 17.5 grams 9) 20 grams10) 22.5 grams11) 25 grams 12) 27.5 grams Which diagram shows the correct direction of electron flow in an electrolytic cell?attachments in order A B C D