If an animal cell gains water?
It is caused by the solute concentration in the cell being higher than its environment

It will eventually cause cell lysis (bursting) as the cell swells up

You could make it shrink again by adding solute to the surrounding environment

All of the choices are correct

None of these choices are correct

Answers

Answer 1

If an animal cell gains water is It is caused by the solute concentration in the cell being higher than its environment which is   option D which is all are correct.

Solute concentration explained.

Solute concentration refers to the amount of solute dissolved in a solvent to form a solution. It is typically expressed as the amount of solute per unit of solvent or solution, such as moles per liter (mol/L), grams per liter (g/L), or percentage by mass (% w/w or % w/v). The concentration of a solute in a solution can greatly affect its properties and behavior, such as its reactivity, boiling and freezing points, and osmotic pressure.

When an animal cell gains water, it is because the solute concentration in the cell is higher than its environment, causing water to move into the cell through the process of osmosis. As the cell swells up, it may eventually reach a point where it bursts or undergoes lysis.

Adding solute to the surrounding environment can help to reverse the process by drawing water out of the cell and causing it to shrink again. Therefore, the statement "You could make it shrink again by adding solute to the surrounding environment" is also correct.

Therefore, the correct choice is: "All of the choices are correct."

Learn more about solute concentration below.

https://brainly.com/question/17206790

#SPJ1


Related Questions

Does the Persian cat population increase or decrease?​

Answers

Answer:

Thus, the management of cat populations is increasing in the public interest. Understanding their genetic relationships helps to manage their healthcare and predict and prevent unwanted genetic diseases and traits.

Question 12 of 30 Which of the following best describes the goal of technology? A. To apply scientific knowledge to ethical decision making B. To use scientific knowledge to solve problems or to make tasks easier C. To make more industrial jobs D. To improve the economy​

Answers

B) To use scientific knowledge to solve problems or to make tasks easier

Your right to safety means consumers have the right to a variety of competitive products in the marketplace.

Answers

Answer:

Yes i believe this is true

Explanation:

An investigator has a strand of chromosomal DNA whose sequence is shown. She wants to use polymerase chain reaction (PCR) to amplify and isolate the DNA fragment defined by the highlighted segment. Her first step is to design two PCR primers, each 20 nucleotides long, that can be used to amplify this DNA segment. The final PCR product generated from the primers should include no sequences outside of the highlighted segment. 5' --- AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG TTAGATTGATTGTTAGGTTCTTAGGTTTAGGTTCTGGTATT GGTTTAGGGTCTTTGATGCTATTAATTCTTTGGTTTTGATTT GGTCTTTATATGGTTTATGTTTTAAGCCGGGTTTTGTCTGG- GATGGTTCGTCTGATGTGCGCGTAGCGTGCGGCG ---3' What are the sequences of the investigator's forward and reverse primer? Enter them 5' to 3'. forward primer: reverse primer:

Answers

The forward primer would be: 5'-ATGCTGGTAACTTGGGGTAT-3' . The reverse primer would be: 5'-CCAGACAAAACCGGCTTAAA-3'

The method that uses a chain of reactions is called a polymerase chain reaction. In vitro procedures that polymerise or create more precise copies of the DNA from a tiny sample are carried out.

The DNA replication process, which includes DNA primers and a specific DNA polymerase enzyme called Taq polymerase, provides the basis for the PCR technique reverse primer.

Denaturation, annealing, and extension are the three steps of the PCR process. During denaturation, the DNA is broken down to release its hydrogen bonds, primers are added at both ends (called reverse and forward primers), DNA is synthesised, and the sample is cooled before extension.

Learn more about polymerase chain  here

https://brainly.com/question/14227755

#SPJ11

If you are going to allow a population of mice to randomly mate for 5 generations and you want to limit inbreeding to a maximum of 14.678481% after generation 5 (assuming you started with zero inbreeding), how many males do you need if you have 20 females?

a) 5

b) 10

c) 50

d) 2

e) 8

Answers

The answer is (b) 10. To limit inbreeding to a maximum of 14.678481% after 5 generations, we need to calculate the expected amount of inbreeding in each generation and then adjust the number of males to add to the population accordingly.

The expected amount of inbreeding in each generation can be calculated using the formula:

Expected inbreeding = (1 - (1/2)^(generation/2)) * (1 - (1/2)^(generation/2)^2) * ... * (1 - (1/2)^(generation/2)^(14))

Substituting the value of generation=5 gives:

Expected inbreeding = (1 - (1/2)^5) * (1 - (1/2)^5)^2 * ... * (1 - (1/2)^5)^(14)

= 0.81924005762932

The maximum amount of inbreeding allowed is 14.678481%. Substituting this value gives:

Maximum inbreeding = 14.678481 / 0.81924005762932

= 17.5937535396166

Therefore, to limit inbreeding to a maximum of 14.678481% after 5 generations, we need to add at least 17.5937535396166 males to the population.

Solving for the number of males needed if we have 20 females, we get:

17.5937535396166 = (20 * 1 - 14.678481) / 20

= 3.45344278981875

Rounding to the nearest whole number, we get:

The number of males needed is 3.

Therefore, the answer is (b) 10.

Learn more about generations Visit : brainly.com/question/5013260
#SPJ11

HELP NEEDED ASAP!!

Which of the following factors is necessary for germination of seeds?
a. Moisture, air, suitable temperature
b. Moisture, sunlight, suitable temperature
c. Air, fertilizer, sunlight
d. Moisture, fertilizer, suitable temperature​

Answers

Answer: b

Explanation: I'm pretty sure its correct because if a seed doesn't have moisture it wont be able to fertile.  

Answer:

Option B

Explanation:

I hope it is the right one

1. White blood cells attack what??
2. Ability of an organism to feed is called
a nutrition 6 irritability cd growth ad movement
3. The following are types of living things
except
Polista
d) lysosomea
4. Another name for Aues is called a hea
6) birds cd mamals d)
frog
animals are herbivores except
goats giraffes Selephants
d leopardo
5. The following
6. The locomotany organ of earthwor mis a) fors
Dwings as muscles D tube feet.
Sol
7. Spider use for respiration ad lungs b) booklungs
c) gills d) lenticels
The top of the tongue is responsible for a
bitterness c) Saltiness d) sourness.
these is not
organ
b) cose c) Tongue ad liver
9. One of
sense o
a) Eye​

Answers

Answer:

white blood cell's fight infections from bacteria, viruses, fungi, and other pathogens

Explanation:

If adequate nutrients are present, primary productivity depends on _____.

a. organism size
b. salinity
c. temperature
d. illumination
e. organism density

Answers

C. temperature

Have a great day!

What effect does the percentage of red blood cells have on the viscosity of blood?

Answers

The effect of the percentage of red blood cells on the viscosity of blood is that an increase in red blood cell concentration leads to an increase in blood viscosity.

Blood viscosity refers to the thickness and stickiness of blood, and it plays a significant role in circulation and overall cardiovascular health. The primary factor affecting blood viscosity is hematocrit, which is the percentage of red blood cells (RBCs) in the blood. When the hematocrit increases, the concentration of RBCs in the blood also increases, leading to a higher viscosity. This occurs because the RBCs can create more friction as they flow through the blood vessels, making it more difficult for blood to flow. Higher blood viscosity can lead to various health issues, such as an increased risk of blood clots, heart attacks, and strokes. On the other hand, a lower hematocrit level and a lower RBC concentration can result in reduced blood viscosity, which can improve circulation but may also indicate anemia or other health issues.

To know more about the cells visit:

https://brainly.com/question/31622457

#SPJ11

Select all the algebraic expressions equivalent to a3b3

Answers

Cube both a and b then times 3 then that number times 3 again

what elements are present in DNA

Answers

Explanation:

DNA WHICH STANDS FOR DEOXYRIBONUCLEIC ACID ,RESEMBLES ALONG,SPIRALING LADDER . IT CONSISTS OF JUST A FEW KINDS OF ATOMS :CARBON,HYDROGEN ,OXYGEN ,NITROGEN ,AND PHOSPHORUS.

COMBINATIONS OF THESE ATOMS FORM THE SUGAR --- PHOSPHATE BACKBONE OF THE DNA--THE SIDES OF THE LADDER ,IN OTHER WORDS.

Specialized skin cells that can trigger an immune response are called:
keratinocytes.
melanocytes.
immunocytes.
Langerhans.

Answers

Answer:

D. Langerhans

Explanation:

edge 2020

Answer:

D) Langerhans

Explanation:

100% edge 2022

A person has one of their lower arms removed in a procedure known as an amputation. After this, what will be the total number of bones in their appendicular skeleton?

Answers

A person has one of their lower arms removed in a procedure known as an amputation therefore the total number of bones in their appendicular skeleton will be 125.

What is a Skeleton?

This is referred to as the structural frame that supports the body of an animal and it consists of bones which are living tissues and help provide structural integrity. They are also involved in the movement of various parts of the body for our daily activities.

The adult human skeleton is made up of 206 bones while the  total number of bones in their appendicular skeleton is 126 and we were told that amputation occurred which led to the loss of one of the lower arms.

This therefore means that the total number of bones in their appendicular skeleton will be 126 - 1 = 125 which is therefore the reason why it was chosen as the correct choice.

Read more about Skeleton here https://brainly.com/question/9332468

#SPJ1

Make a list of all the changes that will take place in the athlete's body after the race has been completed​

Answers

You may have post race sleepiness, your lower legs and body will be sore, you burn loads of calories, muscle pain to the calves hamstrings, or quads.

Sara is learning about photosynthesis and cellular respiration in her science class. Which statement can Sara write that best explains the relationship between
these two processes?
O A. The chemical reactions of photosynthesis and cellular respiration could not take place without each other.
B. Photosynthesis and cellular respiration are chemical processes used in both animal and plant cells.
C. Plants use photosynthesis to produce food, while animals use cellular respiration to consume their food,
D. When cells do not have enough energy for respiration, they rely on photosynthesis.
oh

Answers

Answer:

The most suitable answer is C.

Explanation:

Photosynthesis is the process whereby plants manufacture their own food using water, carbon (iv) oxide and some other minerals in the presence of sunlight while cellular respiration is the oxidation (or breakdown) of substances in the mitochondria (site of cellular respiration) in living cells.

In angiosperms, the _________ is a nutrient-storing tissue that nourishes a developing embryo.
endosperm
A) fruit
B) seed
C) carpels
D) endosperm

Answers

The endosperm is a nutrient-storing tissue that nourishes a developing embryo in angiosperms.

In angiosperms, the endosperm is a nutrient-storing tissue that nourishes a developing embryo.

Angiosperms are flowering plants that reproduce by producing flowers, which are then pollinated by other organisms. The flowers produce fruits, which are used to store and transport seeds to other areas.

Angiosperms are divided into two groups:

monocots and dicots. Monocots have one cotyledon in their seeds, while dicots have two cotyledons.

The endosperm is a nutrient-storing tissue that nourishes a developing embryo in angiosperms. It is present in the seeds of many flowering plants and provides nourishment to the developing embryo.

Hence, option D is correct.

Learn more about endosperm with the given link,

https://brainly.com/question/13231377

#SPJ11

Which of the following monomers is correctly paired with the macromolecule it
forms?
ONucleotide Nucleic Acids
O Monosaccharide - Protein
O Fatty Acid-Carbohydrate
O Amino Acids - Lipids

Answers

Answer:

no. 2 is a right answer.

Explanation:

Monosaccharide- Protein.

Need help ASAP PLZ!


Which type of cell must be produced more frequently than the other types?

1)brain cells
2)red blood cells
3)muscle cells
4)liver cells
5)stomach lining cells

Answers

Answer:

3 because the muscle cells is produced

Red blood cells are produced more frequently than the other types, the body produces them every second, hence option 2 is correct.

Why do red blood cells produce more frequently?

Medication that promotes the formation of RBCs: Erythropoietin is a hormone that is made in the liver and kidneys and stimulates the production of RBCs in the bone marrow. Some types of anemia can be treated with erythropoietin.

In order to replace those red blood cells that eventually deteriorate and die, red blood cells are continuously created in the bone marrow. A red blood cell has a lifespan of roughly 120 days on average. Anemia and shortness of breath result from a large drop in the number of red blood cells.

Therefore, It just takes a few weeks to replenish red cell reserves because your body produces roughly 2 million new ones every second.

Learn more about RBCs, here:

https://brainly.com/question/17890844

#SPJ2

During thermohaline circulation, what two things are transported around the globe? Choose two.



energy in the form of heat


ships and other water vessels


severe weather systems


matter (nutrients, solids, dissolved substances, and gases)

Answers

Answer:energy in the form of heat and matter (nutrients, solids, dissolved substances, and gases)

Explanation:

An XX female will express a recessive sex-linked trait if she

options are in the screenshot and NOOO LINKSSS PLS

An XX female will express a recessive sex-linked trait if sheoptions are in the screenshot and NOOO LINKSSS

Answers

Answer:

what

Explanation:

Answer:

b

Explanation:

mark me brainliest pls :)

♡ Observations... ! I NOTICE... ? I wonder... Think = Reminds me of...

Answers

Answer:

???? whats this and where is the image

which of the following are widely distributed in the skin and are sensitive to touch or pressure? which of the following are widely distributed in the skin and are sensitive to touch or pressure? chemoreceptors mechanoreceptors nociceptors thermoreceptors

Answers

Answer:

Mechanoreceptors because the preceive pressure and sensations

The Venn diagram compares aerobic respiration and anaerobic respiration.

A Venn diagram is shown. One circle is labeled aerobic and the other circle is labeled anaerobic.

Which statement could be categorized only in the anaerobic section of the Venn diagram?
A. is performed by eukaryotes
B. has commercial uses
C. regenerates NADH
D. occurs in the mitochondria

Answers

Answer:

Commercial use

Explanation:

Anaerobic respiration has used commercial use. Anaerobic respiration doesn't need to use oxygen

Hope this helps! :)

Answer:

my answer would be has commercial uses

Explanation:

why I would think this is because is say Which statement could be categorized only in the anaerobic section of the Venn diagram I would think it would be commercial uses and plus i just did the test and it was right.

Which statement best describes enzymes? A) Every enzyme controls many different reactions. B) The rate of activity of an enzyme might change as pH changes. C) Temperature changes do not affect enzymes. D) Enzymes are produced from the building blocks of carbohydrates.

Answers

Answer:

the answer is B

Explanation:

Every enzyme can control one or more types of reaction whereby the rate of activity of an enzyme will be influenced by PH and temperature.

karen and her brother both have a straight hairline, but her parents and sister all have a widow’s peak. complete the punnett square that shows karen’s family

Answers

Answer:

(see explanation)

Explanation:

Let's say we have an H for "hairline." H is widow's peak, and h is straight hair

    H    h

H  HH   Hh

h   Hh   hh

There is a 25% chance that the offspring will have straight hair.

the parents both have Hh genes

A young man is experiencing fever and severe headaches, and is having difficulty staying awake. He reports having spent time in Africa on a missionary trip several months ago. Recently he spent time in a park where he went swimming in the lake and was bitten by a bat he attempted to catch. His cerebrospinal fluid is nearly clear, and contains long, slender, mobile cells. This description indicates infection with

Answers

The young man is experiencing fever and severe headaches, and is having difficulty staying awake. He reports having spent time in Africa on a missionary trip several months ago. Recently he spent time in a park where he went swimming in the lake and was bitten by a bat he attempted to catch. His cerebrospinal fluid is nearly clear, and contains long, slender, mobile cells.

The description indicates an infection of African trypanosomiasis. It is an infection caused by the parasite Trypanosoma brucei, and is transmitted through the bite of the tsetse fly. The disease has two stages: an early stage, which includes fever, severe headaches, and other symptoms, and a late stage, which includes neurological symptoms and can be fatal if not treated promptly. There is no vaccine for African trypanosomiasis.

The main method of prevention is to avoid being bitten by the tsetse fly. If someone is infected, they should receive treatment as soon as possible to prevent the disease from progressing to the late stage. Treatment usually involves medication to kill the parasites, but it can be difficult to treat, especially if the disease has progressed to the late stage.

In addition to the symptoms of African trypanosomiasis, the young man in this scenario also has a history of being bitten by a bat, which could indicate a possible infection with rabies. Rabies is a viral infection that can be transmitted through the bite of an infected animal. The symptoms of rabies can include fever, headache, and other neurological symptoms, and the disease can be fatal if not treated promptly.

To know more about headaches visit:

https://brainly.com/question/801428

#SPJ11

23. perception refers to the process by which: a. the brain organizes and interprets sensation b. sensory receptors gather information from the environment c. sense organs transmit information to the brain for initial processing d. the brain minimizes response to stimuli that do not change

Answers

Perception can be referred to as the process by which the brain organizes and interprets sensation. This occurs through transformation of sensory information. Thus, the correct option is A.

What is Perception?

The process by which people organize and interpret the sensory input to give significance to their environment is known as perception. To understand how this perception functions, it is important to first comprehend sensation.

Sensation is the detection of physical stimuli, such as the sound waves or the light waves, by the sensory receptors which are located in the eyes, ears, nose, tongue, and skin organs. This sensory information is transformed into the neural signals that are carried to the brain, where they are interpreted into meaningful patterns.

Perception includes the integration of these signals into meaningful experiences, as well as the interpretation of the significance of stimuli in the context of an individual's personal history and expectations. Sensory receptors are specialized cells which respond to specific types of stimuli, such as light or sound waves.

Sense organs are the collections of these receptors which are grouped together to form the sensory systems, such as the visual or the auditory systems. When the sensory receptors detect these stimuli, they send signals to the brain for initial processing.

These signals are then transformed into meaningful patterns through the process of perception, which includes the integration of the signals into meaningful experiences, as well as the interpretation of the significance of stimuli in the context of an individual's personal history and expectations.

Therefore, the correct option is A.

Learn more about Perception here:

https://brainly.com/question/29776172

#SPJ11

All muscle found in the body can be dassified into three groups Most of the muscle in the body is
which is muscle that only moves bones.
muscle is another type of muscle
that can be found in internal organs, such as the stomach or arteries. The last type of muscle
is
muscle, which is found only in the

Answers

Answer:

easy

Explanation:

easy lol

Answer:

wowo

Explanation:

wowowowo

Choose the word which best completes the sentence.I wasn’t sure if we were to bring ____ to the party.a.presentsc.seamsb.presenced.none of the abovePlease select the best answer from the choices providedABCD

Answers

Answer:

A. Presents.

How much is DNA important to identify a group? Give a brief explanation on race ,whiteness and property? Does biological anthropologists and genome scientist need to add the relation between Europeans and Indigenous people while doing their research?

Answers

DNA is important in identifying genetic relationships within a group, but it alone is not sufficient to determine complex social constructs like race, whiteness, or property; the inclusion of social, cultural, and historical factors is crucial in understanding these concepts.

Biological anthropologists and genome scientists should consider the relationship between Europeans and Indigenous people in their research to provide a more comprehensive understanding of human genetic diversity and population history.

DNA analysis can provide valuable insights into genetic relationships within a group, such as determining genetic ancestry or identifying related individuals. However, race, whiteness, and property are social constructs that go beyond genetic factors and are shaped by historical, cultural, and socioeconomic factors. These concepts are complex and cannot be solely explained by genetic data. Therefore, it is important for researchers, including biological anthropologists and genome scientists, to recognize the limitations of genetic data and consider the broader social context when studying race, whiteness, and property.

In the context of researching Europeans and Indigenous people, it is crucial for researchers to acknowledge and incorporate the historical and ongoing relationships between these groups. This includes understanding colonization, displacement, and the impact of power dynamics on genetic diversity and health outcomes. By including this relationship in their research, scientists can contribute to a more accurate and nuanced understanding of human genetics and promote social and scientific equity.

To learn more about biological anthropologists, here

https://brainly.com/question/30590344

#SPJ4

Other Questions
A good time to observe the dress code to prepare for your first day is during _____.a.your interviewb.your second dayc.your Orientationd.the weekend What is a good analogy for explaining the actions of a compiler?a hybrid ability of a car to use multiple energy sourcesa street map of a local subdivisionan interpreter who speaks several languagesan automatic programming of kitchen devices a 31.5 g wafer of pure gold initially at 69.9 c is submerged into 63.3 g of water at 26.9 c in an insulated container. the specific heat capacity for gold is 0.128 j/(gc) and the specific heat capacity for water is 4.18 j/(gc). what is the final temperature of both substances at thermal equilibrium? Read the sentence in the present and select the same sentence written correctly in the past:Tous les samedis matin, ils choisissent le parc pour aller marcher. Tous les samedis matin, ils ont choisi le parc pour aller marcher. Tous les samedis matin, ils choisissaient le parc pour aller marcher. Tous les samedis matin, ils vont choisir le parc pour aller marcher. Tous les samedis matin, ils sont choisi le parc pour aller marcher. (4/-5) (-3/10) A) 12/50B) -18.6C) 8/3D) -12/50 when a star's inward gravity and outward pressure are balanced, the star is said to be Which of the following is an example of the author using words that have aviolent connotation? Solve: 5a + 15 = 45O a = 12O a = 6O a = -6O a = -12 There are 50 puzzles in Maggie's puzzle book. Maggie finished 30% of the puzzles. How many puzzles does she have left to do? SHOW YOUR WORK. the ymca, the _________________ army, and rescue missions were popular interdenominational religious organizations of the progressive era. what are strengths the united states had when going into the war of 1812? te gusta jugar?A. noB.no,no me gusta C.no gustaD. no, no me gusta What are the causes of different falls in the air?A, Highlight drop dropB, The Wind BlowsC, of objectD, Air resistance a company sells cereal in two different sized boxes . The smaller box has the dimensions shown below *ceral box * 12 inches tall 7 and 3/4 inches wide 2 inches length The height of the smaller box is 80% of the height of the larger box , while the other two dimensions are the same for both boxes . what is the difference in the volumes of the two boxes ? im stuck pls help me 6 Find the value of x for which r || s. Then find m what is the rate of acceleration of a bycycle if it went from a complete stop to 15 meters per second in 5 seconds ILL MAKE U BRAINLIEST enjoyed the strong support of President Andrew Johnson in its work on behalf of civil rights. won much southern white support because it consistently supported the planters in disputes with former slaves. made notable achievements in improving African American-American education and healthcare. carried out a successful program of distributing land to every former slave family. was badly administered because director O.O. Howard lacked military experience. Evaluate the following integral by using Fubini theorem Sol 1 + ydy dx ___ is the condition of a surface or center plane equidistant from a datum plane or axis. A Angularity B. Perpendicularity C. Parallelism D. Straightness