If a number is positive, then it is a whole number and an integer.9.Which is the conclusion of the conditional? A number is an integer.A number is either a whole number or an integer.A number is a both a whole number and an integer.A number is positive.10.Which is the hypothesis of the conditional? A number is an integer.A number is both a whole number and an integer.A number is either a whole number or an integer.A number is positive

Answers

Answer 1

Answer:

Two lines intersect at right angles. Conclusion: The two lines are

perpendicular.

Step-by-step explanation:


Related Questions

What i 464 divided by 60 with a remainder?
(trying to figure out how many hour i 464 minute)

Answers

When we divide the 464 by 60 we get the following remainder in our answer that is 44.

What do math remainders mean?

The Remainder is the name for the value that is left behind after division. If an amount (reward) cannot be divided completely with another number, we are left with only a meaning (divisor). The remaining is the name for this amount. For instance, 10 is not precisely divisible by 3. We can calculate 3 x 3 = 9 because that is the closest value.

Briefing :

7.733333333333333

=7 44/60 ⇔ 7 R 44

464 divided by 60

=7 with a remainder of 44

Here, we provide you the outcome of the dividing with remainder, often known as the Euclidean division, along with a brief explanation of the following terms:

464 divide by 60 yields a quotient and residual of 7 R 44.

464 is the dividend & 60 is the divisor; the division (numeric division) of 464/60 is 7; the remainder ("left over") is 44.

To know more about Remainder visit :

https://brainly.com/question/23148931

#SPJ4

Which of these values cannot represent the probability of an event happening?0.3356%7/81.2

Answers

Explanation

One of the rules of probability states that the probability of any event A satisfies 0 ≤ P(A) ≤ 1. In other words, the probability of any event is greater than or equal to zero and less than or equal to zero.

Considering that, the value that cannot represent the probability of an event happening is 1.2.

\(\begin{gathered} 0\leq0.33\leq1\Rightarrow\text{ True} \\ 56\%=\frac{56}{100}=0.56\Rightarrow0\leq0.56\leq1\operatorname{\Rightarrow}\text{True} \\ \frac{7}{8}=0.875\Rightarrow0\leq0.875\leq1\Rightarrow\text{ True} \\ 0\leq1.2\leq1\Rightarrow\text{ False} \end{gathered}\)Answer

1.2

Linda can sell 12 magazine subscriptions per week and makes $\$ 4.00$ for each magazine subscription she sells. Obviously this means that Linda will make (12) $(\$ 4.00)=$ $\$ 48.00$ per week from magazine subscriptions. Explain this result mathematically, using mathematical notation and the chain rule.

Answers

The case mentioned above is resolved via multiplication.

Given information,

Linda can sell 12 magazine subscriptions per week and makes 4$ for each magazine subscription she sells. This means that Linda will make 48$ per week from magazine subscriptions.

To show it mathematically,

1 week ⇒ 12 magazines

Each of them costs $4;

⇒ 12 * 4$ = 48$ per week

By using multiplication we solve the above-given case.

To learn more about multiplication click here:

brainly.com/question/5992872

#SPJ4

Foster is centering a photo that is 1 1/2 inches wide on a scrapbook page that is 14 inches wide. How far from each side of the page should he put the picture? Enter your answer as a mixed number.

Answers

Answer:

The answer would be 4 1/4 (4.25)

10-1.5=8.5/2=4.25

Hope this helps!

Can u please mark me as brainliest? I really need it!

Step-by-step explanation:

Find the slope of the line shown below.
1)

Find the slope of the line shown below.1)

Answers

Answer:

-3/2

Step-by-step explanation:

from first point go down 6 units, and 4 units right. simplify -6/4 to -3/2

Answer:

-3/2

step by step explalation

TRUE/FALSE. If the value of the Pearson correlation is r = +1.00 or -1.00, then all data points in a scatter plot fit perfection on a straight line.

Answers

False.

While a Pearson correlation coefficient of +1.00 or -1.00 indicates a strong linear relationship between two variables, it does not necessarily mean that all data points will fit perfectly on a straight line. The correlation coefficient measures the strength and direction of the linear relationship, but it does not guarantee that the data points will fall exactly on a straight line.

Scatter plots with a perfect linear relationship will have all data points lying precisely on a straight line, but this is not always the case even when the correlation coefficient is +1.00 or -1.00. There can still be some degree of scatter or variation around the line, depending on other factors such as measurement errors, outliers, or the presence of other nonlinear relationships in the data.

learn more about coefficient here

https://brainly.com/question/1594145

#SPJ11

PLEASE HELP
Practice
Sketch a graph that does the following in the given order.
1. Decreases linearly
2. Constant
3. Increases non-linearly
4. Constant
5. Decreases non-linearly
6. Increases linearly

PLEASE HELP PracticeSketch a graph that does the following in the given order.1. Decreases linearly2.

Answers

A linear relationship (or linear association) is a statistical term used to describe a straight-line relationship between two variables

What is constant?

 something invariable or unchanging: such as. : a number that has a fixed value in a given situation or universally or that is characteristic of some substance or instrument. : a number that is assumed not to change value in a given mathematical discussion. : a term in logic with a fixed designation. A constant is a value or number that never changes in expression; it's constantly the same. For example, in the figure given above 36 and 82 are constant because its face value is 36 and 82 respectively. Its value never changesConsonants are any letters of the alphabet except "aeiou" . We shall assign the following values: a = 1, b = 2, c = 3, .... z = 26 . For example, for the word "zodiacs", let's cross out the vowels.

 To learn more about constant refers to:

   

https://brainly.com/question/23282770

 #SPJ1

Robyn's class has 22 students. Nine of the students in the class are girls. What is the ratio of boys to girls in Robyn's class?
09:13
9:22
13:9
0 13:22

Answers

Answer:

13:9

Step by Step Explanation:

That is the answer

13:9 will be your answer

use the discrminant to determine all values of k which would result in the equation -3x^2-6x+k=0 having real,unequal roots.​ must be right ty helppp asap

Answers

Answer:

\(k>-3\)

Step-by-step explanation:

We have the equation:

\(-3x^2-6x+k=0\)

Where a = -3, b = -6, and c = k.

And we want to determine values of k such that the equation will have real, unequal roots.

In order for a quadratic equation to have real, unequal roots, the discriminant must be a real number greater than 0. Therefore:

\(b^2-4ac>0\)

Substitute:

\((-6)^2-4(-3)(k)>0\)

Simplify:

\(36+12k>0\)

Solve for k:

\(12k > -36\)

\(k>-3\)

So, for all k greater than -3, our quadratic equation will have two real, unequal roots.

Notes:

If k is equal to -3, then we have two equal roots.

And if k is less than -3, then we have two complex roots.

please help!!!!!!!!!!!!!!!!!!!!

please help!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

d

Step-by-step explanation: it is that answer because (r+s)t=rt+st is you r answer i did it and i got it correct please mark me as brainlist

No Cap I can't see the picture at all ! i'm so sorryI'll edit this if you tell me what this says!God Bless!Stay In school!

Find the sum of the first 20 terms of the arithmetic sequence.
4, 10, 16, 22, ....

Answers

The sum of the first 20 terms of the arithmetic sequence is 1220

The sum of the first 20 terms can be calculated as follows ?

The number of terms (n) = 20

The first term (a) = 4

The common difference (d)= 10-4= 6

The formula for calculating the number of terms in an arithmetic sequence is

(a + L)*n/2

The first step is to calculate the value of L

L = a + (n - 1)*d

L= 4 + (20 - 1)6

L= 4 + 19(6)

L= 4 + 114

L= 118

The sum of the first 20 terms is

(a + L)*n/2

(4 + 118) × 20/2

= 122 × 10

= 1220

Hence the sum of the first 20 terms of the arithmetic sequence is 1220

Read more on arithmetic sequence here

https://brainly.com/question/11597540

#SPJ1

Please help quickly! x=___ units

Answers

The x = 16 units.

What is a triangle?

A triangle is a polygon that contains three sides. There are different types of triangles on the basis of sides.

Given, ∆ ABC is a 45-45-90 triangle

∆ BCD is a 30-60-90 triangle.

If side opposite of 90° [∆] = x, side opposite of 45° [∆] = x / √2 = x √ 2 / 2.

Given side AC is opposite of 90° [∆ ABC] = 32 √ 2, the side opposite of 45° [∆ ABC] = 32 √ 2 / √ 2 = 32 which is AB or BC.

Since side BC is part of BCD.

The side opposite of 90° [∆BCD] = BC = 32.

Since x is the opposite of 30° [∆BCD].

X = Side opposite of 90° [∆ BCD] / 2 = 32 / 2 = 16.

Therefore, x = 16 units.

To learn more about triangles, visit here:

https://brainly.com/question/14087679

#SPJ1

The question is incomplete. The missing image is added below:

Please help quickly! x=___ units

What is the equation of the line?

What is the equation of the line?

Answers

Answer:

y=2x=2

Step-by-step explanation:

bc the line is to the right and going up so it makes it positive and it crosses 2 on the y axis and it goes up 2 times each time

what does a rhombus look like

Answers

A rhombus with opposite sides are parallel and equal, and opposite angles are equal looks like Diamond.

A closed two-dimensional plane figure is a rhombus. It is regarded as a peculiar parallelogram, and due to its distinctive characteristics, it acquires a distinct identity as a quadrilateral. Due to its equal length sides, a rhombus is also known as an equilateral quadrilateral. The name "rhombus" is derived from the Greek word "rhombos," which really refers to a spinning object.

Due to the fact that it is a quadrilateral with two pairs of parallel sides, a rhombus can be considered a particular parallelogram. A rhombus also has equal sides on all four sides, exactly like a square. Because of this, it is often referred to as a tilted square. To comprehend the relationship between the rhombus shape, parallelogram, and square, look at the graphic below.

Learn more about Rhombus:

https://brainly.com/question/29629002

#SPJ4

what does a rhombus look like

How to do multiplication with decimals.

Answers

Answer: just line up the decimals.

Step-by-step explanation:

is there a specific question I can help you with?

HELP!!!IT IS MY WORST ENEMY.....MATH!!!!!!!!I WILL GIVE THE CROWN TO THE FIRST PERSON

WHO ANSWERS MY NEXT 2-3 EASY QUESTIONS!!!!

HELP!!!IT IS MY WORST ENEMY.....MATH!!!!!!!!I WILL GIVE THE CROWN TO THE FIRST PERSON WHO ANSWERS MY
HELP!!!IT IS MY WORST ENEMY.....MATH!!!!!!!!I WILL GIVE THE CROWN TO THE FIRST PERSON WHO ANSWERS MY
HELP!!!IT IS MY WORST ENEMY.....MATH!!!!!!!!I WILL GIVE THE CROWN TO THE FIRST PERSON WHO ANSWERS MY
HELP!!!IT IS MY WORST ENEMY.....MATH!!!!!!!!I WILL GIVE THE CROWN TO THE FIRST PERSON WHO ANSWERS MY

Answers

Answer:

Step-by-step explanation:

HELP!!!IT IS MY WORST ENEMY.....MATH!!!!!!!!I WILL GIVE THE CROWN TO THE FIRST PERSON WHO ANSWERS MY

Answer:

i kill math for u

Step-by-step explanation:

Earth has a radius of 3959 miles. A pilot is flying at a steady altitude of 1.8 miles above the earth's surface.

What is the pilot's distance to the horizon
Enter your answer, rounded to the nearest tenth

Answers

1.8 miles + 3959 miles = 3960.8

That’s 3961miles as the final answer

It is possible for more than 50% of the scores in a distribution to have values above the mean. Group of answer choices True False

Answers

Answer:

True

Step-by-step explanation:

Yes, it is possible if the data is skewed negatively and the median is greater than the mean.

In the figure below, O is the center of the circle. Name a radius of the circle. A. HK←→ B. FG←→ C. AB¯¯¯¯¯¯¯¯ D. AO¯¯¯¯¯¯¯¯

In the figure below, O is the center of the circle. Name a radius of the circle. A. HK B. FG C. AB D.

Answers

Answer:

D. AO

Step-by-step explanation:

The radius can be made with a line from a point in the circumference (end) to the middle.

Point A is on the circumference. Point O is in the middle. So, line segment AO is the radius.

The radius of a circle is a line drawn from the center of the circle to any point on the circumference of the circle.

The radius of the circle are AO, CO and BO.

From the attached diagram of the circle, we have:

\(O \to\) center

There are three lines from center O to the circumference of the circle. The three points are: A, C and B.

This means that the radius of the circle are AO, CO and BO.

Read more about radius at:

https://brainly.com/question/11137975

if z is a standard normal random variable, what is the probability that z is between -2.4 and 0.4?

Answers

The probability that a standard normal random variable z is between -2.4 and 0.4 is approximately 0.6472.

To find the probability that a standard normal random variable z is between -2.4 and 0.4, we can follow these steps:

Step 1: Look up the cumulative probability corresponding to -2.4 in the standard normal distribution table. The cumulative probability at -2.4 is approximately 0.0082.

Step 2: Look up the cumulative probability corresponding to 0.4 in the standard normal distribution table. The cumulative probability at 0.4 is approximately 0.6554.

Step 3: Subtract the cumulative probability at -2.4 from the cumulative probability at 0.4 to find the probability between the two values:

P(-2.4 < z < 0.4) = 0.6554 - 0.0082

= 0.6472.

Therefore, The probability that z is between -2.4 and 0.4, when z is a standard normal random variable, is approximately 0.6472. This means that there is a 64.72% chance that a randomly selected value from a standard normal distribution falls within the range of -2.4 to 0.4.

To know more about probability, visit:

https://brainly.com/question/32782543

#SPJ11

a manufacturing machine has a 5% defect rate. if 8 items are chosen at random, what is the probability that at least one will have a defect?

Answers

The probability of randomly choosing atleast one defective item would be 0.33657

Given the Parameters :

Defect rate = P(defect) = 0.05

Probability = required outcome / Total possible outcomes

P(atleast 1 is defective) = 1 - P(none is defective)

P(not defective) = 1 - P(defective) = 1 - 0.05 = 0.95

P(none is defective) = P(non defective)^5

P(none defective) = 0.95 × 0.95 × 0.95 × 0.95 × 0.95 × 0.95 × 0.95 × 0.95= 0.6634

P(atleast one is defective) = 1 - 0.6634 = 0.33657

Therefore, probability of atleast one defective item is 0.33657

learn more about of probability here

https://brainly.com/question/11443428

#SPJ4

i need help fast pls be correct

i need help fast pls be correct
i need help fast pls be correct
i need help fast pls be correct
i need help fast pls be correct
i need help fast pls be correct

Answers

1) The rule of transformation is described as; A: A rotation 90° clockwise about the origin

2) The value of x is; 2

3) The value of x is 10

4) The slope of the line is; 2

How to Interpret rule of transformation?

1) The rule of transformation for When the point M (h, k) is rotated through 90° clockwise about the origin, the point M (h, k) takes the image M' (k, -h). Thus, that is the rule here.

2) From the given image, we can tell that the angles 50° and 26x - 2 are corresponding angles. Thus, they are congruent and we have;

26x - 2 = 50

26x = 52

x = 2

3) From the given image, we can see that the given angles are supplementary and as such they add up to 180 degrees. Thus;

9x + 15 + 6x + 15 = 180

15x + 30 = 180

15x = 150

x = 10

4) Slope is;

m = (y2 - y1)/(x2 - x1)

m = (1 - (-3))/(1 - (-1))

m = 4/2

m = 2

5) Same question as the first one.

Read more about Rule of Transformation at; https://brainly.com/question/4289712

#SPJ1

If f(x)=8^x and g(x) =9 , what is (f divided g ) (x)
A.8^x-9
B.8^x/9
C.(8/9)^x
D.9(8^x)

Answers

Answer:

f(x) / g(x) = 8^x / 9 --> B

Step-by-step explanation:

You just need to plug in the values

Answer:

B. 8^2/-9

Step-by-step explanation:

I think the first guy is right

What is 3,920,000,000,000 in scientific notation?

Answers

Answer:

The 3,920,000,000,000 in scientific notation is 3.92 x 10^12.

Step-by-step explanation:

Answer:

3.92 x 10^12

Step-by-step explanation:

The 3,920,000,000,000 in scientific notation is 3.92 x 10^12

Hi can someone please help me with question 4.
4. With the aid of examples, explain how the traditional system attempts to solve the three central economic questions.

Answers

The traditional economic system attempts to solve the three central economic questions through customs, traditions, and long-standing practices. These questions include what to produce, how to produce it, and for whom to produce. The system relies on the allocation of resources based on cultural norms, historical practices, and inherited roles within the society.

In a traditional economic system, the answers to the three central economic questions are derived from customs and traditions that have been followed for generations. Let's take a look at each question and how the traditional system addresses them:
What to produce:
In a traditional system, the choice of what to produce is guided by the needs and preferences of the community. Economic activities are often centered around meeting the basic necessities of life, such as food, clothing, and shelter. For example, a community engaged in agriculture may primarily produce crops and livestock to sustain themselves.
How to produce:
The traditional system relies on established methods and techniques that have been passed down through generations. Production methods are often based on the knowledge and skills of the community. For instance, traditional crafts and artisanal skills are practiced using traditional tools and techniques.
For whom to produce:
In a traditional system, the distribution of goods and services is typically based on social roles, kinship ties, and communal practices. Resources are shared within the community based on customs and traditions that prioritize the well-being and needs of the collective. For example, in some traditional societies, elders or leaders may receive preferential access to resources.
Overall, the traditional economic system seeks to address the three central economic questions by relying on cultural values, customs, and traditions that shape resource allocation, production methods, and distribution within the community.

Learn more about traditional economic system here
https://brainly.com/question/27630988

 #SPJ11

I need some help on this question please

I need some help on this question please

Answers

Answer:

m1 = 4, m2 = 176

Step-by-step explanation:

Using complementary angle rule you know the total angle is 180 thus:

\(180 - (x-18) = 8x\\198 - x = 8x\\198 = 9x\\x = 22\)

m1 = (22 - 18) = 4

m2 = 8(22) = 176

help. geometry question

help. geometry question

Answers

Statement 1, BD ≅ SD and ED ≅ TD would not be sufficient to prove quadrilateral BEST is a parallelogram.

How to determine that a quadrilateral is a parallelogram?

A quadrilateral is a parallelogram if it satisfies any of the following conditions: Opposite sides are parallel and congruent, Opposite angles are congruent, Diagonals bisect each other. If a quadrilateral satisfies any of these conditions, it is a parallelogram.

Although BD ≅ SD and ED ≅ TD indicate that the diagonals bisect each other, it does not necessarily mean that the opposite sides are parallel. For example, a kite has diagonals that bisect each other but its opposite sides are not parallel.

Learn more on parallelograms here: https://brainly.com/question/12097947

#SPJ1

Factor the expression completely. -12x - 24

Answers

Answer:

- 12(x + 2)

Step-by-step explanation:

- 12x - 24 ← factor out the common factor of - 12 from each term

= - 12(x + 2)

your sample consists of 147 subjects, with 54 successes. calculate the test statistic, rounded to 2 decimal places

Answers

The value of test statistic for the given sample of 147 subjects along with 54 successes is equal to - 0. 25.

As given in the question,

Sample size 'n' of 147 subjects

Successes of 54 subjects

\(\bar{p}\) = 54/147

  = 0.3673

  = 0.37

p = 0.38

1 - p = 1 - 0.38

       = 0.62

Test statistic = ( \(\bar{p}\) - p ) / √p(1 - p)/ n

                   = ( 0.37 - 0.38 ) / √0.38 ( 0.62)/ 147

                   = - 0.01 / √ 0.0016

                   = - 0.01 / 0.04

                   = -.0.25

Therefore , the value of test statistic for the given sample and successes is equal to - 0.25.    

The above question is incomplete , the complete question is:

Testing :

H₀ : p = 0.38

H₁ : p≠ 0.38

Your sample consists of 147 subjects, with 54 successes. calculate the test statistic, rounded to 2 decimal places.

Learn more about test statistic here

brainly.com/question/14128303

#SPJ4

at what rate is the angle θ, between the ladder and the ground changing then?

Answers

To determine the rate at which the angle θ, between the ladder and the ground is changing, we need to establish a relationship between the angle θ and the given variables.

Let's assume the ladder is leaning against a wall, forming a right triangle with the ground. The ladder acts as the hypotenuse, and the angle θ is the angle opposite to the height of the wall.

Given that the length of the ladder is decreasing at a constant rate of 2 ft/s, we can express this as dh/dt = -2 ft/s, where h represents the height of the wall.

Using trigonometry, we know that sin θ = h/l, where l represents the length of the ladder. Taking the derivative of this equation with respect to time t, we get:

d/dt(sin θ) = d/dt(h/l)

Differentiating both sides using the chain rule, we have:

cos θ * dθ/dt = (dl/dt * h - dh/dt * l) / l²

Since dl/dt is given as -2 ft/s and dh/dt is given as -2 ft/s, we can substitute these values into the equation:

cos θ * dθ/dt = (-2 * h - (-2) * l) / l²

Simplifying further:

cos θ * dθ/dt = (-2h + 2l) / l²

Now, to find the rate at which the angle θ is changing (dθ/dt), we need to know the values of h and l at a specific point in time. Without additional information or specific values for h and l, we cannot determine the exact rate at which θ is changing.

In summary, the rate at which the angle θ is changing (dθ/dt) depends on the specific values of h and l at a given time.

Learn more about variables. from

https://brainly.com/question/28248724

#SPJ11

Other Questions
1. Greek scientist called Archimedes was asked to check the purity of the gold in a crown. He did this by comparing the density of the crown with the density of pure gold.a) Describe how he could have measured the density of an irregular shaped object as a crown. Which is the graph of x2 y2 = 16? Please please help me with this!!Look at the picture for the question Fill in the equation so that the equation has one solution. Answers:255-2xNone of the above. Which text evidence best supports the authors' claim about plantations?"The Muslims worked out a new form of farming to handle sugar, which came to be called the sugar plantation.""By contrast, the plantation had only one purpose: to create a single product that could be grown, ground, boiled, dried, and sold to distant markets.""Since one cannot live on sugar, the crop grown on plantations could not even feed the people who harvested it.""The mill was right next to the crop, so that growing and grinding took place in the same spot." What is the value of k when e = 0 v ? express your answer to one significant figure Could someone please check if this is a strong introduction paragraph? And please tell me what I can change to make it stronger.My work:Have you read a poem or piece of writing, and you can feel the emotions in the words? Writers like William Wordsworth and John Muir use figurative language to appeal to your emotions. Take these as examples "Continuous as the stars that shine" and "It seemed the most spiritual of all the flower people." This is how John Muir and William Wordsworth express their relationship with nature using figurative language. identifies the main point or the overall idea of a paragraph and is often placed at the beginning of the paragraph. Write the equation of the line passing through the points (28,4) and (-4,-4) Question 3 (30 marks) a. The income statement and a partial balance sheet for Mango Company are presented below. Mango Company Income statement For the year Ended December 31, 2020 Sales $260,000 105,600 Cost of goods sold Gross Profit $154,400 Operating expenses: Salaries $24,000 16,000 Depreciation expense Miscellaneous Net Income 10,600 50,600 $103,800 2016 Cash 224,000$ 8,800 Account receivable Inventories 16,800 10,800 Prepaid expenses Accounts Payable 8,800 Salaries Payable 5,320 Required: Prepare the operating activities section of the statement of cash flows using indirect method. (15 Marks) QUECIP Mango Company Financial experts recommend a monthly savings ratio of at least ____ of gross income.A. 0%B. 5-10%C. 20%D. 25-35%E. 50% Explain what TWO forces cause Earths water to bulge? pls help Which angle is supplementary toFAE? An example of irony in night chapter 5 so I did a food chain can you please tell me if I did it right or not?: the first federal constitution that texas operated under was the mexican constitution. group of answer choices can you please compare the DNA sequences in thisimage, mark any insertion, deletion, polymorphism, and addition.Discuss about the yellow region in sequences and the nucleotides.discuss all the simi>M12-LCMT-F_D02.ab1TAAAGCCATTTACCGTACATAGCAC >M13-LCMT-F E02.ab1TAAAGCCATTTACCGTACATAGCAC >M14-LCMT-F_F02.ab1TAAAGCCATTTACCGTACATAGCAC325 >M15-LCMT-F_G02.ab1TAAAGCCATTTACCGTACATAGCAC >M16-LCMT-F_H02.ab1TAAAGCCATTTACCGTACATAGCAC>M12-LCMT-F_D02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M13-LCMT-F_E02.ab1ATTACAGTCAAATCCCTTCTCGTCC >M14-LCMT-F F02.ab1ATTACAGTCAAATCCCTTCTCGTCC350>M15-LCMT-F G02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M16-LCMT-F_H02.ab1ATTACAGTCAAATCCCTTCTCGTCC w >M12-LCMT-F_D02.ab1CCATGGATGACCCCCCTCAGATAGG>M13-LCMT-F_E02.ab1CCATGGATGACCCCCCTCAGATAGG >M14-LCMT-F_F02.ab1CCATGGATGACCCCCCTCAGATAGG375 >M15-LCMT-F_G02.ab1CCATGGATGACCCCCCTCAGATAGG>M16-LCMT-F_H02.ab1CCATGGATGACCCCCCTCAGATAGG>M12-LCMT-F_D02.ab1GGTCCCTTGACCAC>M13-LCMT-F_E02.ab1GGTCCCTTGACCAC >M14-LCMT-F_F02.ab1AGTCCCTTGACCAC >M15-LCMT-F_G02.ab1GGTCCCTTGACCAC>M16-LCMT-F H02.ab1GGTCCCTTGACCAC 400 25) what is the probability that a 100 year flood will occur along the mississippi river this year? what should you do if while loading your firearm you notice that there is no headstamp What might the Soviet Unions response to the Marshall Plan meeting have indicated about the potential for tension with the United States? Quality at the source is often discussed in the context of ______________ quality.