By observing another monkey exhibit fear of snakes, monkeys can acquire that phobia.
Are monkeys naturally afraid of snakes?Real, toy, and modeling snakes caused significant fear in the majority of monkeys raised in the wild, however most of those raised in laboratories only displayed extremely weak reactions. Lack of willingness to reach food on the snake's opposite side and behavioral disturbances were indicators of fear.
Is a fear of snakes something you can learn?According to David Rakison, a social psychologist at Carnegie Mellon who studies early child development, "the current experiment, and even no contractor shall submit, has provided proof that fear of snake or spiders is intrinsic."
To know more about monkeys visit :
https://brainly.com/question/7580215
#SPJ4
What are some non examples of fertilization
Answer:
Infertile. That is the only one I can think of sry
Explanation:
Hope this helped, Have a Wonderful Day/Night!!
Answer: In animals, there are two types of fertilization, internal and external. Internal fertilization happens in the female body. External fertilization happens outside of the body. Mammals, birds, and reptiles use internal fertilization.
Explanation:
So you look at the definition and fine examples
The community of a pond is made up of ?
Answer:
The community is made up of fish, insects, and all living organisms
Explanation:
Answer:
Explanation:
plants, animals, microorganisms, and a surrounding environment
Prokaryotes do not have a
O genetic information
O cytoplasm
O ribosomes
O O OO
membrane bound nucleus ,
cell membrane
OK
INDEPENDENT, DEPENDENT, OR CONTROL?
You water three sunflower plants with salt water. Each plant receives a
different concentration of salt solution. A fourth plant receives pure water.
After a two-week period, the height is measured.
1. Is the height the independent variable or dependent variable?
2. What is the control group in this experiment?
Answer:
dependent variable
the control group is the fourth plant with pure water.
Explanation:
What is the difference between diffusion and osmosis?
Answer:
Osmosis is the movement of solvent particles across the a semipermeable membrane from a dilute solution into a concentrated solution.
Diffusion is the movement of particles from an area of higher concentration to lower concentration.
Explanation:
The overall effect is to equalize concentration throughout the medium.
Answer:
What is the difference between osmosis and diffusion?
Explanation:
The boiling point of benzene is 80ºC. Which pair of samples will have the same average kinetic energy as benzene molecules?(1 point)
a sample of liquid benzene at 70ºC and a sample of gaseous benzene at 90ºC
a sample of liquid benzene at 70ºC and a sample of gaseous benzene at 90ºC
a sample of liquid benzene at 80ºC and a sample of gaseous benzene at 80ºC
a sample of liquid benzene at 80ºC and a sample of gaseous benzene at 80ºC
two samples of liquid benzene, one at 70ºC and the other at 80ºC
two samples of liquid benzene, one at 70ºC and the other at 80ºC
two samples of gaseous benzene, one at 80ºC and the other at 90ºC
two samples of gaseous benzene, one at 80ºC and the other at 90ºC
Answer:
a sample of liquid benzene at 80ºC and a sample of gaseous benzene at 80ºC
Explanation:
I took the quick check
Which of the following are valid ways to find out correct information about your health. Search the internet. Ask a trusted family member consult a doctor, nurse or qualified health professional none of the above
Answer:
Consult a doctor, nurse or a qualified health professional.
Explanation:
Doctors and Nurses are professionals in this field. From the options listed they are the only people who could give you valid information on your health. Getting your information from other sources could lead you to being misinformed, and that could have detrimental effects.
is the form of nitrogen plants need to grow, develop and produce seeds Nitroplasma Nitrachem Nitrohydrogen Nitrate
Answer:
Nitrate.
Explanation:
”Nitrate is the form of nitrogen most used by plants for growth and development.”
hope this helps!
The plane of Earth's orbit around the Sun is called the: ?
Answer:
its called The Ecliptic.
Explanation:
The plane of Earth's orbit around the Sun is called the "ecliptic plane." The ecliptic plane is an imaginary flat plane that represents the average path traced by Earth as it orbits the Sun.
The Ecliptic plane serves as a reference plane for locating the positions of celestial objects in the sky, including the Sun, Moon, planets, and stars. The ecliptic plane is inclined at an angle of approximately 23.5 degrees with respect to Earth's equator, giving rise to the changing seasons as Earth orbits the Sun.
Therefore, the ecliptic plane represents the average path of Earth's orbit around the Sun and serves as a reference for understanding celestial positions and movements. Its tilt plays a vital role in determining Earth's seasons, and its alignment with other planets enables various astronomical phenomena.
For more details regarding Earth's orbit, visit:
https://brainly.com/question/32021664
#SPJ6
Write me a 10 minute speech about varicella zoster
Need it asap
Varicella Zoster is an infectious viral disease causing chickenpox in children and shingles in grown-ups. Inoculation plays a crucial part in avoidance and lessening complications.
Aspeech on Varicella-ZosterWomen and noblemen,
Nowadays, I would like to examine a vital and predominant viral disease known as Varicella Zoster. Varicella Zoster, commonly alluded to as chickenpox, is caused by a varicella-zoster infection. It fundamentally influences children, but can too affect grown-ups who have not been already contaminated.
Varicella Zoster presents as a profoundly infectious sickness characterized by a particular hasty, fever, and common disquietude. The infection spreads through coordinated contact or respiratory beads, making it effortlessly transmissible inside families and communities.
Whereas chickenpox is for the most part a gentle ailment in children, it can lead to more serious complications in grown-ups, pregnant ladies, and people with debilitated resistant frameworks. These complications incorporate pneumonia, bacterial contaminations, and in uncommon cases, neurological complications such as encephalitis.
Luckily, the improvement of a profoundly successful antibody has essentially diminished the frequency of Varicella Zoster around the world. Immunization not as it were secures people from the distress and potential complications of chickenpox, but too makes a difference anticipate the infection from spreading inside the community.
In any case, Varicella Zoster doesn't halt at chickenpox. Once the introductory contamination settles, the infection remains torpid inside the body and can reactivate a long time afterward, causing a condition known as herpes zoster, or more commonly, shingles.
Shingles are characterized by a difficult hasty that ordinarily happens in a single dermatome, regularly along the middle or confront. The reactivated infection can cause critical pain and inconvenience, enduring for weeks or indeed months. Moreover, complications such as postherpetic neuralgia, a persistent torment disorder, can happen, especially in more seasoned people.
To combat the chance of shingles, an isolated antibody called the shingles antibody or herpes zoster immunization has been created. This antibody not as it were makes a difference anticipate shingles but moreover diminishes the chance of postherpetic neuralgia.
In conclusion, Varicella Zoster, enveloping both chickenpox and shingles, could be a viral contamination that has critical suggestions for open well-being. We have made significant progress in reducing the burden of this disease through extensive vaccination efforts.
In any case, ongoing efforts to prevent Varicella zoster from returning to our communities and to protect powerless populations require prompt attention and vaccination.
Much obliged to you for your thought. Let's collaborate to ensure a better future for everyone.
Learn more about chicken pox here:
https://brainly.com/question/4024185
#SPJ2
Different kinds of substances have different properties. Compare and contrast the electrical properties of salts, metals, and acids.
Salts, metals, and acids are three different types of substances exhibiting unique electrical properties.
Thus, salts are ionic compounds and exhibit electrical properties as they have both positively charged ions and negatively charged ions. They can dissociate in solution into their constituent ions to conduct electricity, but they can not conduct electricity in the solid state.
Like salts, metals also conduct electricity due to their free-moving electrons. They have high electrical conductivity and are used in electrical wiring and other applications. Acids release hydrogen ions when dissolved in water which allows them to conduct electricity because the hydrogen ions move freely and carry an electrical charge when acids are dissolved in water, thereby, exhibiting electrical properties.
Learn more about the salts here:
https://brainly.com/question/30105881
#SPJ1
What is the natural tendency of molecules to spread from an area of high concentration to an area of low concentration?
A.
Active transport
B.
Vesicle
C.
Passive transport
D.
Diffusion
Answer:
This concept is known as diffusion. Diffusion is a passive process, as it requires no energy for it to occur. In a cell, it is used as a method of passive transport since it requires no energy.
Explanation:
A P E X
Which of the following best describes a plant?
(A) multicellular eukaryote
(B) multicellular prokaryote
(C) unicellular eukaryote
(D) unicellular prokaryote
Answer:
The correct option to describes prokaryotes and eukaryotes are B. Prokaryotes do not have a nucleus; eukaryotes have a nucleus. .
Explanation: The prokaryote cells do not have a nucleus whereas eukaryotic cells have distinct a nucleus
3. List the main phases of mitosis in order from start to finish. *
The main phases of mitosis in order from start to finish are as follows:
ProphasePrometaphaseMetaphaseAnaphaseTelophase.What is Mitosis?Mitosis may be defined as a type of cell division through which a parental cell is successfully divided into two daughter cells. These daughter cells are genetically identical to the parental cells and generally diploid in nature.
Prophase is the longest phase of karyokinesis. In this phase, the nuclear membrane and nucleolus disappear. In metaphase, the chromosomes are usually lined up in one plane by attaching to the spindle through the centromere.
Anaphase is the smallest phase of mitotic cell division. In this phase, the centromere splits, and chromosomes move to opposite poles. In telophase, the two sets of daughter chromosomes reached opposite poles and are converted into chromatin thread.
Therefore, the main phases of mitosis order from start to finish are well described above.
To learn more about Mitosis, refer to the link:
https://brainly.com/question/19058180
#SPJ1
To see if baldness in men is caused by a high protein diet, a scientific researcher provides one group of 50 men a diet which includes the normal AMDR range for protein (10-35%). The researchers provide a second group of 50 men with a high protein diet, containing above 50% protein. What is the variable for which this experiment’s results will be based upon?
a.
Whether or not the men develop baldness
b.
The amount of protein in the men’s diets
c.
The age of the men and amount of water they are given to drink
d.
The number of men in each group
What is the difference between science and non-science? (3 points)
A. Science is absolute knowledge based on prediction and guessing
B. Science uses only absolute truths without evidence
C.There are no errors in science
D.Science looks for evidence of phenomena in the natural world
Answer:
d
Explanation:
science depends on facts. no guessing, no predictions
Answer: D
Explanation:
What is the function of the circulatory system? *
A. Transports oxygen, waste, and nutrients around the body.
B. Removes waste from the body
C. Attaches to bones helps the body move
D. The nervous system gathers and interprets information and sends messages throughout the body.
Answer:
A
Explanation:
please give brainlest
All organisms are genetically different.
All organisms have homologous structures.
All organisms share a common genetic code.
All organisms came from different ancestors.
Answer:
All organisms share a common genetic code.
Explanation:
Organisms are genetically different for the most part but this asks why it applies to all organisms.
They do not all have homologous structures
They share a common ancestor
Factorise completely pq - q?
Explanation:
q(p-1) is the factorization of pq- q.
which organelle has large storage containers for water, food, and waste only in plant cells
Answer:
Vacuole
Explanation:
The vacuole is one of the largest organelles in a plant cell because it holds the water, food, and waste of the cell.
Answer:
Central Vacuole
Explanation:
Central Vacuole A large storage container for water, food and waste only in plant cells. Cell Membrane Made of two layers of phospholipids. Controls what moves in and out of the cell.
2. I understand how having less carbon dioxide available in the biodome led to fewer energy storage molecules being made in the biodome.
yes
Answer:#69
Explanation:My name is Walter Hartwell White. I live at 308 Negro Arroyo Lane, Albuquerque, New Mexico
A specific characteristics such as a seed color or plant height that varies from one individual to another
Answer:
Phenotype
Explanation:
Phenotype refers to an individual's observable traits, such as height, eye color and blood type.
Unlike perennials, annuals
A. must be grown in handing baskets
B. Cannot be grown in the sun
C. Need plenty of shade
D. Finish their life cycles in a year
Part one
The sedimentary rock known as conglomerate typically forms in _______ environments in which particles can become rounded, such as fast-flowing rivers.
An example of _______ is when moving water slows down and particles being transported in the water begin to settle out (sediment) in a new location.
_______ is a type of sediment that feels smooth to your fingers but gritty in your mouth.
The most common chemical sedimentary rock is _______.
Limestone typically doesn't accumulate in the ocean at depths below 4,000 meters because below that depth, calcite is _______.
Based on the principle of original horizontality, geologists conclude that layers of sedimentary rock that have been tilted must have been subjected to _______.
Based on the principle of inclusions, the cobbles in conglomerate must have been formed _______ the conglomerate.
Geologists use the principle of _______ to justify using fossils in a sample of sedimentary rock to determine the rock’s age.
Partings between adjacent beds of sedimentary rock may represent periods of _______, which could range from a few decades to a few centuries.
Some graded beds, especially those resulting from deposition by a fast-moving debris flow, are reversed, which means _______ material is at the top instead of at the bottom.
Part 2
During metamorphic processes, increased pressure and temperature can affect the _______ of minerals in rock.
Rocks subjected to very high pressure are typically _______ than others because mineral grains are squeezed together, and the atoms are more closely packed.
During metamorphic processes, water facilitates the transfer of ions between and within minerals, which can _______ the rate at which metamorphic reactions take place.
The growth of new minerals within a rock during metamorphism has been estimated to be about _______ per million years.
_______ metamorphism is commonly associated with convergent plate boundaries, where two plates move toward each other.
During contact metamorphism, a large intrusion will contain _______ thermal energy and will cool much more slowly than a small one.
Metamorphosed sandstone is known as _______.
The metamorphic rock _______, made from metamorphosed shale, was once used to make blackboards for classrooms.
The proper response to the rocks and minerals are;
1. high-energy environments 2. An example of deposition
3. Silt is a type of sediment 4. sedimentary rock is limestone.
5. calcite is soluble. 6. subjected to tectonic forces
7. before the conglomerate. 8. principle of faunal succession
9. periods of non-deposition, 10. which means coarser material
What more should you know about rocks and minerals?
In response to part 2 on rocks and minerals;
1. temperature can affect the structure and composition of minerals in
rock.
2. Rocks subjected to very high pressure are typically denser
3. water facilitates the transfer of ions between and within minerals, which can increase the rate at which metamorphic reactions take place.
4. The growth of new minerals within a rock during metamorphism has been estimated to be about 1 mm per million years.
5. Regional metamorphism is commonly associated with convergent plate boundaries,
6. During contact metamorphism, a large intrusion will contain more thermal energy
7. Metamorphosed sandstone is known as quartzite.
8. The metamorphic rock slate, made from metamorphosed shale, was once used to make blackboards for classrooms.
Find more exercises on rocks and minerals;
https://brainly.com/question/31709538
#SPJ1
The tons of toxic fly ash generated by coal-fired power plants are made up of all of the following EXCEPT:
Please choose the correct answer from the following choices, and then select the submit answer button.
Answer choices
cadmium.
silica.
sulfates.
lead.
The tons of toxic fly ash generated by coal-fired power plants are made up of all of the following EXCEPT sulfates. Therefore the correct option is option C.
Chemical substances containing the sulphate ion (SO4 2-), which is made up of sulphur and oxygen atoms, are referred to as sulphates or sulphates. Minerals, salts, and detergents are just a few examples of the natural and manufactured sources of sulphate.
Sulfates are frequently employed as foaming agents, surfactants, and emulsifiers in the context of personal care and cosmetic goods in order to help produce lather and cleanse the face or hair.
Sodium lauryl sulphate (SLS) and sodium laureth sulphate are typical instances of sulphates used in personal care products. (SLES). Therefore the correct option is option C.
For such more question on sulfates:
https://brainly.com/question/275651
#SPJ11
Galileo and newton both study the night sky. Galileo study Jupiter and its moons. Newton study the gravitational force that held the planets in orbit. Which of these statements best explains why the two scientist propose different theories about the solar system?
a. both scientist had different interests.
b. both scientist lacked scientific evidence.
c. they wanted to be the first to discover new planets.
d. they wanted to contradict each other‘s theories.
Answer:
a. both scientists had different interests.
Explanation:
Newton focused in physics for the most part and the study of what we know now as Newton's laws
while Gallileo focused on planets and astrology
individuals may give rise to ________ offspring than could possibly ____________.
Individuals may give rise to more offspring than could possibly survive.
This concept is known as overproduction or reproductive potential. It is a fundamental principle in biology that species tend to produce more offspring than the environment can support.
The reason for this overproduction is rooted in the struggle for limited resources and the survival challenges individuals face in their respective habitats.
By producing a large number of offspring, individuals increase the chances of some offspring surviving and reproducing successfully. This strategy maximizes the species' probability of passing on their genetic traits to future generations.
However, the environment has finite resources, such as food, shelter, and mates, which cannot sustain unlimited population growth.
As a result, only a fraction of the offspring will survive and reach reproductive age. The rest may face competition, predation, disease, or other factors that prevent their successful reproduction.
This overproduction and subsequent natural selection of the fittest individuals contribute to the ongoing process of adaptation and evolution within populations.
Those individuals with advantageous traits are more likely to survive and reproduce, passing on their favorable traits to the next generation.
For more such answers on the population
https://brainly.com/question/29885712
#SPJ11
How is a recessive allele different from a dominant allele?
Answer:
A dominant allele is an allele that will express the dominant phenotype when only one allele is present. In contrast, a recessive allele is an allele that is only expressed when both alleles are in the genotype.
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
Answer:
look at explanation
Explanation:
basically in order to go from mrna to trna just replace
a becomes u
g becomes c
u becomes a
c becomes g
Why is it hard to model the inheritance of more than one gene?
Answer:
because all of them are different?
Explanation: