The body of a medusa is composed of two different layers, the ectoderm, and the endoderm.
They have an umbrella shape, the aboral zone (the pole opposite to the mouth) is convex and is called the exumbrella. The concave oral zone is called the subumbrella, at the end of which the mouth opens. From the edge of the exumbrella hang several tentacles provided with numerous cnidocytes, the typical stinging cells of cnidarians.
The tissue that makes up their bodies is called mesoglea and unlike polyps, it is normally very thick and gelatinous, but may attain cartilaginous consistency in some species.
what is primary productivity
Primary productivity is the process where inorganic substance are synthesized by organisms to produce a simple organic materials.
Example: Diatoms,Dinoflagsllates and coccolithophores etc
1. )Which of the following would be classified as an acute disease condition?
swine flu
pinkeye
broken leg
all of the above
2.) All chronic diseases are present at birth and are always fatal.
true
false
3.) The term "dermatitis" refers to:
the study of skin diseases
Inflammation of the skin
neither of the above
10. How do the personality traits of married couples compare to randomly coupled people?
O A. Personality traits have no impact on relationships.
B. Married couples often have fewer similarities than randomly coupled people.
C. Married couples often have more similarities than randomly coupled people.
D. Married couples often have nothing in common.
Answer:B
Explanation:
Answer: Married couples often have more similarities than randomly coupled people.
Explanation: "researchers developed a couple-based compatibility test to measure the compatibility of couples based on similarity in looks, personality, intelligence, social skills, attitudes, habits, and leisure preferences. Married couples had the most similarities compared to randomly coupled people. This information suggests that we’re more likely to look for people who are just like ourselves. Science certainly seems to suggest that opposites don't always attract."
One model of a DNA molecule is a twisted ladder.
In this model, what do the rungs of the ladder represent?
O A. Nitrogen bases
B. Sugars
C. Amino acids
D. Phosphates
Answer:
a
Explanation:
Answer:
Explanation:
Yes correct Nitrogen bases!
the scottish fold is a breed of cat with a mutation in a gene involved in cartilage development. the result is that each ear of the cat has a crease, so the ears fall forward and lie against the head instead of standing up like the ears of most small cats. the mutation is a dominant allele.
a cat that is heterozygous for the fold allele mates with a cat that is homozygous for the fold allele.
what are the expected percents of offspring that will have each characteristic?
In complete dominance, the presence of at least one dominant allele in the genotype is enougth to express the dominant phenotype. 100% of the offspring will have mutated creased ear, while 0% of the will have normal standing ear.
What is complete dominance?
Complete dominance is the inheritance pattern in which the dominant allele completely masks the recessive allele.
This interaction between alleles is observed in individuals who are heterozygous for a particular gene. They carry both alleles but only express the dominant trait. The dominant allele is hiding the expression of the recessive allele.
In the exposed example,
E is the dominant allele and codes for the mutated creased ear,e is the recessive allele and codes for the normal standing ear.Cross: a cat that is heterozygous with a cat that is homozygous for the fold allele.
Parentals) Ee x EE
Gametes) E e E E
Punnett square) E e
E EE Ee
E EE Ee
F1) 50% of the progeny is expected to be heterozygous
50% of the progeny is expected to be homozygous dominant
100% of the progeny is expected to have ears with a crease.
The expected percents of offspring that will have each characteristic are,
100% of the animals will have mutated creased ear,0% of the animals will have normal standing ear.You can learn more about complete dominance at
https://brainly.com/question/30640875
#SPJ1
3. What is the probability of a type BO mother and a type AO father having a type O child?
Answer:
B: 75% ////// O: 25%
Explanation:
So each child has a 75% of being B and a 25% chance of being O. Note that genetically, not all of the B blood type kids are the same. The BB child will only pass down the B version of the gene. The BO child can pass on their O gene version.
2. Try to find three different food chain from this food web and write them down?
Three food chains are:
Carrot › Rabbit › Snake › TigerGrass › Squirrel › Snake › EagleTrees › Deer › TigerHope you could understand.
If you have any query, feel free to ask.
What are common risk factors for cancer? Check
all that apply.
O genetic risk factors
behavioral risk factors
biological risk factors
environmental risk factors
travel risk factors
DONE
Answer: a and d
Explanation:
How does a medicine like Benadryl (a medicine taken to suppress allergy symptoms) affect the immune system?
Answer: might impair innate immune responses to bacteria
Explanation:
A crane has a sharp and pointed beak while the duck has a flat beak.Explain why
Answer:
The crane has a sharp and pointed beak adapted for catching and grasping prey. The sharp beak allows the crane to effectively stab and pierce its prey, such as fish, frogs, or small animals. The pointed shape helps the crane to accurately target its prey and secure a firm grip.
On the other hand, the duck has a flat beak, which is better suited for its specific feeding habits. Ducks are primarily filter feeders, and their flat beak enables them to sift through water or mud to collect small organisms, insects, and plants. The flat beak acts like a sieve, allowing the duck to strain out food particles while retaining water.
The difference in beak shape between the crane and the duck reflects their distinct feeding strategies and ecological roles. Each species has evolved its beak shape to optimize its ability to capture and consume the specific types of food sources available in their respective habitats.
Briefly explain the reason that Sedlak gives for water shortages.
Answer:
There are many factors that contribute to this. One being the population as well as climate. ... The population has clearly increased dramatically, which means more people need access to water to survive. Another impact is simply the climate change.
How has human activity, such as deforestation and reliance on fossil fuel, augmented the greenhouse effect and contributed to global warming?
Answer:
They lead to increased levels of carbon dioxide and other greenhouse gases in the atmosphere which causes the greenhouse effect.
Explanation:
Answer:
primary cause of human-created carbon emissions - burning fossil fuels
destroys natural carbon sinks, leading to more co2 in the air - deforestation
emits methane from decomposing matter - waste disposal in landfills
Explanation:
Plato
ATP Synthase is a channel for protons to pass from and area of High concentration to an area
of low concentration. This makes in an example of:
Active Transport
Filtration
Facilitated Diffusion
Osmosis
Exocytosis
You are testing learning and memory in two strains (A and B) of hamsters by determining which hamsters learn and remember how to navigate a maze better. You discover that a strain of hamsters raised in a diverse environment has enhanced memory compared to a strain of hamsters raised in a bare cage. You look at a specific gene that is involved in brain development and is activated during learning and memory. If you use bisulfite treatment and subsequent sequencing to study the methylation pattern is of the promoter for this gene, you find that at the same region of the promoter sequence:
Strain A has the following bisulfite treated sequence: GTACGTTAAACGATCG
Strain A has the following untreated sequence: GTACGTTAAACGATCG
Strain B has the following bisulfite treated sequence: GTATGTTAAATGATTG
Strain B has the following untreated sequence: GTACGTTAAACGATCG
Based on the sequences above, greater levels of transcription for this learning and memory gene more likely occur in which of the strains?
Answer:
The correct answer is - Strain B.
Explanation:
The methylation process is adding the methyl group to the DNA molecule that can alter the activity of the DNA segment without any change in the sequence. Methylation presence in the promotor in a gene can repress the transcription process.
By the sequence given it is clear that strain B is not treated and less likely to methylated whereas strain B is more likely to methylated so the greater transcribe sequence would be - Strain B.
Chemicals that help chemical reactions occur faster rates in living organisms are known as
PLEASE HELP me solve this!!!
Water is able to pass through the tubing.
Will Mark as Brainliest
The enzyme involved in the transcription of RNA molecules is:
O Pepsin
DNA polymerase
Codon
RNA polymerase
Answer:
RNA polymerase is the enzyme involved in the transcription of RNA molecules.
What do scientist think was the first step in the origin of life on earth?
A) Protonionts formed stromatolites near the oceans.
B) Prokaryotes formed when eukaryotes engulfed other eukaryotes.
C) Cyanobacteria caused the great oxidation event.
D) Organic molecules formed in oceans as Earth began to cool.
Scientist think the first step in the origin of life on earth is Organic molecules formed in oceans as Earth began to cool. Option D
What more should you know about scientist theory of the origin of life on earth?There are a handful of theories about how life may have first come to be on our planet.
Scientists hypothesize that the first step toward the origin of life on Earth was the formation of simple organic molecules such as amino acids, nucleotdes, and sugars.
While the exact origin of life on Earth is still a mystery, scientists are always working to learn mre about how life may have startd.
Find more exercises on origin of life;
https://brainly.com/question/30243113
#SPJ1
The scientist think the first step in the origin of life on earth is D) Organic molecules formed in oceans as Earth began to cool.
What was the origin of life on earth?It was recorded that the Microbes, which is the earliest known life forms, left traces of their existence in rocks that were 3.7 billion years old.
However different scientist have their own discoveries, Oparin discussed the idea of a chemical origin for life whereby the biochemical beginning of life as suggested by Oparin and Haldane cannot have taken place on the planet as it is today.
Learn more about earth at:
https://brainly.com/question/25624188
#SPJ1
Select all the correct answers.
Which of these facts were established by other scientists before Charles Darwin published his famous theory of evolution in 1859?
A. Many species have become extinct over time.
B.Variation in characteristics results in the birth of new species.
C.There are many similarities in the anatomy of humans and other species.
D.There are processes in nature that produce organisms that are not able to adapt to the environment.
E.The relationship between evolution and the unity and diversity of life on earth was studied on a large scale.
The facts that were established by other scientists before Charles Darwin published his famous theory of evolution in 1859 were A. Many species have become extinct over time and C. There are many similarities in the anatomy of humans and other species.
What is the theory of evolution proposed by Darwin?The theory of evolution proposed by Darwin is a scientific model to explain how organisms adapt (evolve) regarding environmental conditions
Therefore, with this data, we can see that the theory of evolution proposed by Darwin was based on different previous assumptions.
Learn more about the theory of evolution here:
https://brainly.com/question/1589147
#SPJ1
Please help
Sperm are produced in the _____. They then mature in the_____
Answer: sperm are produced in the testes and mature in the epididymis
Explanation:
how many genders are there in this spiraling down hill world?
Answer:
I think it is something like 72
Explanation:
i know what you mean
what is the second level of organisms
Answer:
Herbivores
Explanation:
What type of asexual reproduction has been observed in placozoans by scientists?
binary fission
fragmentation
budding
conjugation
Answer:
The answer is Budding
Explanation:
That"s the answer
Answer:
A
Explanation:
List and describe 2 habitats you observed. List the species you observed (at least 3 species) and any variation within the species (due to genetic variation within the species) you observed. Indicate which habitat you saw each in. What sorts of things might negatively impact the habitat of the species you observed? For example, spiders living in a flower garden might be negatively impacted by pesticides.
Habitat 1: Forest
Species observed:
Eastern gray squirrel (Sciurus carolinensis)
White-tailed deer (Odocoileus virginianus)
Red-tailed hawk (Buteo jamaicensis)
Genetic variation observed:
The Eastern gray squirrels had variation in their fur color, with some individuals having darker or lighter shades of gray.
The White-tailed deer had variation in their antler size and shape, with some individuals having larger or more branched antlers than others.
The Red-tailed hawk had variation in their feather coloration, with some individuals having darker or lighter shades of red on their tails.
Negative impacts on the habitat:
Deforestation and habitat loss due to human activities such as logging and urban development can negatively impact the forest habitat of these species.
Pollution, including air and water pollution, can also negatively impact the health of the forest ecosystem and the species that depend on it.
Habitat 2: Coral reef
Species observed:
Clownfish (Amphiprioninae)
Blue tang (Paracanthurus hepatus)
Green sea turtle (Chelonia mydas)
Genetic variation observed:
The Clownfish had variation in their coloration, with some individuals having brighter or darker stripes than others.
The Blue tang had variation in their fin shape, with some individuals having longer or more pointed fins than others.
The Green sea turtle had variation in their shell pattern, with some individuals having more or fewer scutes (the bony plates that make up their shell).
Negative impacts on the habitat:
Climate change and ocean acidification can negatively impact the health of coral reefs, which in turn can affect the species that depend on them.
Overfishing and destructive fishing practices can also damage coral reefs and reduce the populations of fish and other species that depend on them.
Which of the following helps protect biofilms from issues such as drying out and predators
a.) Extracellular polymeric substances
b.) Quorum sensing
c.) Becoming sessile
d.) Autoinducers
Extracellular polymeric substances help protect biofilms from issues such as drying out and predators. Option A
Biofilms are complex communities of microorganisms that adhere to surfaces and form a protective matrix. They can be found in various natural and artificial environments, such as riverbeds, medical devices, and plumbing systems. Biofilms provide advantages to the microorganisms within them, including protection from environmental stresses and predators.
One of the key components that helps protect biofilms is extracellular polymeric substances (EPS). EPS are complex mixtures of polysaccharides, proteins, and DNA that are secreted by microorganisms within the biofilm. These substances form a matrix that encases the cells, providing structural support and protecting the community.
EPS help biofilms resist drying out by retaining water and preventing desiccation. The polysaccharides in EPS can absorb and retain moisture, creating a hydrated environment within the biofilm even in dry conditions. This is crucial for the survival of the microorganisms within the biofilm.
Additionally, EPS serve as a barrier against predators. The matrix formed by EPS can make it difficult for predators, such as protozoa or grazing organisms, to access and consume the microorganisms within the biofilm. It acts as a physical defense mechanism, limiting the exposure of the microorganisms to predation.
While quorum sensing, becoming sessile (immobile), and autoinducers are all important mechanisms and processes associated with biofilms, they do not directly address the protection of biofilms from drying out and predators. So Option A is correct.
For more question on biofilms visit:
https://brainly.com/question/13232627
#SPJ8
A cladogram of five species is shown. Based on the cladogram, the ancestral species most likely had-
What 4 things do both eukaryotic and prokaryotes cells contain?
Answer:
Both prokaryotic and eukaryotic cells have structures in common. All cells have a plasma membrane, ribosomes, cytoplasm, and DNA. The plasma membrane, or cell membrane, is the phospholipid layer that surrounds the cell and protects it from the outside environment.
Explanation:
The similarities between the eukaryotic and prokaryotic cells are:
Cell membraneRibosomesDeoxyribonucleic acid (DNA)Cell wallEukaryotic cells are those cells that contains organelles that are membrane-bound. These cells are found in plants, animals, fungi, and protists.
Prokaryotic cells are those cells that does not contain membrane-bound organelles. The cell structure is simple with no definite nucleus.
There are four components that can be found in both the eukaryotic and prokaryotic cells. They include:
Cell membrane: This is a semi-peameable membrane that surrounds the cell.Ribosomes: They are structures that are specialized for protein synthesis.Deoxyribonucleic acid (DNA): This is a hereditary material.Cell wall: This contains cellulose that helps protect the cell.Learn more here:
https://brainly.com/question/1963834
Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.
Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.
Methionine can be abbreviated as Met.
The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.
We can use the codon chart to determine the amino acid sequence.
The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.
Each codon codes for a different amino acid.
For example, the codon AUG codes for the amino acid methionine.
To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).
Then we write down the amino acid sequence for the codons we read, using the codon chart.
Here, the sequence starts with AUG, which codes for methionine.
After that, the next codon is UAA which is a stop codon, so we can stop.
The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).
For more such questions on Methionine
https://brainly.com/question/29481268
#SPJ8
Denise, who is Type A, negative, has a father who is Type O positive. She has children with David, who is Type AB positive, and whose mother is Type B negative. Give the genotypes of Denise and David, and give the phenotype ratio of the children they could produce.
Answer: Denise AO -
David AB +
children 2 (A): 1 (B): 1 (AB) all positive
Explanation:
Look at the pedigree below, does anyone in the 4th generation have cystic fibrosis?
A No
B Yes, just Child 2
C Yes, Child 1 & 2
D Yes, Child 3
E Yes, just Child 1
Answer:
C
Explanation:
Child 1 and 2 are both filled in and Child 3 is a carrier, as indicated by the key to the right of the pedigree.