Option D, Touching their eyes, nose, or mouth pathogens can spread.
What is a pathogen?An organism that infects its host with disease is referred to as a pathogen, and the severity of the disease symptoms is referred to as virulence. Pathogens include viruses, bacteria, unicellular and multicellular eukaryotes, as well as other taxonomically diverse organisms.In biology, a pathogen is any organism or agent that has the potential to cause illness. Another name for a pathogen is an infectious agent or just a germ. In the 1880s, the word "pathogen" first became in use.There are five basic categories of pathogenic organisms: bacteria, fungus, viruses, protozoa, and worms.This can involve non-sexual hand-shaking or sexual touch during an intimate deed. Numerous illnesses, such as the cholera bacteria, can be spread via contaminated water.Learn more about pathogen refer to ;
https://brainly.com/question/10500193
#SPJ4
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Answer:
- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
Helper t cells interact with target cells by recognizing __________.
Answer:
Helper T-cells interact with target cells by recognizing antigens that are complexed with MHC proteins
Explanation:
please consider as brainlest if i helped toy
Which answer choice correctly states and describes the relationship between volume
and particle motion within the states of matter?
a) they have an indirect relationship, so when the volume for a state of matter increases, its particle motion decreases
b) they do not have any relationship, so they do not affect each other.
c) they have a direct relationship, so when the volume for a state of matter increases, its particle motion increases
d) they have a stable relationship, so the volume and particle motion for state of matter are equal to each other at all times
Answer:
The correct option is;
c) They have a direct relationship, so when the volume for a state of matter increases, its particle motion increases
Explanation:
The different states of matter are solid liquid and gas
Solids
The most compact form of matter is the solid state where the particles are held closely together and have no little or no motion to each other. The positions of the particles of solid iron are rigidly fixed and a mass of iron does not readily change shape
For example 1 kg of iron has a volume of 127 cm³
Liquids
When the 1 kg of iron is melted the volume it occupies becomes 143.27 cm³
The molten iron particles move freely and takes the shape of the container into which they are placed
Gases
Gases are the lightest state in which matter can exist and they completely fill the container into which they are placed due to their ease of movement.
Of the following, which is NOT considered to increase the risk of developing cancer for humans?Select one:a.ultraviolet lightb.toxic chemicalsc.regular exercised.smoking
Answer is C.
Explanation: Exercise is good for the body. It helps regu
what does localized swelling mass and lump trunk mean
Localized swelling, mass, and lump on the trunk refer to an abnormal enlargement or growth of tissue that is confined to a specific area on the body's central core region.
Swelling refers to an increase in the size of a body part due to an accumulation of fluid, while a mass or lump refers to an abnormal growth of tissue. These symptoms can be caused by a variety of conditions, such as an injury, infection, inflammation, or a tumor.
It is important to have any localized swelling, mass, or lump on the trunk evaluated by a healthcare professional.
A physical examination, imaging tests, and possibly a biopsy may be necessary to determine the underlying cause and appropriate treatment.
To know more about abnormal enlargement refer here
https://brainly.com/question/32137628#
#SPJ11
which one of these groups is at greatest risk of contracting and transmitting tuberculosis?
Individuals with weakened immune systems are at the greatest risk of contracting and transmitting tuberculosis and are more susceptible to TB infection and HIV/AIDS.
The group at greatest risk of contracting and transmitting tuberculosis is individuals with compromised immune systems, such as those with HIV/AIDS, as well as individuals who live in crowded or unsanitary conditions, such as homeless individuals or those living in poverty. Additionally, individuals who work in healthcare settings and come into contact with TB patients are also at increased risk. This includes people with HIV/AIDS, those undergoing cancer treatment, and individuals taking immunosuppressive medications. These groups are more susceptible to TB infection and are more likely to spread the disease to others.
To know more about HIV/AIDS visit:
https://brainly.com/question/22072504
#SPJ11
What do the skin and urinary system have in common?
O Both remove filtered wastes and reabsorb blood.
Both remove undigested food from the body.
O Both remove urine from the body.
Both remove urea from the body.
Answer:
d
Explanation:
Select the correct answer from each drop-down menu.
A
is an agent that causes disease. All
are pathogens.
A pathogens(C) is an agent that causes disease. All viruses(C) are pathogens.
What are pathogens?For Part 1, the correct answer is C. Pathogen. A pathogen is an agent that causes disease. All pathogens are infectious agents, but not all infectious agents are pathogens. For example, the common cold is caused by a virus, but the virus is not considered a pathogen because it does not usually cause serious illness.
For Part 2, the correct answer is C. Viruses. Viruses are the smallest and simplest pathogens. They are not cells, and they cannot reproduce on their own. They must infect a host cell in order to replicate.
Find out more on pathogens here: https://brainly.com/question/4205913
#SPJ1
Complete question:
Select the correct answer. A __ is an agent that causes disease. All ___ are pathogens.
Part 1
A. Bacteria
B. Germ
C. Pathogen
Part 2
A. Bacteria
B. Fungi
C. Viruses
when a dividing cell undergoes cytokinesis, two cells are produced. What is a educated guess about the meaning of cytokinesis.
Answer: cytokinesis is the splitting of a single cell into two daughter cells after telophase of mitosis is completed
Explanation:
Based on the cell theory, which of the following is true?
A) Large organisms have fewer cells than small organisms.
B) Small organisms have smaller cells than large organisms.
C) All living things are made of more than one cell.
D) New cells are produced from old cells.
Answer:
D.
Explanation:
As part of reproduction, the old cell splits up and makes a new one.
Answer:
D
Explanation:
El Niño is an event where the normally strong winds along the equator are much weaker than usual, causing warm surface water along the equator to pile up. Do these images represent a normal circulation pattern or an El Niño pattern? Explain your response.
Yes, because In 1997, El Niño had not spread as far across the equator in comparison to 2015. During an El Niño event, warm ocean waters accumulate in the central and eastern tropical Pacific, disrupting the normal atmospheric circulation patterns.
What is the El NiñoEl Niño refers to a climatic occurrence marked by the increase in temperatures of the ocean's surface in the central and east areas of the tropical Pacific Ocean. It has the potential to cause considerable changes in global weather phenomena.
The intensity and scope of El Niño occurrences differ annually. The year 2015 experienced a robust El Niño, which had significant and far-reaching impacts on weather systems around the world.
Learn more about El Niño from
https://brainly.com/question/6869165
#SPJ1
A garden supply company has an advertisement selling beneficial bacteria. They claim that the bacteria will help gardeners grow better gardens because of better soil. What can some bacteria do for soil?
increase clay content
provide water
slow down weathering
improve fertility
Answer:
D. improve fertility
Explanation:
A garden supply company has an advertisement selling beneficial bacteria. They claim that the bacteria will help gardeners grow better gardens because of better soil.
This claim is simply based on the premise or fact that some bacterias can improve fertility of the soil.
Some species of bacterias are living microorganisms that are capable of decomposing organic matter into nitrogen, carbon and other nutrients, which are then released into the soil in a plant available form when in excess and this cycle continues with reproduction of new bacterias.
Some examples of these bacterias are Klebsiella, Anabaenopsis, Beijerinckia, Azotobacter, Clostridium, Anabaena, Nostoc, Bacillus etc.
a molecule made of many smaller molecules
As molecules move down their concentration gradient, from a more ordered state to a less ordered state, entropy:_______.
As molecules move down their concentration gradient, from a more ordered state to a less ordered state, entropy increases. Entropy is a measure of the disorder of a system. The more entropy a system has, the more disordered and random it is.
As molecules move down their concentration gradient from a more ordered state to a less ordered state, they become more randomly distributed. This increase in randomness results in an increase in entropy. To summarize, when molecules move down their concentration gradient from a more ordered state to a less ordered state, entropy increases.
The smallest particle of a substance that has all of the physical and chemical properties of that substance. Molecules are made up of one or more atoms. The measure of a system's thermal energy per unit temperature that is unavailable for doing useful work. Because work is obtained from ordered molecular motion, the amount of entropy is also a measure of the molecular disorder, or randomness, of a system.
To know more about entropy visit:
https://brainly.com/question/28405832
#SPJ11
which of the following is the most accurate definition of perception? the processing of visual stimuli by the brain to give an accurate representation of the view of the world the conscious interpretation of the world around us the detection of the various energy forms in the environment by sensory receptors the detection of stimuli in the internal environment by visceral receptors the detection of stimuli in the external environment by sensory receptors
The best way to define perception is as our conscious interpretation of the world around us. Our ability to recognize and evaluate sensory data is known as perception.
How we react to information is also a part of perception. When we think of perception, we can picture a process where we take in sensory data from our surroundings and use it to interact with them. Various stimuli in our environment are constantly stimulating our sense organs. Our sense organs pick up on many of these stimuli, which are then transformed into sensations. Selecting, organizing, and interpreting stimuli are cognitive tasks that are part of perception.
We can therefore infer that the most accurate definition of perception is our conscious interpretation of the surroundings, which also includes our recognition and understanding of sensory data.
LEARN MORE ABOUT PERCEPTION HERE:
https://brainly.com/question/27164706
#SPJ4
Hair viewed for forensic investigations is studied both macroscopically and microscopically. Microscopic characteristics include the:
Hair viewed for forensic investigations is studied both macroscopically and microscopically. Microscopic characteristics include the pattern of the medulla, pigmentation of the cortex and types of scales.
Light microscopy is frequently used in forensic science laboratories to examine human hairs. The two steps of this investigation are typically the identification of the questioned hairs and the comparison of the questioned and known hairs.
In order to determine if one or more people may have come into touch with an object or whether two or more people could have come into contact, this examination is being conducted. In violent crimes like murder, sexual assault, and aggravated assault when physical contact may have taken place, this association evidence is very helpful. Crimes like burglaries and armed robberies sometimes include the retrieval of trash and clothing items that might contain hairs relevant for identifying culprits.
Learn more about Forensic Investigation here:
https://brainly.com/question/30029535
#SPJ4
several body systems work together to regulate the ph of body fluids within a very narrow range. click to select the problems that can occur when the ph of body fluids gets too high (alkalosis) or too low (acidosis).
Fatigue and dizziness .There is evidence that acidosis stimulates.
What is acidosis and alkalosis?The condition acidosis and alkalosis result due to the change in body’s pH base balance. When the body's fluids have an abnormally low pH level and are too acidic, the condition is known as acidosis. The opposite is true in alkalosis when the body's fluids are too alkaline (high in pH). When biological fluids contain too much acid, acidosis develops. Lower values indicate more acidic substances, hence this causes a fall in blood PH. When the blood's pH is lower than 7.35, it is regarded as abnormally acidic (high in acid). There could be a mild acidosis without any symptoms. In some cases, especially in seriously ill people, it can worsen if it is not diagnosed and treated. Acidosis can sometimes lead to serious physical effects, Hyperventilation (breathing abnormally rapidly or deeply) (breathing abnormally fast or deeply) ,impaired heart performance, reduced blood pressure, Coma\s Alkalosis. When the blood has too little acid, a condition known as alkalosis results, making the blood overly basic, which is another word for alkaline. Higher numbers indicate more alkaline substances, so the blood pH rises as a result. When the blood's pH rises above 7.45, it is deemed to be abnormally alkaline. Mild, persistent (chronic) alkalosis may happen with no obvious symptoms. Symptoms of alkalosis that result in severe or quick pH changes may include the following: Unsteadiness or faintness, Hands and feet that are numb, Confusion, nausea or diarrhoea, twitching or spasms of the muscles, inadequate blood oxygen levels, Seizures, becoming unconscious or almost unconscious.
To know more about acidosis and alkalosis, visit:
https://brainly.com/question/17031780
#SJP4
The ____________________ explosion is a radiation of animals with hard parts that marks the start of a new eon in geologic time.
The Cambrian explosion is a radiation of animals with hard parts that marks the start of a new eon in geologic time.
What is Cambrian period?
The Cambrian Period is the first geologic period of the Paleozoic Era ("Time of Ancient Life"). This period lasted from 541 million to 485.4 million years ago, more than 55 million years ago, and marked a dramatic burst of evolutionary change in life on Earth, known as the "Cambrian Explosion". Among the animals that evolved during this period were chordates — animals with a dorsal nerve cord; brachiopods with hard bodies that resembled clams; and arthropods—the ancestors of spiders, insects, and crustaceans.
Although there is some scientific debate as to which fossil strata should mark the beginning of this period, the International Commission on Stratigraphy places the lower limit of the period at 541 million years ago, when worms making horizontal burrows first appeared in the fossil record. The end of the Cambrian period is marked by evidence in the fossil record of a mass extinction about 485.4 million years ago. The Cambrian period was followed by the Ordovician period.
To learn more about Cambrian period from the given link:
https://brainly.ph/question/280941
#SPJ4
Whale primary functions
The primary functions of whales include feeding, reproduction, communication, and migration.
Whales are primarily filter feeders or predators, depending on the species.
Filter-feeding whales, such as baleen whales, have baleen plates in their mouths that allow them to filter out small prey, such as krill or small fish, from large volumes of water.
Predatory whales, such as toothed whales, hunt and feed on various marine organisms, including fish, squid, and marine mammals.
Reproduction is another important function for whales. Most whale species have a gestation period of several months, with females giving birth to a single calf.
The calves are nursed with milk from their mothers and rely on their care for a period of time until they become independent.
Communication is vital for whales, as they rely on vocalizations to communicate with other members of their pod.
Whales produce a variety of sounds, including songs, clicks, and whistles, which serve purposes such as mating, social interactions, and navigation.
Migration is a common behavior observed in many whale species. Whales undertake long-distance migrations, often covering thousands of kilometers, to reach feeding grounds in nutrient-rich waters or to reproduce in specific breeding areas.
These migrations are driven by seasonal changes in food availability and environmental conditions.
In summary, the primary functions of whales encompass feeding, reproduction, communication, and migration, all of which are essential for their survival and successful adaptation to their marine environments.
For more such answers on whales
https://brainly.com/question/28623065
#SPJ8
Develop a project plan, clearly indicating the project scope, deliverables, flow of deliverables, project. activities, Work Break Structure (WBS), the schedule, quality criteria, and expected risks. (50Marks) Project: Conference - You are required to organize and run a conference for 100 delegates. - The date and subject matter are set. - The focus of the conference is to bring members of Project Management profession up to date on recent procedures and standards and to developments in professional allow for networking between fellow members. Task 2 A farmer has been allocated 100 hectares of an arable land in Otavi. The farmer is not sure whether to grow vegetables or to produce livestock feed on the plot. He then approaches you for advice as to which option will maximize his benefits from an efficiency point of view. Prepare a detailed Project plan for each of the two options. (50Marks) 2. Use the Cost-Benefit Analysis Method to compare which option will bring more economic benefits. 3. What other factors would you consider in making final recommendations? 4. Use Chapters in the prescribed textbook and any other resources to guide you in the assignment. NB: Students are expected to have read Chapters in the prescribed textbook and apply the Cost-Benefit analysis method to the given project.
1. Organize and run a conference for 100 delegates in order to update project management professionals on recent procedures and standards and facilitate networking opportunities. 2. Successful execution of the conference, updated procedures and standards material, networking opportunities. 3. Pre-conference planning, venue setup, registration, keynote speeches, breakout sessions, networking activities, post-conference evaluation. 4. Project Activities: Venue selection, budgeting, speaker invitations, program development, marketing and promotion, logistics management, registration process, on-site coordination.
Task 1: Organizing a Conference
1. Project Scope:
Organize and run a conference for 100 delegates.Date and subject matter are already set.Focus on updating project management professionals on recent procedures, standards, and developments in the profession.Provide networking opportunities for conference attendees.2. Deliverables:
Successfully organized conference event.Well-informed and engaged conference attendees.Networking opportunities for project management professionals.3. Flow of Deliverables:
Pre-conference planning and preparationConference event executionPost-conference follow-up and evaluation4. Project Activities:
Venue selection and bookingDeveloping a conference program/agendaIdentifying and inviting relevant speakers/presentersManaging registrations and attendee communicationsOrganizing logistics (catering, audiovisual equipment, signage, etc.)Coordinating networking activitiesConducting post-conference evaluation and feedback collection5. Work Breakdown Structure (WBS):
Each project activity should be broken down into smaller, manageable tasks to create a comprehensive WBS.6. Schedule:
Create a timeline outlining the start and end dates of each project activity, including dependencies and milestones.7. Quality Criteria:
Define specific quality standards for each deliverable, such as the professionalism of speakers, attendee satisfaction, smooth event logistics, and effective networking opportunities.8. Expected Risks:
Identify potential risks and develop a risk management plan, including strategies to mitigate, transfer, or accept risks associated with the conference. Risks could include budget overruns, speaker cancellations, technical failures, or low attendance.Task 2: Farmer's Land Allocation
1. Project Options:
Option 1: Growing vegetables on the plot.Option 2: Producing livestock feed on the plot.2. Cost-Benefit Analysis:
Conduct a cost-benefit analysis for each option to compare the economic benefits.Identify and quantify costs associated with each option (e.g., land preparation, seeds, equipment, labor, maintenance).Identify and quantify benefits (e.g., crop yield, market prices, potential profits, savings on feed costs).3. Other Factors for Consideration:
Environmental factors (water availability, soil suitability)Market demand for vegetables and livestock feedFarmer's expertise and resourcesPotential risks and challenges specific to each option (e.g., pests, diseases, market fluctuations)To learn more about project plan, here
https://brainly.com/question/30187577
#SPJ4
*PLEASE ANSWER FAST!
10. The process shown in the diagram is known as
- photosynthesis
-replication
-cellular respiration
-protein synthesis
Answer:
cellular respiration i think...
Which species is more likely to survive changes in the environment?
ATP stands for ______ triphosphate, which is a molecule that powers many cellular reactions. Multiple choice question.
ATP stands for Adenosine triphosphate, which is a molecule that powers many cellular reactions. ATP is a nucleotide that consists of three components, which are a nitrogenous base called adenine, a sugar molecule called ribose, and three phosphate groups that are connected by high-energy bonds.
The three phosphate groups are crucial to the molecule's function because they store large amounts of energy. When one of the phosphate groups is cleaved, ATP releases the energy required to drive many cellular reactions. Cellular reactions require energy to function, and this energy can come from ATP molecules. When the body needs energy, it uses enzymes to break down ATP, releasing energy and transforming the molecule into ADP (adenosine diphosphate). The process by which ATP is converted into ADP is reversible, meaning that energy from other sources can be used to transform ADP into ATP once again. Overall, ATP is an essential molecule that is critical to the functioning of many cellular processes.
To know more about molecule visit:
https://brainly.com/question/32298217
#SPJ11
The average lethal blood concentration of morphine is estimated to be 2.5 ug/mL with standard deviation of 0.95 ug/mL The data is normally distributed. Examine the range of values 0.05 to 4.95 pg/mL Answer the following questions and provide the appropriate calculations (13 points): a. What is the probability associated with the range lethal morphine blood levels? b. Provide the range of values that lie within 1, 2 and 3 standard deviations from the mean_ What is the probability that somebody dies if the blood morphine concentration is 0.3 pg/mL
The probability associated with the range of lethal morphine blood levels is 0.99. The probability that somebody dies of the blood morphine concentration is 0.3 pg/ mL will be 0.0103.
What is Probability?A probability is a number which reflects the chance or likelihood that a particular event will occur. Probabilities can be easily expressed as the proportions which range from 0 to 1, and they can also be expressed as the percentages ranging from 0% to 100%.
Mean (u) = 2.5,
Standard deviation (σ) = 0.95
(a) P(0.05 < x < 4.95)
P(0.05-2.5/0.95 < x < 4.95 -2.5/0.95)
P(-2.5789 < x < 2.5789)
P ( x < 2.5789) - P(< -2.5789)
0.9950 - 0.0050
= 0.99
(b) within 1 S.D Range values are
1, S.D= (μ ± σ) = 2.5 ± 0.95 = (1.55, 3.45)
2, S. D = (μ ± 2σ) = 2.5 ± 2 (0.95) = (0.6, 4.4)
3, S. D = (μ ± 3σ) = 3(0.95) = (-0.35, 5.35)
(c) P(x < 0.3)
P(Z < 0.3-2.5/ 0.95)
P(Z<-2.3158)
P = 0.0103
Learn more about Probability here:
https://brainly.com/question/30034780
#SPJ1
HELP PLS: NEED ANSWER ASAPPPPPPPPPPPP <3
1. Explain acid deposition. Your explanation should include the following:
• The sources of acid deposition
• The chemical equations involved in acid deposition formation
• An explanation of the types of acid deposition
• A discussion of the effects of acid deposition
• A drawing that shows the sources, formation, and precipitation of acid deposition
Acid deposition, also known as acid rain or acid precipitation, refers to the deposition of acidic substances from the atmosphere onto the Earth's surface. It is primarily caused by emissions of sulfur dioxide (SO2) and nitrogen oxides (NOx) from human activities, particularly the burning of fossil fuels such as coal and oil in power plants, industrial processes, and vehicle emissions.
The chemical equations involved in acid deposition formation are as follows:
1. Formation of sulfuric acid (H2SO4):SO2 (sulfur dioxide) + O2 (oxygen) + H2O (water) → H2SO4 (sulfuric acid)
2. Formation of nitric acid (HNO3):NOx (nitrogen oxides) + OH (hydroxyl radical) → HNO3 (nitric acid)
Acid deposition can occur in two main forms: wet deposition and dry deposition.
1. Wet deposition: This occurs when acidic compounds in the atmosphere combine with water vapor to form acids that are then brought down to the Earth's surface through precipitation, such as rain, snow, sleet, or fog.2. Dry deposition: In this form, acidic compounds settle directly onto the Earth's surface without the involvement of precipitation. These compounds can be in the form of gases, particles, or dust, which are deposited onto plants, buildings, soil, and water bodies.The effects of acid deposition can be significant and wide-ranging:
1. Environmental impact: Acid deposition can acidify soil and bodies of water, leading to detrimental effects on aquatic ecosystems and plant life. It can harm fish, amphibians, and other aquatic organisms, as well as affect the pH levels and nutrient availability in soil, hindering plant growth.2. Damage to infrastructure: Acidic substances in acid deposition can corrode and damage buildings, statues, bridges, and other structures made of materials such as limestone, marble, and metals.3. Human health concerns: Acid deposition does not directly pose a significant health risk to humans. However, the pollutants that contribute to acid deposition, such as sulfur dioxide and nitrogen oxides, can contribute to respiratory problems and aggravate existing respiratory conditions in susceptible individuals.\(\huge{\mathfrak{\colorbox{black}{\textcolor{lime}{I\:hope\:this\:helps\:!\:\:}}}}\)
♥️ \(\large{\underline{\textcolor{red}{\mathcal{SUMIT\:\:ROY\:\:(:\:\:}}}}\)
illustrate passive transport.
Pls HELP
In 1907, Dr. Duncan MacDougall performed a series of experiments in which he attempted to measure the weight of the soul as it left a dying person. In his experiments, MacDougall placed a dying person on a scale and measured their weight immediately prior to and following death. MacDougall determined the change in weight to be approximately 21 grams. From these experiments, he concluded that the soul exists and has mass. What is the fundamental scientific flaw in his conclusions? (5 points)
They are based on the concept of the soul, which is beyond the bounds of science.
They are based on the idea that the soul is made of matter, not energy.
They are based on the assumption that the soul does not remain in the body after death.
They are based on the concept that the soul can be measured.
Answer:
I think so..
A. They are based on the concept of the soul, which is beyond the bounds of science.
Answer:
A. They are based on the concept of the soul, which is beyond the bounds of science.
Explanation:
Good luck! Hope this helped :)
draw a simple diagram of a carbohydrate molcule and describe its structure
Answer:
just draw the diagram
Which of the following have no cell walls, no chloroplasts, and are heterotrophs?
d. fungi
a. protist
b. bacteria
c. plants
e. animals
Answer:
No cell walls ,no chloroplast and heterophs.
Explanation:
e.Animals is the correct answer
Which question can be answered using the scientific process?
A. Which kind of bag has the best color?
B. How long does it take a paper bag to break down?
C. Is it right for a grocery store to use plastic bags?
D. Should people feel bad for using paper bags?