Please help I’ll give brainist!

Please Help Ill Give Brainist!

Answers

Answer 1

Answer:

a

Explanation:

Just trying to help


Related Questions

if a muscle fiber has a very long refractory period, what consequence would this have on the ability of the muscle to achieve a tetanic contraction?

Answers

When tetanized, the contracting withinside the muscle stays consistent in a consistent state.

This is the maximal viable contraction. During tetanic contractions, muscle mass can shorten, prolong or continue to be consistent period. Tetanic contraction is generally normal (together with whilst keeping up a heavy box). Contraction period - anxiety will increase as movement capacity is spreading alongside the period of the muscle tissue.

Relaxation period – muscle relaxes, relieves anxiety or comes again to its unique period. Since it takes place because of passive anxiety from the connective tissues, takes extra time than the contraction phase. The longer the muscle fiber, the bigger the pressure it may generate because of the elevated wide variety of myosin-actin bridges it may form.

Read more about muscle;

https://brainly.com/question/13920046

#SPJ4

Question 1 of 10
A rod-shaped bacterial cell has a length of 0.004 mm. A scale model of the
bacterial cell has a length of 40 mm. What is the scale of the model?
A. 1:1,000,000
B. 100,000:1
C. 10,000:1
D. 1:1,000

Answers

C. The the scale of the model the bacteria cell  is 10,000:1.

What is a rod shaped bacteria?

A  bacillus, also called a bacilliform bacterium or often just a rod, is a rod-shaped bacterium or archaeon. Bacilli are found in many different taxonomic groups of bacteria.

Scale of the model

40 mm  :  0.004 mm :

x  1000    : x 1000

=  40,000  : 4 mm  

=  (40,000 mm/4mm) : (4 mm/4mm)  

=  10,000 : 1

Thus, the the scale of the model the bacteria cell  is 10,000:1.

Learn more about shape of bacteria cell here: https://brainly.com/question/8574377

#SPJ1

What is ballistochory?

Answers

Answer:

Ballistochory. So it is called when the seeds are forcefully or explosively spread. The aim is to "throw" the seed from the parent plant as far as possible.

Explanation:

This is what is known by the violent and explosive dispersal of the seeds. The aim is to "throw" the seed from the parent plant as far as possible. (This works because the wind resistance is not high for seeds.)

Answer:

the dispersal of seeds by force

Explanation:

the high-affinity hsp90–chip complex recognizes and selectively degrades phosphorylated tau client proteins

Answers

The high-affinity Hsp90-CHIP complex recognizes and degrades phosphorylated tau client proteins, contributing to the regulation of tau homeostasis and the prevention of tau aggregation in neurodegenerative diseases. Understanding this process may aid in developing therapeutic strategies for tau-related disorders.

The high-affinity Hsp90-CHIP complex plays a crucial role in recognizing and selectively degrading phosphorylated tau client proteins. Hsp90 (heat shock protein 90) is a chaperone protein that assists in the folding and stabilization of various client proteins, including tau. CHIP (carboxyl terminus of Hsc70-interacting protein) is an E3 ubiquitin ligase that targets misfolded or damaged proteins for degradation.

Phosphorylated tau proteins are associated with neurodegenerative disorders, such as Alzheimer's disease. The Hsp90-CHIP complex specifically recognizes and binds to phosphorylated tau client proteins through a high-affinity interaction. This recognition allows CHIP to ubiquitinate the phosphorylated tau, marking it for degradation by the proteasome.

By selectively targeting phosphorylated tau proteins, the Hsp90-CHIP complex contributes to the regulation of tau homeostasis and the prevention of tau aggregation, which is a hallmark of neurodegenerative diseases. This process helps maintain cellular proteostasis and reduces the accumulation of toxic protein aggregates that can contribute to neurodegeneration.

Understanding the mechanisms underlying the recognition and degradation of phosphorylated tau by the Hsp90-CHIP complex may provide insights into potential therapeutic strategies for the treatment of tau-related neurodegenerative disorders.

To know more about Alzheimer's disease,

https://brainly.com/question/29972488

#SPJ11

Unit 10: Career Exploration
This activity will help you meet these educational goals:
● Content Knowledge—You will learn about the responsibilities of different types of
Biologists.
● Inquiry—You will conduct online research in which you will collect information, make
observations, and communicate your results in written form.
● 21st Century Skills—You will employ online tools for research and analysis, use critical
thinking, and communicate effectively.

Introduction
Biologists have different responsibilities based on their career choice or specialty. You have to
understand the opportunities available to you should pursue a career in this field.
__________________________________________________________________________
Directions
Task 1: Biologist Responsibilities
Research one or more of the following biology-related job fields: Field Biologist, Senior Biologist,
Conservation Biologist, Conservation Scientist, or Evolutionary Ecologist. Find a sample resume
within that field and identify some key skill sets that resume has. Are these skills that you feel you
already possess? Or would you need to grow some of these skills? Be sure to upload the sample
resume to the dropbox.
Type your response here:

Answers

There are many different job paths you might choose with this degree, but biology is a prerequisite for careers in the science and health sectors.

What is career in Biology?

Relevant experience demonstrates your dedication to the field and helps you gain practical skills in a competitive employment market. It also gives you the chance to network with other professionals.

Profession experience might provide you a helpful understanding of the work if you're undecided of the area of biology you want to pursue.

You can qualify for a scholarship or bursary to help pay for your year-long industrial placement if your biology degree program includes one.

Therefore, There are many different job paths you might choose with this degree, but biology is a prerequisite for careers in the science and health sectors.

To learn more about Biology, refer to the link:

https://brainly.com/question/28405832

#SPJ1

7. You perform a karyotype on a human cell and find that it has 23 chromosomes. Is this a somatic cell or
gamete? How do you know?

Answers

Gamete. Gametes contain half the number of chromosomes somatic cells do. Somatic cells contain 46 chromosomes (23 pairs), whereas gametes contain 23 chromosomes.

For which of the following would a transmission electron microscope be the best type of microscope to use?Studying the structures of a live parameciumLooking at a thick piece of fruitSeeing animal tissue that is visible to the naked eyeViewing a cell's mitochondria in detail

Answers

Answer:

viewing a cells mithocondria in detail

Explanation:

A transmition electron microscope (TEM) is a microscope that can see up to two million times better than the naked eye, meaning the only right answer would be D "Viewing a cell's mitochondria in detail"

Answer:

D - viewing the cells mithocondria in detail

Explanation:

microscopes zoom in and give u a clearer pictrure

Please choose the correct definition of a line flower.

Answers

The correct definition of a line flower is option 2 - it refers to a floral design technique where flowers are arranged in a linear or sequential manner, creating a continuous line or pattern.

In floral design, a line flower is not a specific type of flower, but rather a technique used to create a specific arrangement style. Option 2 accurately describes this technique, where flowers are arranged in a linear or sequential fashion.

This technique aims to create a continuous line or pattern using the flowers. By arranging the flowers in a specific order, designers can achieve a visually appealing and dynamic composition. The other options (1, 3, and 4) describe different aspects of flowers or decorative elements but do not accurately define a line flower in the context of floral design.

Learn more about line flower here:

https://brainly.com/question/32820579

#SPJ11

The complete question is:

Please choose the correct definition of a line flower.

1. A line flower refers to a type of flower that grows in a straight or linear pattern, often characterized by elongated petals or sepals arranged in a single row along the stem.

2. A line flower is a term used in floral design to describe a specific technique where flowers are arranged in a linear or sequential manner, creating a continuous line or pattern.

3. A line flower is a botanical term that refers to a species of flowering plant with a long, slender stem and minimal branching, resulting in a tall, straight growth habit.

4. A line flower is a decorative artificial flower used in various crafts and arrangements, typically made from a thin wire or string shaped into a linear form and adorned with fabric or paper petals.

what is the major source of increased muscle mass for plantaris muscles from both legs? why did the right leg also increase in mass during these 2 months?

Answers

The age of the experimental rats was a substantial contributor to the increased muscle mass in the plantaris muscles from both legs. The muscles grew since they were still so young.

Part of the poster superficial compartment of the calf, the plantaris is a tiny muscle that runs along the back of the leg. The plantaris muscle, which is frequently seen as an accessory, vestigial muscle, is absent from only 7–20% of limbs.

The plantaris functions to plantar flex the knee joint and ankle joint sporadically. The central nervous system may receive proprioceptive feedback information about the location of the foot from the plantaris muscle.

To learn more about muscle mass

https://brainly.com/question/13205097

#SPJ4

What are some impacts of climate change on terrestrial ecosystems?

Answers

Answer:

Climate change can overwhelm the capacity of ecosystems to mitigate extreme events and disturbance, such as wildfires, floods, and drought.

-TheUnknownScientist

What is meant by the description "antiparallel" regarding the two strands that make up the DNA double helix?
(A) The double helix structure of DNA creates nonparallel strands.
(B) The 5' to 3' direction of one strand runs counter to the 5' to 3' direction of the other strand.
(C) Base pairings create unequal spacing between the two DNA strands.
(D) One strand contains only purines and the other contains only pyrimidines.

Answers

The meant by the description "antiparallel" regarding the two strands that make up the DNA double helix , the 5' to 3' direction of one strand runs counter to the 5' to 3' direction of the other strand

Chromosomal DNA would be composed of two DNA polymers that together form a double helix, which is a three-dimensional (3D) structure. When the DNA strands are antiparallel, which means the 3' and 5' ends of each DNA strand are parallel to one another.

Two strands of something like the DNA molecule are joined through hydrogen bonds.

Hence, the correct answer will be option (B)

To learn more about antiparallel , here

https://brainly.com/question/12540255

#SPJ4

Explain how sex-linked, codominant and incomplete dominant traits are passed on to offspring.

Answers

Sex-linked traits are genes carried on the sex chromosomes, the X and the Y chromosome. Only males carry the Y chromosome, and therefore all genes on the Y chromosome are passed down to the son. Women carry two X chromosomes; therefore, sex-linked traits can be passed on from both the mother and the father.

Examples of sex-linked traits include red-green colour blindness and haemophilia.

In codominance, both alleles are expressed in the phenotype of heterozygous offspring. The human ABO blood group is an example of codominance.

There are three alleles for the ABO gene: IA, IB, and I (i is recessive to both IA and IB). If an individual is heterozygous for both the IA and IB alleles, they will express both A and B antigens on their red blood cells. If they are homozygous for either IA or IB, they will express only one antigen on their red blood cells.

Incomplete dominance occurs when neither allele is dominant nor recessive, but instead, the phenotype is a blend of both. An example of incomplete dominance is the snapdragon flower, which has a red flower and a white flower. When the red flower is crossed with the white flower, the resulting offspring have pink flowers, which is a blend of red and white. The genotype for pink flowers is Rr, where R represents the red allele, and r represents the white allele.

When two pink flowers are crossed, their offspring will have a ratio of 1:2:1 of red, pink, and white flowers.

For more such answers on sex chromosomes

https://brainly.com/question/13125598

#SPJ8

10.
________are organisms that get their energy by_______
other organisms. These organisms are also called______

Answers

I believe heterotrophs are organisms that get their energy by eating other organisms. These organisms are also called predators

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a change to a g result in a change in gene expression?

Answers

No, a change to a G would not result in a change in gene expression as the underlined C is a non-coding nucleotide and does not have any effect on gene expression.

Non-coding DNA corresponds to the portion of an organism's genome that does not code for amino acids, the building blocks of proteins. Some noncoding DNA sequences are known to play functional roles such as regulation of gene expression, whereas other regions of noncoding DNA have no known function. Other regions of non-coding DNA are important for protein assembly. By altering one of these regions, a variant (also known as a mutation) in the noncoding DNA can turn on the gene, causing the protein to be produced in the wrong place or at the wrong time. There are two types of SNPs in the coding region.Synonymous and non-synonymous SNPs. Synonymous SNPs do not affect the protein sequence, whereas non-synonymous SNPs change the amino acid sequence of the protein.

To know more about Non-coding DNA visit:

https://brainly.com/question/28360970?referrer=searchResults

#SPJ4

The major evolutionary episode corresponding most closely in time with the formation of Pangaea was the a. Pleistocene ice ages. b. Cambrian explosion c. Cretaceous extinctions. d. Permian extinctions

Answers

The major evolutionary episode corresponding most closely in time with the formation of Pangaea was  d. Permian extinctions.

In general , the major evolutionary event correlative with most closely in time occurs while the formation of Pangaea was the Permian extinction. This episode took place at around 250 million years ago. On the other hand the Pleistocene ice ages took place at much later, around 2.6 million to 11,700 years ago. Hence , Permian mass extinction in the oceans was caused by global warming that made animals unable to breathe.

Permian extinction, also known as the Permian-Triassic extinction or end-Permian extinction, which is a series of extinction process that is noted as the greatest mass extinction in Earth's history.

To learn more about Permian extinction , here

brainly.com/question/4290693

#SPJ4

Which of the following organelles packages proteins and other materials from the endoplasmic reticulum for storage in the cell or transport out of the cell?
Golgi apparatus
cell membrane
mitochondrion
cytoplasm

Answers

The Golgi apparatus

Make the model molecules for the reactants of photosynthesis by arranging your model atoms into groups that represent each molecule. Draw a picture (or take and attach a photo) of what you have made in the space labeled "Reactants" below Step 3.

Answers

The reactants of photosynthesis are carbon dioxide and water with sunlight as an energy source, The model is shown in the attached picture.

What are reactants?

Reactants are substances that combine together and undergo chemical changes in order to form new substances called products.

Plants and other living things employ a process called photosynthesis to transform light energy into chemical energy that can then be released through cellular respiration to power the organism's activities.

The reactants in photosynthesis are carbon dioxide and water which combine to form glucose and oxygen.

Learn more about reactants in photosynthesis at: https://brainly.com/question/12519864

#SPJ1

Make the model molecules for the reactants of photosynthesis by arranging your model atoms into groups

Identify the organelle *
1 point
-Large Subunit
Small Subunit
Ribosome
O Mitochondria
O Nucleus
O Chloroplast

Identify the organelle *1 point-Large SubunitSmall SubunitRibosomeO MitochondriaO NucleusO Chloroplast

Answers

Answer:

mitochondria pretty sure if not super sorry

A coastal area that once supported a thriving fishing industry is overfished. The number of species found living in the marine ecosystem continues to decrease. Which of these activities is most likely to increase the natural biodiversity in the area

Answers

Answer:

The answer is "Building artificial reefs and limiting fishing activity".

Explanation:

A variety of different methods could be used to construct an artificial island, which is most habitats are built to create a coral through using raw parts, and farming is the farming company, both "the creation of artificial reefs and restriction of fisheries" the activities are used to control environmental ecosystems throughout the region.

Answer:

Building artificial reefs and increasing fish activity

Explanation:

Read the following claim.

The energy animals need to survive was once energy from the sun.

What evidence from the article supports this claim? Think about energy pyramids, then explain how the evidence from the article supports this claim.

Answers

Answer: The energy from the sun is the only source of energy which has the ability to sustain life on earth.

The energy pyramid states that the transfer of energy is unidirectional and it flows from the producers to the consumers.

There are different trophic levels at which the organism are found say herbivores, carnivores and top predators.

All of the organism are dependent on the producers for their source of energy.

hence, the sunlight helps autotrophs to make food and herbivores feed on them and then the carnivores animals feed on herbivores and then the top predators feed on the carnivores animals.

So, ultimate source of energy on earth is sun, which directly or indirectly provides energy to the producers and other animals.

By the end of the triassic _____________________ overwhelmed ecosystems worldwide.

Answers

By the end of the Triassic dinosaurs overwhelmed ecosystems worldwide.

What is Triassic era?

There was a lot of change throughout the Triassic Period.

The variety and domination of life on Earth underwent significant changes throughout this period, which was bounded by extinctions. As a result, several well-known animal groupings that would later govern the world for millions of years first appeared.

Reptiles that resembled mammals, like Lystrosaurus, ruled the early Triassic.

We still don't completely understand what led to the Permian-Triassic extinction disaster. There have been various possibilities put out, including an unidentified asteroid impact, large-scale volcanic eruptions in what is now Siberia, the release of methane from the ocean's depths, sea level change, rising aridity, or a combination of several of these.

To know more about dinosaurs:

https://brainly.com/question/26251005

#SPJ4

usain bolt, a world champion sprinter, can run a 10-meter split in 0.82 seconds. say you obtain a quadriceps muscle sample from usain bolt and compare it to one from a 25-year-old male long-distance runner. what differences do you expect to observe between those two muscle samples? select all that apply.

Answers

A quadriceps muscle sample from Usain Bolt and compared it to one from a 25-year-old male long-distance runner, and it is seen that there are more fast-twitch fibers and red and white muscle fibers of larger cross-sectional area in Usain Bolt's leg muscles.

What is the distinction between fast-twitch and slow-twitch muscles?

Athletes who run fast, such as sprinters, have more fast-twitch muscle, which is called "white muscle," as they need more energy for a short period of time, and as a result, the muscles anaerobically respire. The slow twitch muscle, called "red muscle," is more commonly seen in the long distance runner, such as in the marathon, and these runners need a continuous supply of energy for a long time, so aerobically the muscle respires.

Hence, a quadriceps muscle sample from Usain Bolt was compared to one from a 25-year-old male long-distance runner, and it was seen that there are more fast-twitch muscle fibers and red and white muscle fibers with a larger cross-sectional area in Usain Bolt's leg muscles.

Learn more about the fast-twitch and slow-twitch muscles here.

https://brainly.com/question/1232212

#SPJ6

The question is incomplete; the complete question is below.

usain bolt, a world champion sprinter, can run a 10-meter split in 0.82 seconds. say you obtain a quadriceps muscle sample from usain bolt and compare it to one from a 25-year-old male long-distance runner. what differences do you expect to observe between those two muscle samples? select all that apply.

more fast-twitch fibers in Usain Bolt's leg muscles

more mitochondria in Usain Bolt's leg muscles

red and white muscle fibers of larger cross-sectional area in Usain Bolt's leg muscles

What is the element with the highest electronegativity value?
What is the element with the highest electronegativity value?
A)calcium
B)cesium
C)fluorine
D)helium

Answers

The element with the highest electronegativity value is fluorine.

                         

                       Electronegativity is a measure of the ability of an atom to attract electrons towards itself in a chemical bond. It is expressed on a scale from 0 to 4, with fluorine having the highest electronegativity value of 4.0. This means that fluorine has the strongest ability to attract electrons towards itself in a bond compared to any other element. In contrast, helium has a very low electronegativity value of 0.0, indicating that it has a very weak ability to attract electrons. Calcium and cesium have electronegativity values of 1.0 and 0.79, respectively, which are significantly lower than that of fluorine.

To learn more about electronegativity:

https://brainly.com/question/17762711

#SPJ11

List the cell organelles involved in energy generation for the cell.

Answers

Answer:

Mitochondria are tiny organelles inside cells that are involved in releasing energy from food. This process is known as cellular respiration. It is for this reason that mitochondria are often referred to as the powerhouses of the cell.

Son las mitocondrias redes interconectadas en vez de organelos independientes

Answers

Answer:

no

Explanation:

extravasation of immune cells depends on choose one: a. antibody production by b cells. b. increased permeability of endothelial cell junctions. c. down regulation of selectin proteins on endothelial cells. d. increased vasoconstriction.

Answers

Extravasation of immune cells depends on to choose one:  increased vasoconstriction.

The smallest unit which could stay on its own and that makes up all dwelling organisms and the tissues of the frame. Mobile has 3 main components: the cellular membrane, the nucleus, and the cytoplasm. The mobile membrane surrounds the cellular and controls the materials that go into and out of the mobile. A cell has 3 fundamental parts: the mobile membrane, the nucleus, and the cytoplasm. The cellular membrane surrounds the cell and controls the substances that pass into and out of the mobile. The nucleus is a structure within the mobile that contains the nucleolus and most of the cell's DNA. it's also wherein maximum RNA is made.

Cells offer structure and function for all residing things, from microorganisms to people. Scientists recollect them the smallest form of existence. Cells house the organic equipment that makes the proteins, chemical compounds, and indicators answerable for the whole lot that occurs interior our bodies.

Learn more about  Cells here:

https://brainly.com/question/13123319

#SPJ4

self-propagation and refractory periods (states) are typical of _____.
A) action potentials
B) graded hyperpolarizations
C) excitatory postsynaptic
potentials
D) threshold potentials
E) resting potentials

Answers

Self-propagation and refractory periods are typical of action potentials. Action potentials are brief electrical impulses that travel down the axon of a neuron, triggering the release of neurotransmitters at the synapse.

Self-propagation refers to the ability of an action potential to regenerate itself as it moves down the axon, ensuring that the signal remains strong and consistent. Refractory periods are short periods of time during which a neuron is unable to generate another action potential, ensuring that signals do not overlap and interfere with one another. Graded hyperpolarizations, excitatory postsynaptic potentials, threshold potentials, and resting potentials are all different types of electrical signals that contribute to the generation and modulation of action potentials.


Self-propagation and refractory periods (states) are typical of action potentials (A). Action potentials are electrical signals generated by neurons, allowing them to communicate with other cells. Self-propagation refers to the ability of an action potential to maintain its strength as it travels along the neuron, while the refractory period is a temporary state during which a neuron is unable to generate another action potential. This ensures proper signal transmission and prevents the action potential from moving backward along the neuron.

To know about Action potential visit:

https://brainly.com/question/30634467

#SPJ11

A probe with the sequence 5-A-T-G-C-C-A-G-T-3' will serve as a probe for which sequence? *notice DNA directionality* a 3'-T-G-S-C-C-G-T-A-5' b 3-A-T-G-C-C-A-G-T-5' c 3'-T-A-C-G-G-T-C-A-5' d 3'-A-C-T-G-G-C-A-T-3'

Answers

The probe with the sequence 5-A-T-G-C-C-A-G-T-3' will serve as a probe for the sequence 3-A-T-G-C-C-A-G-T-5'. This is because DNA is directional and the directionality of the probe sequence matches that of the complementary sequence.

In DNA, the two strands run in opposite directions, with one strand running in the 5' to 3' direction and the other running in the 3' to 5' direction. When using a probe, we want it to hybridize or bind to its complementary sequence. In this case, the probe sequence is running in the 5' to 3' direction, so we need to find the complementary sequence that is running in the 3' to 5' direction. The only sequence listed that is complementary to the probe and runs in the 3' to 5' direction is 3-A-T-G-C-C-A-G-T-5'. Therefore, the correct answer is option b.

Learn more about DNA here:-

https://brainly.com/question/32072734

#SPJ11

What is the only evidence we can get from a star?

Answers

Answer:

Stars are born within the clouds of dust and scattered throughout most galaxies. A familiar example of such as a dust cloud is the Orion Nebula. Turbulence deep within these clouds gives rise to knots with sufficient mass that the gas and dust can begin to collapse under its own gravitational attraction.

Explanation:

When it was dark these stars would light up the sky giving people light . In addition stars are very important because they make life on Earth. the most important is the Sun, because without that it wouldn't be life on Earth . Earth would just be a rock with ice.

PLEASE MARK ME AS BRAINLIEST!

what is the most common cause of hypoparathyroidism? 1. pituitary hyposecretion 2. parathyroid adenoma 3. parathyroid gland injury 4. hypothalamic inactivity

Answers

This is the most well-known reason for hypoparathyroidism. It creates after inadvertent harm to or expulsion of the parathyroid organs during a medical procedure. The correct answer is (3).

During thyroid or neck surgery, injury to the parathyroid glands is the most common cause of hypoparathyroidism. It could also be brought on by any one of the following: Common autoimmune attack on the parathyroid glands and Very low blood magnesium level (reversible) The condition is frequently discovered during other medical blood tests. The most common cause of hyperparathyroidism, or overactive parathyroid glands, is parathyroid adenomas, which raise blood calcium levels. Any one of the following symptoms may occur: Confusion.

DiGeorge syndrome, a chromosomal genetic condition, is the most common genetic cause. Parathyroid glands are absent from DiGeorge syndrome infants. People with DiGeorge syndrome suffer from chronic hypoparathyroidism because their bodies are unable to produce parathyroid hormone.

To learn more about hypoparathyroidism here

https://brainly.com/question/2563424

#SPJ4

Other Questions
20. write two short letters that reflect what you have learned about how the civil war affected the lives of civilians and soldiers. write one letter from a union or confederate soldier to a civilian family member. write the other letter from a civilian family member in the north or the south to a soldier. in each letter, include at least three details that indicate what life was like for each letter writer. please help its for a test please Your transponder is inoperative. In order to enter class b airspace, you must submit a request for a deviation from the Find the ratio of the lengths of corresponding sides for the similar triangles.smaller/larger = Consider the function represented by the table.For which x is f(x)=3?7445 * Azucenainicioun clubde aficionados ala Musica popula de su pas. El primerda ella era la nicasocia. A partirese dice se unio al club unclub un miembromas queanterior. Al cabode10 das Cuantosmiembros haba enclub? Philippe Pinel became famous for demanding that the mentally ill be treated with kindness, personally unlocking the chains of inmates in France. Use the graph to answer the questions for the questions SHARKS' TEETHLangston CarterThe day we found the sharks' teeth was foggy and cool. Moisture hung in the air so thick you could almost see it sparkling in the dim sunlight. There were days, early in the summer like this one, where it seemed there was more water in the air than in the bay. We had beached the boat and stepped out on the recently cleared spit of land. The ground had a light dusting of white sand over an under layer of dried black mud. It looked like a recently frosted chocolate cake, though the frosting was spread a bit thin for my taste. The ground was solid, but we knew from experience that it was full of fiddler crab holes, and would be underwater at the first super-high tide. Mysteriously, to us anyway, someone wanted to build a house there.We often came to these spots to look for artifacts. Our beach, our summer home, had been a fishing camp for as long as anyone living could remember. The oldest stories told of travelers coming down to the edge of the sea, lining up to fill their wagon beds with salted fish to take back home. Old decaying cabins still lined the beach. Rotting nets, hung out to dry in the last century, decorated their weathered walls. Their broken faces spun stories in our minds. The fishermen who, tanned and wrinkled from sun and salt, hauled their nets full of splashing mullet in to cheers from the waiting crowds. The bounty of the sea lightened everyone's hearts, and the smell of roasting fish filled the damp air. Women fanned themselves from wagon seats. Children splashed in the shallow edges of the bay. It was a scene we had acted out as youngsters, building an imaginary bridge to a life we would never fully know.Read this line from the text:The day we found the sharks' teeth was foggy and cool.What does this line imply about the narrator? (5 points)Group of answer choicesThe narrator has had other adventures with this group.The narrator has seen many foggy cold days.The narrator often finds sharks' teeth.The narrator is very focused on weather conditions. a 2x4 line decoder with enable is implemented using nand gate only. how many nand gate is needed to construct this line decoder? Which is an example of income? a. utilities b. tuition c. financial aid d. rent five adaptive features of guava fruite I will give brainliest!!!!If you arranged the scale of our Solar System on a piece of 100-foot-long string, with the Sun at the beginning, how far away would Earth be from the Sun?Choose 1 answer:(Choice A)A1 ft 1 in(Choice B)B2 ft 0 in(Choice C)C10 ft 5 in(Choice D)D60 ft 3 in Story: "A Cooking Revolution: How Clean Energy and Cookstoves Are Saving Lives"Read these paragraphs from the excerpt.Cooking: it's a simple act that has brought families around the world together for thousands and thousands of years.As a chef, I can think of few things more beautiful than that. However, I also know how deadly such a simple act can be , not only to our health, but to our environment.Why does the author place these paragraphs first in his argument? In the text, you read this about ranching after the Civil War: Ranchers employed cowhands to tend their cattle and drive herds to market. These hard workers rode alongside the huge herds in good and bad weather. They kept the cattle moving and rounded up strays. After the Civil War, veterans of the Confederate Army made up the majority of the cowhands who worked in Texas. However, it is estimated that nearly one in three cowhands was either Mexican American or African American. Some cowhands dreamed of setting aside enough money to start a herd of their own. Use the passage to answer the question. Why might recent events have led to many African Americans working for ranchers On a piece of paper, use a protractor to construct a triangle with angle measures of 60 and 80Which statements about this triangle are true?Select all correct answers.All sides have different lengths.The third angle measures 100The third angle measures 40.It is an acute triangle.Two sides have the same lengthIt is an obtuse triangle In How Soon Hath Time, Miltonspeculates that people may consider him a full-grown adult, due to his semblance, or O outward appearance. O inner poise. O professional endeavors. O inner duplicity. When does population increase the fastest for the Gompertz equation :P(t)=0.7ln(P(t)(4500)/P(t))?P=Round to the nearest whole number. As a person cycling increases speed, the rate of calorie burned, distance traveled, and energy expended also increase. Which of the following is the independent variable?Please explain why you chose this answer to better understand. a. Calories b. Energy c. Distance d. Speed Your financial advisor, who has a phd in economics, is warning you that you should sell your long-term government bonds because the rising inflation and falling private consumption indicate that there will be a loss of investor confidence in government bonds. this will decrease their price and you will lose a lot of money. why is this an example of rational persuasion? you are a project manager for a large manufacturing company. an internal project has been formally approved and you are in the process of identifying key stakeholders. where would be the best place to start?