Please help me.
Do you think it would be more difficult to use medicine to get rid of a virus using the Lytic cycle or a virus using the Lysogenic cycle? Justify your answer.

Answers

Answer 1

It would be more difficult to use medicine to get rid of a virus using the Lysogenic cycle than the lytic cycle.

What is a Lysogenic cycle?

The lysogenic cycle involves the incorporation of the viral genome into the host cell genome, infecting it from within and is more dangerous and harmful.

Lytic cycle on the other hand involves the reproduction of viruses using a host cell to manufacture more viruses and the viruses then burst out of the cell which could be managed.

Read more about Virus here https://brainly.com/question/25236237

#SPJ1


Related Questions

A community is

all the organisms living in an area that have the potential to interact

all the individuals of a species that can potentially interact

all the animal species that can potentially interact with all the plant species in an area

all the organisms and abiotic components of an area that have the potential to interact

A place filled with people that will assist in raising your child...and bully them, peer-pressure them, etc.

Answers

Answer:

all the organisms living in an area that have the potential to interact

Explanation:

All the organisms in a living area


Sponges are some of the simplest animals on Earth. Why do they fit the definition of animals? Why are sponges
different from plants or fungi?

Answers

Answer:

cause the sponge eat phytoplankton and zooplankton.

Explanation:

The zooplankton count as an animal, a plant can't eat an animal that's why the sponge count as an animal.

Which of these is NOT a similarity that whales share with land animals?
1. Some have legs to walk
2.Blowhole like a
nose
3.Feed their baby milk

Answers

Whales being aquatic, is considered as mammal. They have blowhole that resembles to nose of mammals and they also feed their babies like mammals.

What is the characteristics of a mammal?

Mammals are warm blooded animals that gives birth to young ones. They have advanced reproduction and prenatal care for their babies.

The mammals have following characteristics:

Presence of hair or fur.They have sweat glands.These have mammary gland that produces milk.These have four chambered heart.These have more complex brain.

As whale have mammary glands, they gives birth to young ones and feed milk to their babies, so, these are included under mammals.

Thus, the correct option is 1.

For more details regarding mammals, visit:

https://brainly.com/question/15326492

Eukaryotic cells and prokaryotic cells have some parts that are different. Which of the following would you find only in a eukaryotic cell?
A. membrane-bound organelles and a nucleus
B. a nucleus and organelles without membranes
C. a cell membrane and organelles without membranes
D. membrane-bound organelles and DNA in cytoplasm

Answers

Answer:

A

Explanation:

Answer:

A

Explanation:

Within a eukaryotic cell, each membrane-bound structure carries out specific cellular functions. Here is an overview of many of the primary components of eukaryotic cells.

Nucleus, Nucleolus, Plasma membrane, Cytoskeleton or cell wall, Ribosomes, Mitochondria, Cytoplasm, Cytosol, Endoplasmic reticulum, Vesicles and vacuoles.

List the 7 levels of classification from largest to smallest.
A. Kingdom, Phylum, Order, Class, Family, Genus, Species

B. Kingdom, Phylum, Order, Family, Class, Genus, Species

C. Phylum, Kingdom, Order, Family, Class, Genus, Species

D. Kingdom, Phylum, Class, Order, Family, Genus, Species

Answers

Answer:

List the 7 levels of classification from largest to smallest.

D. Kingdom, Phylum, Class, Order, Family, Genus, Species

Answer:

D. Kingdom, Phylum, Class, Order, Family, Genus, Species

Explanation:

These are the 7 levels of classification from largest to smallest.

1. What is likely to be caused by a diet low in both fat and fibre?
A. Constipation and obesity
B. Constipation only
C. Neither constipation nor obesity
D. Obesity only​

Answers

Answer:

A. Constipation and obesity I think

Which of the following are examples of natural discharge areas for underground water?
Select one:
a. Lakes and shallow wells
b. Lakes and swamps
c. Pumped wells and streams
d. Shallow wells and swamps

Answers

Answer:lakes and swamps

Explanation:any thing that is not man made

Examples of natural discharge areas for underground water are lakes and swamps. The correct option is b.

What is underground water?

Groundwater is defined as any water that seeps underground. A riverbed where the water does not soak the soil sufficiently to appear above the surface of the riverbed is an example of this.

More rain would cause enough water to flow down the river to make it appear as a river or stream. The hydrosphere is the total amount of water that exists on the planet's surface. This includes water in any area on Earth, as well as the atmosphere and surface, the subterranean, and even the air.

Lakes and ponds are open-water ecosystems that exist beyond the boundaries of swamp or emergent vegetation.

Therefore, the correct option is b. Lakes and swamps.

To learn more about underground water, refer to the link:

https://brainly.com/question/6284267

#SPJ2

facilitated diffusion requires multiple choice enzymes. carrier proteins. lipid carriers. carbohydrate carriers. lipid or carbohydrate carriers.

Answers

The correct answer is "carrier proteins." Facilitated diffusion is a passive transport process that allows the movement of specific molecules across a cell membrane, from an area of higher concentration to an area of lower concentration, with the help of carrier proteins.

These carrier proteins act as transporters, facilitating the movement of certain molecules that cannot easily pass through the lipid bilayer of the cell membrane.

Carrier proteins undergo conformational changes to bind with the specific molecule being transported and then release it on the other side of the membrane. These proteins are selective and can transport specific molecules or groups of molecules, such as ions, sugars, or amino acids.

Lipid carriers and carbohydrate carriers are not terms commonly associated with facilitated diffusion. Lipid carriers typically refer to lipoproteins that transport lipids in the bloodstream. Carbohydrate carriers are not a recognized term in the context of facilitated diffusion.

Therefore, facilitated diffusion relies on carrier proteins to enable the transport of specific molecules across the cell membrane. These proteins play a crucial role in facilitating the movement of substances that would otherwise face difficulty crossing the membrane through simple diffusion.

For more such answers on carrier proteins

https://brainly.com/question/889175

#SPJ8

Final answer:

Facilitated diffusion is a process wherein substances move down their concentration gradient aided by carrier proteins in the cell membrane.

Explanation:

Facilitated diffusion is a process in which substances move down their concentration gradient with the help of carrier proteins embedded in the cell membrane.

These carrier proteins are more selective than channel proteins and allow specific molecules to cross. They do not require ATP to work and can transport small, uncharged organic molecules like glucose.

Learn more about facilitated diffusion here:

https://brainly.com/question/32884792

#SPJ11

Please I need help with this

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

A chemical equation is shown below. Which substance below is NOT a product in this equation?

Answers

Answer:

you didnt give us the equation

Explanation:

Because this trait is ____________ , unaffected individual ____________ , who is not genetically related to the other family members, is not likely to be a carrier for this trait.

Answers

Because this trait is recessive, unaffected individual X, who is not genetically related to the other family members, is not likely to be a carrier for this trait.

Recessive traits are only expressed when an individual has two copies of the recessive allele. If an individual has one copy of the recessive allele and one copy of the dominant allele, they will be unaffected by the trait, but they will be a carrier.

In order for an individual to be a carrier for a recessive trait, they must have inherited the recessive allele from one of their parents.

If an individual is not genetically related to the other family members, then they are not likely to have inherited the recessive allele from any of them. As a result, they are not likely to be a carrier for the trait.

In the case of individual X, they are not genetically related to the other family members. Therefore, they are not likely to be a carrier for the recessive trait.

To know more about recessive trait, refer here:

https://brainly.com/question/17447924#

#SPJ11

Can someone help? 40 points <3

Can someone help? 40 points &lt;3

Answers

Answer:

Please see following

Explanation:

Step 1: glycolysis

cuts glucose in half to create pyruvate

makes 2 atp

step 2:

If oxygen is available, then process: cellular respiration

occurs in the: mitochondria

is oxygen is not available, then: process- fermentation

which does not use oxygen so: anaerobic

occurs in the: cytoplasm

occurs in yeast cells products: alcohol

occurs in muscle cells: lactic acid

hope this helps!

A compound that prevents the separation of the homologous chromosomes in anaphase I is being studied. Which of the following questions can be best answered during this study based on Figure 5-3?
A) Will the cells produced at the end of meiosis still be genetically identical to each other in the presence of this compound?
B) Will the long-term development of the individual be affected by this meiotic error?
C) When do the centrosomes start to move apart during meiosis I as compared to meiosis II?
D) Is there a pattern to the movement of homologous chromosomes in the presence of this compound?

Answers

Is there a pattern to the movement of homologous chromosomes in the presence of this compound? is the correct Answer(Option D)

The information that determines every protein that makes up an organism, including details about when, which cells each protein should be formed in, and how much of each protein should be produced, is carried by genes, which serve as DNA's most crucial role.

We examine how genes are normally organized on each chromosome in this section. Eucaryotes have chromosomes that make up their genomes.

We also explain the specific DNA sequences that enable correct chromosome duplication and transmission from one generation to the next. We also face the significant problem of DNA packing. If the DNA in one human cell were to be stretched end to end, it would measure about 2 meters.

To know more about Cell division:

https://brainly.com/question/15028999

#SPJ4


Temperature and precipitation are two important factors that determine_____
and characterize different biomes by also affecting the organisms
that live there.
1)communities
2)adaptations
3)rainfall
4)climate

Answers

Answer:

Rainfall

Explanation:

I took this quiz and passed it

choose five word roots related to a part of the body. add different prefixes and/or suffixes to the word root to create at least three different terms for each body part.

Answers

Body parts and their word roots.

The human body is composed of several parts that serve various functions.

In the medical field, many words are used to describe different body parts, which can help one to understand various conditions and diseases.

Below are some of the common word roots related to parts of the body.

1. Crani- (skull) Craniology, Craniometry, Cranioscopy

2. Cardio- (heart) Cardiology, Cardiovascular, Cardiothoracic

3. Derma- (skin) Dermatology, Dermatosis, Dermatomyositis

4. Gastro- (stomach) Gastroscopy, Gastroenterology, Gastroesophageal

5. Osteo- (bone) Osteomyelitis, Osteoporosis, Osteomalacia

Body parts and their prefixes and/or suffixes:

Prefixes are letters added to the beginning of a word root to change its meaning. For instance, pre- is a prefix that means before, as in prehistoric.

Suffixes are letters added to the end of a word root to change its meaning. For example, -tion is a suffix that turns the verb into a noun, as in action.

1. Crani- (skull) Decraniated, Hypercrania, Craniocerebral

2. Cardio- (heart) Cardioverter, Cardioversion, Cardiomegaly

3. Derma- (skin) Dermatopathy, Dermatologist, Dermatogenic

4. Gastro- (stomach) Gastritis, Gastroscopy, Gastrology

5. Osteo- (bone) Osteocyte, Osteoblast, Osteopathy

Note that the word roots are listed first, and different prefixes and suffixes are used to create the other terms.

Learn more about Word roots:

https://brainly.com/question/13854956

#SPJ11

charles darwin studied the relationship between the adrenal medulla and emotions. which chemical, produced in the adrenal medulla, causes the fight or flight response? oxytocin dopamine serotonin epinephrine

Answers

The chemical produced in the adrenal medulla that causes the fight or flight response is epinephrine. Epinephrine is also known as adrenaline.

Epinephrine is a hormone and neurotransmitter that is released by the body when a person is stressed or in a dangerous situation. It is responsible for triggering the body’s natural "fight or flight" response. The release of epinephrine increases the heart rate, increases blood pressure, and decreases blood flow to the skin and gut. It also increases the body’s supply of oxygen and glucose, allowing muscles to work harder and faster. In addition, epinephrine causes the pupils of the eyes to dilate, allowing more light to enter. This helps the body to better assess its environment. Charles Darwin studied the relationship between the adrenal medulla and emotions and identified epinephrine as the chemical responsible for the fight-or-flight response.

Learn more about epinephrine: https://brainly.com/question/29307133

#SPJ11

In contrast to bioremediation, which is a strategy for _____, biological augmentation _____ a degraded ecosystem. see concept 55.5 (page)

Answers

In contrast to bioremediation, which is a strategy for removing harmful substances, biological augmentation uses organisms to add essential materials to a degraded ecosystem.

What is bioremediation?

The process in which living organisms like bacteria and other microorganisms are used for the decontamination of an area affected by contaminants is called bioremediation.

It removes various kinds of toxins and pollutants from water bodies, soil, and other kinds of environments. It is very commonly used for the removal of pollutants from the groundwater that has been contaminated.

Therefore, bioremediation is a strategy for removing harmful substances and biological augmentation uses organisms to add essential materials to a degraded ecosystem.

Read more about bioremediation, here

https://brainly.com/question/14353375

#SPJ4

Look at the data below. From the graph, calculate the % increase in the untrained person's heart rate after 10 minutes of exercise (to the nearest ten percent).

Answers

There is a 140% increase

Explanation:According to the key, the untrained person's heart rate is represented by a red line. Heart rate at beginning of exercise period = 66 bpm and at the end = 158 bpm.  % increase = difference / original × 100. 158 – 66 / 66 × 100 = 139.39, expressed to the nearest 10 % = 140

Unlike sound, light waves do not need a ◄)) medium (matter) liquid atmosphere gas PHAY B D) in which to travel through​

Answers

Light waves do not need a medium in which to travel through​ from one place to another because light is an electromagnetic waves.

What is electromagnetic wave?

Electromagnetic waves are those waves that requires no medium for their propagation. It is differ from mechanical waves because they do not require a medium to propagate.

So we can conclude that Light waves do not need a medium in which to travel through​ from one place to another because light is an electromagnetic waves.

Learn more about wave here: https://brainly.com/question/15663649

#SPJ1

what is the function of DNA and RNA

Answers

Answer: DNA codes for our genotype, which is the genetic representation of out traits. There are multiple kinds of RNA but it is mostly used to aid the replication of DNA.

Explanation: DNA is the strand of nucleic acid, sugars and phosphate group, that is found in the nucleus and mitochondria of every cell. It codes for our genotype, which is essentially the written representation of our traits. There are multiple kinds of RNA but they are mostly used to replicate DNA, they are single stranded as opposed to the double stranded DNA and include the nitrogen base uracil (U), instead of thymine (T). mRNA, tRNA and dsRNA are commonly used to replicate and regulate the DNA sequence.

Answer:

The two main types of nucleic acids are DNA and RNA. Both DNA and RNA are made from nucleotides, each containing a five-carbon sugar backbone, a phosphate group, and a nitrogen base. DNA provides the code for the cell 's activities, while RNA converts that code into proteins to carry out cellular functions.

Explanation:

RNA:

The central dogma of molecular biology suggests that the primary role of RNA is to convert the information stored in DNA into proteins.

DNA:

The main role of DNA in the cell is the long-term storage of information. It is often compared to a blueprint, since it contains the instructions to construct other components of the cell, such as proteins and RNA molecules.

I HOPE IT HELPED

what can you say about the structure of each of their cell walls as a result of their staining?

Answers

The structure of a cell wall can be determined by staining it with different dyes. Different dyes will bind to different components of the cell wall, and the resulting color can reveal information about the structure of the cell wall.

Gram-positive bacteria have a thick peptidoglycan layer in their cell walls. When stained with crystal violet and iodine, the peptidoglycan layer will retain the dye, resulting in a purple color.

Gram-negative bacteria have a thinner peptidoglycan layer and an outer membrane containing lipopolysaccharides. When stained with crystal violet and iodine, the thinner peptidoglycan layer will not retain the dye, and the outer membrane will not be affected. The result is that the cell appears pink or red.

In summary, the staining of cell walls with crystal violet and iodine can be used to differentiate between Gram-positive and Gram-negative bacteria. Gram-positive bacteria will appear purple, while Gram-negative bacteria will appear pink or red.

Learn more about cell walls here: https://brainly.com/question/965751

#SPJ4

Which of the following describes advantages of geothermal power?

1. Plants require some electricity to operate.

II. Its use reduces greenhouse gases.

III. It uses local sources of energy.

Oll only

O III only

O II and III

O I, II, and III

Answers

The following describes advantages of geothermal power are C. II Its use reduces greenhouse gases, and III It uses local sources of energy.

Geothermal power plants do require some electricity to operate, but the amount needed is minimal compared to the amount of energy produced. The use of geothermal power can help to reduce the reliance on fossil fuels and the associated emissions, making it a more sustainable option.

Additionally, geothermal energy is a local resource that can be harnessed in areas with suitable geological conditions, reducing the need for long-distance energy transmission and the associated costs. Overall, the use of geothermal power offers a reliable and renewable source of energy that has the potential to contribute to a more sustainable energy system. So therefore the correct answer is C. II and III, the advantages of geothermal power include reducing greenhouse gas emissions and using local sources of energy.

Learn more about geothermal power plants at:

https://brainly.com/question/27442707

#SPJ11

a student is collecting the gas given all from a plan and write something like at the temperature of 27° the gas being collected is probably
A. oxygen
B.carbon dioxide
C.ATP.
D.glucode

Answers

The gas being collected is probably oxygen. Thus, option A. is correct.

What is oxygen?

Oxygen is gas, which is colorless, odorless, and tasteless, but essential for living organisms. Organisms take oxygen and convert into carbon dioxide. As source of carbon this carbon dioxide is taken up by plants and releases oxygen into the atmosphere.

Swedish chemist, Carl Wilhelm Scheele, discovered oxygen in 1772 by heating potassium nitrate, mercuric oxide, and many other substances. It is highly reacting non metal and oxidizing agent.

Liquid oxygen is cryogenic in nature. It has boling point of  –297°F (–183°C). when at room temperature it acts as gas, Therefore  student collecting gas is oxygen.

Learn more about oxygen, here:

https://brainly.com/question/13905823

#SPJ1

How are the nucleotides in dna different from those found in rna?.

Answers

The structural difference between nucleotides rests in two instances: A DNA nucleotide contains deoxyribose sugar, whereas an RNA contains the sugar ribose in every nucleotide. ... Unlike DNA, RNA contains a uracil nitrogenous base instead of thymine.

Suppose a flower had normal expression of genes A and C and expression of gene B in all four whorls. Based on the ABC hypothesis, what would be the structure of that flower, starting at the outermost whorl?

a. carpel-petal-petal-carpel

b. petal-petal-stamen-stamen

c. sepal-carpel-carpel-sepal

d. sepal-sepal-carpel-carpel

Answers

The correct structure of the flower would be sepal-carpel-carpel-sepal. Option (C) is correct.

Based on the ABC hypothesis, the structure of the flower would be option c. sepal-carpel-carpel-sepal, starting from the outermost whorl.

This is because according to the ABC hypothesis, genes A, B, and C control the development of floral organs.

In this scenario, gene A is responsible for sepal development, gene B is responsible for petal development, and gene C is responsible for stamen development.

Since gene A and gene C are expressed normally, we can conclude that the outermost whorl will consist of sepals.

Following the order of gene expression, the next two whorls will consist of carpels, and the innermost whorl will consist of carpels as well.

Therefore, the correct structure of the flower would be sepal-carpel-carpel-sepal.

To know more about carpel visit :

https://brainly.com/question/30421225

#SPJ11

type of food . type of enzyme
fats .
carbohydrates .
proteins .

Answers

Proteins-proteases
Carbohydrates- amylase
Fats-bile

ASAP PLEASE!

Stomata are tiny openings found in plant leaves. Specialized cells known as guard cells surround the stomata and open and close the openings. When it is very hot, plants may close their stomata to prevent water loss. When plants close their stomata, what else is affected?
Group of answer choices

Plants cannot take in water from the air.

Plants cannot release glucose made in photosynthesis.

Plants cannot take in the carbon dioxide they need for photosynthesis.

Plants cannot take in the sunlight they need for photosynthesis.

Answers

Answer:

Plants cannot take in the carbon dioxide they need for photosynthesis.

i did the same exact question (As you can see) and it even says correct. theres the proof.

ASAP PLEASE!Stomata are tiny openings found in plant leaves. Specialized cells known as guard cells surround

place the following in the order in which they occur when hiv infects a macrophage and immediately begins to produce new viruses rather than remain dormant.

Answers

1.attachment to host cell 2. penetration 3. synthesis of viral components

4. assembly of new viruses 5. release of new viruses from host cell

define host cell ?

The alien creature is provided with both refuge and nourishment. Two organisms are considered to be in a symbiotic relationship when they live together and have a tight and long-term biological interaction. This symbiotic interaction can take many forms. Depending on the extent to which the foreign organism or guest is dependent, the connection between host and visitor might be:

Parasitic: A connection between a host cell and a parasite or a guest cell in which the parasite or guest cell benefits at the expense of the host cell. Parasites require a host in order to survive.

Mutualistic: A connection in which the host cell and the visitor cell survive without damaging one another.

Commensalism: A relationship in which both the host cell and the visitor profit from each other.

1.attachment to host cell 2. penetration 3. synthesis of viral components

4. assembly of new viruses 5. release of new viruses from host cell

To learn more about host cell follow the given link: https://brainly.com/question/29212401

#SPJ4

Name the two types of cells in which the HIV multiplies after gaining entry into the human body.

Answers

Answer:

Macrophages and Helper T-lymphocytes.

Explanation:

Hope this helped, Have a Great Day!!

Which example is a specific question that could be used to start a scientific investigation?

A. Do long droughts increase the likelihood of forest fires

B. Should there be more services to prevent forest fires

C. Are forest fires as frightening as mudslides

D. What is the most devastating effect of a forest fire

Answers

Answer:

A specific question that could be used to start a scientific investigation is A. Do long droughts increase the likelihood of forest fires. This question can be tested and answered through scientific methods and data collection.

Other Questions
I need to compare Greek gods to celebrities! Help Zeus, Herms , Aphrodite, Apollo, Athena and fast this is due in an hour Anyone know the answer ? Carol needs to divide 6 pounds of grain into 3/4-pound bags. How many 3/4-pound bags can Carol fill? 3 O6 O 8 can you help me on this i neeed help Why do do we eat? QERneed long answers Into what two categories do Perelmanand Olbrechts-Tyteca divide the starting points of argumentation?What specific sources of agreement are planed under eachheading? Select the correct answer from each drop-down menu.Jupiters strength of gravity is greater than Earths strength of gravity.A persons will be the same on Jupiter and Earth. A persons will be greater on Jupiter than on Earth.Reset Next solve the equation exactly on 0 lessgreater than t less greater than 2phi public schools immigrant children learn English and were taught about American history and culture a process known as ? Which represents the solution up above ^^^^^^^^^^ Just like pirates cherished their earrings and Vikings dyed their hair, samurai demonstrated theirdedication to the code and to their lifestyle in some unique ways. Describe some of these. * The sum of the first 5 terms of the geometric sequence given that a1 = 5 and r = 2 use either of these formulas State the slope and y-intercept of the graph of y=25x+2 quizlrt There are two types of incentive based environmental policies Group of answer choices market-based systems and technology standards. technology standards and emissions standards. taxes/subsidy programs and technology standards. market-based systems and taxes/subsidy programs Understanding that cellulose is NOT digestible by humans, examine the structures of digestible starch and glycogen and make a prediction if you think agarose (the gel-like substance used in Petri dishes and electrophoresis) is or is not digestible. Write an essay about your favorite holiday spot and the reasons for it. What is the slope-intercept form of the function described by this table? x 1 2 3 4 y 8 13 18 23 Enter your answer by filling in the boxes. y = x + Find the distance between the two points. 16.) (-4,2), (5,1) what is the circumference if the diameter is 21in and pi is 22/7 Consider the enlargement of the trapezoid. A smaller trapezoid with top side length of 2 centimeters and bottom side length of 3. 25 centimeters. A large trapezoid with top side length of x centimeters and bottom side length of 6. 5 centimeters. Which of the proportions is correctly set up to find the missing dimension of the enlarged trapezoid?StartFraction 2 over x EndFraction = StartFraction 6. 5 over 3. 25 EndFractionStartFraction 2 over 3. 25 EndFraction = StartFraction x over 6. 5 EndFractionStartFraction 2 over 3. 25 EndFraction = StartFraction 6. 25 over x EndFractionStartFraction x over 6. 5 EndFraction = StartFraction 3. 25 over 2 EndFraction