PLEASE HELP WILL MARK BRAINLIEST PLEASE NO LINKS OR I WILL REPORT YOU
Why is an element considered a pure substance? PLEASE MAKE THE ANSWER SCHOOL APPROPRIATE

Answers

Answer 1
an element is a pure substance as it cannot be broken down or transformed into a new substance even by using some physical or chemical means because elements are mostly metal!!!
Answer 2

Answer:

An element is a pure substance as it cannot be broken down or transformed into a new substance even by using some physical or chemical means. Elements are mostly metals, non-metals, or metalloids. Compounds, on the other hand, are also pure substances when two or more elements are combined chemically in a fixed ratio.

HOPE IT HELPS, PLS BE SAFE! :)


Related Questions

norovirus and hepatitis a are directly related to contamination from

Answers

Norovirus and hepatitis A are directly related to contamination from fecal matter.

Both viruses are highly contagious and can be transmitted through the fecal-oral route, which means that they can be spread when people ingest food or water contaminated with fecal matter containing the virus. This can occur through improper hygiene practices, such as not washing hands after using the bathroom, or through consumption of contaminated food or water. Contaminated surfaces, objects, or aerosols can also spread the viruses, which is why they can cause outbreaks in places with large groups of people, such as nursing homes, schools, and cruise ships. Therefore, it is important to practice good hygiene, such as washing hands frequently, properly cooking food, and avoiding close contact with individuals who may be infected, to prevent the spread of these viruses.

To know more about hepatitis A

brainly.com/question/13061804

#SPJ4

If there are different numbers of nucleoli in the cells you examined, what could be the reason?

Answers

Answer:

The reason there are different numbers of nucleoli in the cells is that the nucleus in the cell is the primary cell structure responsible for making the DNA, and protein synthesis.

Explanation:

how does the body maintain a constant partial pressure of oxygen in the arteries even as exercise intensity increases?

Answers

During exercise, the body needs more oxygen to meet the increased demand of the muscles.

To maintain a constant partial pressure of oxygen in the arteries, the body employs a few mechanisms:
1. Increased breathing rate: During exercise, the respiratory rate and depth of breathing increase. This allows more oxygen to be taken in and delivered to the lungs for oxygenation.
2. Increased heart rate: The heart pumps blood faster during exercise, which means that oxygen-rich blood is delivered to the tissues more quickly.
3. Vasodilation: The arteries supplying the muscles dilate during exercise. This widening of the blood vessels allows for increased blood flow, delivering more oxygen to the muscles.
4. Red blood cell production: With regular exercise, the body adapts by producing more red blood cells. Red blood cells carry oxygen, so an increase in their numbers enhances the oxygen-carrying capacity of the blood.
By combining these mechanisms, the body ensures that a constant partial pressure of oxygen is maintained in the arteries, even as exercise intensity increases. These adaptations support the increased oxygen demand of the muscles and promote optimal functioning during physical activity.

To know more about arteries visit:

https://brainly.com/question/33378057

#SPJ11

what is the predicted size of the corresponding mature mrna in base pairs (bp), excluding the 5' cap and 3' poly-a tail?

Answers

Predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5' cap and 3' poly-a tail is 295 bp.

1000 base long mRNA, this means that its double-stranded version will be 500 bp long. Messenger RNA or mRNA is a type of single-stranded RNA involved in protein synthesis.

mRNA is type of RNA that is important for protein production. In human cells, mRNA uses the information in genes to create a copy for making proteins. Many mRNA vaccines helps to protect humans from various disease like recently scientist have developed covid vaccine using mRNA .

To learn more about mRNA,  here

brainly.com/question/12903143

#SPJ4

How do gametes differ from other cells in the body?.

Answers

Answer:

How they are different is Somatic cells are any form of a biological cell, other than a reproductive cell.

I Need Help From Science
Why do temperatures in the mesosphere decreases as altitude increases?

Answers

Answer:

due to decreasing absorption of solar radiation by the rarefied atmosphere and increasing cooling by CO2 radiative emission.

Explanation:

Within the mesosphere, temperature decreases with increasing height, due to decreasing absorption of solar radiation by the rarefied atmosphere and increasing cooling by CO2 radiative emission.

Select the best explanation for why protease enzymes are secreted in inactive forms. Inactive enzymes will simply be expelled with the feces if no protein is present in the digesting food, this will help to conserve energy. The enzymes would digest each other if they were not properly regulated. The immunoglobulins protecting the digestive tract would be digested without proper regulation of protein digesting enzymes. The cells producing inactive enzymes are themselves protected from the enzymes until they are safely within the lumen of the GI tract. Milk sugars would be chemically digested by Amylase from both the mouth and pancreas and by the brush border enzyme lactase Amylase from both the mouth and pancreas and by the brush border enzyme sucrase amylase from both the mouth and pancreas and by the brush border enzyme maltase O HCl from the stomach and the brush border enzyme carboxypeptidase and The effects of sympathetic nerve impulses on the alimentary canal are parasympathetic impulses are inhibitory, or slow down activity; stimulative, or causes increases of activity. not known; integrative stimulative, or cause increases of activity; inhibitory, or slows down activity varied with most of the activity being inhibitory; inhibitory all the time

Answers

The correct option for the statement "why protease enzymes are secreted in inactive forms. " is D) the cells producing inactive enzymes are themselves protected from the enzymes until they are safely within the lumen of the GI tract.

The correct answer for the statement " Milk sugars would be chemically digested by" is B) Amylase from both the mouth and pancreas and by the brush border enzyme sucrase.

The right response for the statement "The effects of sympathetic nerve impulses on the alimentary canal are parasympathetic impulses are" is A)  inhibitory, or slow down activity; stimulative, or causes increases of activity.

1) The best explanation for why protease enzymes are secreted in inactive forms is to prevent self-digestion of the cells producing the enzymes until they are safely within the lumen of the GI tract. The correct option is D.

2) Milk sugars, also known as lactose, would be chemically digested by the brush border enzyme lactase, which breaks down lactose into glucose and galactose. Amylase from both the mouth and pancreas is responsible for breaking down carbohydrates, but not specifically lactose. HCl from the stomach and the brush border enzyme carboxypeptidase are involved in the digestion of proteins, not sugars. The correct option is B.

3) The effects of sympathetic nerve impulses on the alimentary canal are inhibitory, or slow down activity, while the effects of parasympathetic impulses are stimulative, or cause increases in activity. The correct answer is A.

Therefore, the correct answers for statements 1, 2, and 3 are options D,B, and A respectively.

For more such answers on enzymes

https://brainly.com/question/1596855

#SPJ11

Question

Select the best explanation for

1) why protease enzymes are secreted in inactive forms.

A) Inactive enzymes will simply be expelled with the feces if no protein is present in the digesting food, this will help to conserve energy.

B) The enzymes would digest each other if they were not properly regulated.

C) The immunoglobulins protecting the digestive tract would be digested without proper regulation of protein digesting enzymes.

D) The cells producing inactive enzymes are themselves protected from the enzymes until they are safely within the lumen of the GI tract.

2) Milk sugars would be chemically digested by

A) Amylase from both the mouth and pancreas and by the brush border enzyme lactase

B) Amylase from both the mouth and pancreas and by the brush border enzyme sucrase

C) amylase from both the mouth and pancreas and by the brush border enzyme maltase

D) HCl from the stomach and the brush border enzyme carboxypeptidase  

3) The effects of sympathetic nerve impulses on the alimentary canal are parasympathetic impulses are

A) inhibitory, or slow down activity; stimulative, or causes increases of activity.

B) not known; integrative

C) stimulative, or cause increases of activity; inhibitory, or slows down activity

D) varied with most of the activity being inhibitory; inhibitory all the time

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Answers

UACCGCUCCGCCGCUCGACAAUACC

trace a drop of blood from the left ventricle (top) to the right fingers (bottom

Answers

This journey involves passing through various blood vessels, including arteries, arterioles, capillaries, venules, and veins.

The journey begins in the left ventricle, which pumps oxygenated blood into the aorta, the largest artery in the body. From the aorta, the blood enters smaller arteries and continues to branch into arterioles. Arterioles then lead to capillaries, which are tiny blood vessels present in the tissues. At the capillary level, oxygen and nutrients are exchanged with the surrounding tissues.

After the capillaries, the blood enters venules, which merge to form larger veins. The blood travels through veins, gradually returning to the heart. Specifically, the blood from the upper body flows into the superior vena cava, while the blood from the lower body enters the inferior vena cava. Both the superior and inferior vena cava merge into the right atrium of the heart.

From the right atrium, the blood is pumped into the right ventricle and then expelled into the pulmonary artery, leading to the lungs for oxygenation. After oxygenation, the blood returns to the heart through the pulmonary veins, entering the left atrium and then the left ventricle.

Once the left ventricle contracts again, the blood is propelled back into the systemic circulation, where it eventually reaches the fingers by traveling through arteries, arterioles, capillaries, venules, and veins in the upper limbs.

In summary, the journey of a drop of blood from the left ventricle to the right fingers involves the systemic circulation, passing through various blood vessels and organs to deliver oxygen and nutrients to the tissues and return waste products to be eliminated from the body.

learn more about blood circulation here:

https://brainly.com/question/28915450

#SPJ11

In which location would fisherman most likely catch a greater number of fish?
at the shorline
O intertidal zone
O in an upwelling
O on the deep ocean floor

Answers

Answer:

On the deep ocean floor

Explanation:

This is because it is the lowest layer of the ocean where little or no light penetrate. In this floor, there are abundance of organic matter which the fish majorly feed and that is why they abundant there. The temperature in deep ocean floor is moderate and it's okay for their survival. The humidity also is moderate and that is why they live there.

in a large maternity hospital in copenhagen, there were 94,075 births. ten of the infants were achondroplastic dwarfs. achondroplasia is an autosomal dominant trait show virtually full penetrance. only two of the afflicted children had a dwarf parent. what is the mutation rate of the achondroplasia gene in this populations?

Answers

the mutation rate of the achondroplasia gene in this population is 8.50 × 10⁻⁵

It is Given that Achondroplasia is an autosomal dominant disorder,

The total births = 94075,

Dwarfism achondroplasia affects ten infants.

The parents of two infants are also dwarfs. As a result, they passed on this condition to them.

Dwarfism caused by achondroplasia is an autosomal dominant condition. Therefore, those who inherit them from their parents must also have dwarf parents; those who do not have dwarf parents are the result of an achondroplasia gene mutation.

Infants having achondroplasia because of mutation = 10 - 2 = 8

8 infants have the achondroplasia gene mutation.

mutation rate = Infants with gene mutation / Total Infants

mutation rate  = 8 / 94075 = 0.0000850 = 8.50 × 10-5

Know more about mutation rate here: https://brainly.com/question/29423701

#SPJ4

__________ is the protein that bonds to form the fibrous component of a blood clot.

Answers

The protein that bonds to form the fibrous component of a blood clot is fibrin. Blood clotting is a necessary process that is used to stop bleeding after an injury.

It can help to prevent excessive blood loss and promote wound healing. However, if blood clots form in blood vessels where they are not needed, they can cause serious medical problems like heart attacks, stroke, and deep vein thrombosis. When you get a wound or an injury that breaks the blood vessels, several things happen in your body. First, the platelets in your blood form a temporary plug to stop the bleeding. Then, a protein called fibrin forms a mesh over the platelets and the damaged blood vessels. The fibrin mesh forms a stable blood clot, which helps to prevent further blood loss and promote healing.

Learn more about fibrin

https://brainly.com/question/28544778

#SPJ11

A student constructs a model using a fan and a pile of sand shaped like a dune. The student turns on the fan, observes the model for changes, and lists several conclusions in a chart.
1. Wind cannot erode landforms.
2. Wind can reduce the surface heights of landforms
3. Wind cannot transport materials
4. Wind cannot weather materials.

Answers

Answer: Im sorry i dont kno

Explanation:

Based on the observations of the sand dune model with a fan, the conclusions provided in the chart are incorrect. In reality, each statement's opposite is true.

What is Sand dune?

A sand dune formed by wind or water flow is known as a sand dune. When there is a lot of loose sand present and the wind or water is powerful enough to shift the sand grains, sand dunes emerge. Beaches, deserts, and some riverbeds all contain sand dunes.

Based on the observations in the provided example, the following inferences are correct:

Landforms can be eroded by wind.Sand can be moved by wind and dumped elsewhere, altering the size and shape of landforms.Sand and other materials are transported from one location to another by wind, which is a significant agent of sediment transport.Materials can weather and degrade in the wind through abrasion and deflation.

Therefore, the conclusions given in the chart are false based on the observations of the sand dune model.

Learn more about Sand dune, here:

https://brainly.com/question/2456718

#SPJ3

I NEED HELP SO BADLY!!

I NEED HELP SO BADLY!!

Answers

The most likely effect will be, mullet populations would increase, but trout and drum populations would decrease, option B is correct.

Dead zones can cause a decrease in the oxygen levels of the water, which can lead to fish kills and the displacement of fish to areas with more oxygen. Mullet are known to be more tolerant of low-oxygen environments than speckled trout and red drum. Therefore, mullet populations may increase in dead zones due to reduced competition for resources from the other fish.

However, the decreased oxygen levels in dead zones are likely to have negative effects on the populations of speckled trout and red drum, which are more sensitive to low-oxygen environments. These fish may experience reduced growth rates, reproductive success, and overall survival, leading to a decrease in their populations, option B is correct.

To learn more about mullet follow the link:

https://brainly.com/question/14017087

#SPJ1

The complete question is:

Speckled trout and red drum both prey on mullet along the Texas coastline. Dead zones are caused by excessive nutrient pollution, along with other factors that deplete the oxygen from the water. What likely effect would increasing dead zones have on the populations of speckled trout, red drum, and mullet?

A. All three populations would increase.

B. Mullet populations would increase, but trout and drum populations would decrease.

C. Mullet populations would decrease, but trout and drum populations would increase.

D. All three populations would decrease.

Think about a time when you had to alter a belief or understanding you held in your life. It doesn’t have to relate to science. What was that belief and what evidence caused you to alter it?

Answers

Have you had a drastic changes in belief or a small one before?

Answer:

I used to think that seasons were caused by Earth getting closer to and farther from the Sun. My science teacher pointed out that when it’s summer in North America, it’s winter in the Southern Hemisphere. So, I realized that seasons are not caused by Earth’s closeness to the Sun.

Explanation:

PLATO answer

For what reasons did many researchers assume that protein was the genetic material?

Answers

Many researchers assumed that protein was the genetic material because at the time, proteins were known to have greater structural complexity and variability than nucleic acids.

Proteins were thought to have more functional diversity and were thought to be better suited for carrying and transmitting genetic information. However, further research revealed that nucleic acids, specifically DNA, were the true carriers of genetic information. This was demonstrated through experiments such as the Hershey-Chase experiment, which showed that DNA, not protein, was responsible for transmitting genetic information in viruses.

Many researchers assumed that protein was the genetic material for several reasons:

1. Complexity: Proteins are composed of 20 different amino acids, while DNA is composed of only 4 nucleotide bases. Due to this higher complexity, researchers believed proteins could store more genetic information than DNA.

2. Structural variety: Proteins have diverse structures and functions, making them appear as suitable candidates for carrying genetic information. DNA, on the other hand, has a more uniform structure.

3. Early discoveries: Initial research on cellular components focused on proteins and their importance in cell function, leading scientists to believe that proteins were the genetic material.

In summary, researchers assumed that proteins were the genetic material due to their complexity, structural variety, and prominence in early scientific discoveries. However, further research, including experiments by Avery, MacLeod, and McCarty, as well as the Hershey-Chase experiment, eventually proved that DNA is the genetic material responsible for inheritance and the transmission of genetic information.

Learn more about protein here,

https://brainly.com/question/29413322

#SPJ11

the term ""neural correlates of consciousness"" refers most accurately to the

Answers

The term "neural correlates of consciousness" refers most accurately to the specific brain processes and structures that are associated with conscious experience. In other words, it describes the relationship between the physical aspects of the brain and the subjective experiences of consciousness.



To study the neural correlates of consciousness, researchers often investigate the differences between conscious and unconscious brain activity. They might use neuroimaging techniques, such as functional magnetic resonance imaging (fMRI) or electroencephalography (EEG), to measure brain activity during various conscious and unconscious states, like wakefulness, sleep, or anesthesia.

By comparing the patterns of neural activity across these different states, researchers can identify the areas of the brain and the neural networks that are most closely associated with conscious experience. This helps us understand the biological basis of consciousness and may lead to insights into the nature of consciousness itself.

To know more about brain click here

brainly.com/question/11950231

#SPJ11

In the sympathetic nervous system, preganglionic neurons excite postganglionic neurons through NACHRs to produce an ionotropic response However, the postganglionic neurons also contain metabotropic acetylcholine receptors (M1, Gq- coupled), and activation of these receptors provides a slow EPSP that slightly depolarizes the resting potential. The slow EPSP also makes overlapping NACHR-based EPSPs twice as big. What is the likely molecular mechanism for this slow metabotropic EPSP, how does it change the passive properties of the postganglionic neuron? How would this change in passive properties lead to doubling of the nACHR-based EPSP? Let's say you want to block the effect of the slow metabotropic EPSP on nAChR-based EPSPs, but you can't block the M1 or nАChRs. What pharmacologic strategies could you use to manipulate the passive properties of the post- ganglionic neuron? You can assume the presence of any other types of ion channels and synapses on the post-ganglionic neuron that you want, as long as you can explain how you manipulating those specific channels or synapses would counteract the in terms of passive electrical properties.

Answers

Activation of metabotropic acetylcholine receptors enhances nAChR-based EPSPs by depolarizing and changing the passive properties of postganglionic neurons.

The slow metabotropic EPSP is likely produced by the activation of M1 acetylcholine receptors that couple to Gq proteins, leading to the activation of phospholipase C and the production of second messengers that modulate ion channels.

This slow depolarization increases the input resistance and time constant of the postganglionic neuron, making it more excitable and sensitive to synaptic inputs.

The doubling of the nAChR-based EPSP is due to the summation of the slow EPSP with the fast ionotropic response mediated by NACHRs.

To block the effect of the slow metabotropic EPSP, one could use drugs that modulate the activity of other ion channels, such as potassium channels or voltage-gated calcium channels, that counteract the depolarizing effect of the slow EPSP.

Alternatively, one could use drugs that selectively inhibit the activation of Gq proteins or downstream effectors of the M1 receptor, without affecting the nAChRs.

For more such questions on acetylcholine, click on:

https://brainly.com/question/27960161

#SPJ11

The likely molecular mechanism for the slow metabotropic EPSP is the activation of Gq-coupled M1 receptors, which leads to the activation of phospholipase C (PLC) and subsequent production of inositol triphosphate (IP3) and diacylglycerol (DAG). IP3 triggers the release of calcium from intracellular stores, leading to the activation of calcium-dependent non-selective cation channels and subsequent depolarization of the membrane potential.

DAG also activates protein kinase C (PKC), which can modulate the activity of various ion channels, including nAChRs.

The slow EPSP changes the passive properties of the postganglionic neuron by depolarizing the resting membrane potential and reducing the input resistance, which allows more current to flow through the membrane for a given stimulus. This change in passive properties makes the overlapping nAChR-based EPSPs twice as big because more current can flow through the membrane and activate more nAChRs.

To block the effect of the slow metabotropic EPSP on nAChR-based EPSPs without blocking the M1 or nAChRs, one pharmacologic strategy could be to manipulate the activity of voltage-gated ion channels, such as potassium channels. For example, opening of potassium channels would hyperpolarize the membrane potential and increase the input resistance, which would reduce the amplitude of the slow EPSP and decrease the flow of current through the membrane, thereby reducing the overlap between the slow EPSP and the nAChR-based EPSPs.

To know more about membrane  ,

https://brainly.com/question/32084334

#SPJ11

What's the difference between inference and observation? Give examples of each.

Answers

Answer:

A inference is a conclusion reached on the basis of evidence and reasoning.

A observation is an act or instance of regarding attentively or watching

Explanation:

Example for a inference would be - lets say you notice someone isnt acting like theirself you may infer that their not having a good day or their not in a mood

Observation example- when your doing a lab for science you may observe the different types of utensils or the effects of the object you use like oh this is blue or something

Identify which type of reaction the feature occurs in.
light-dependent reactions
light-independent reactions

Answers

Answer:

light dependent reaction occurs in grana produces ATP, release oxygen and produce glucose. while light independent reactions occur in stroma, fixes carbon dioxide. Explanation: Photosynthesis is a process that converts light energy into chemical energy in a multi protein complex called a photo system.

How many types of gametes will be produced by individuals of AABbcc genotype?
(a) Two
(b) Four
(c) Six
(d) Nine

Answers

There are four types of gametes that will be produced by individuals of AABbcc genotype. The two possible combinations for A are AA and Aa, the two possible combinations for B are BB and Bb, and the two possible combinations for c are cc and c. This gives us a total of 2 x 2 x 2 = 4 different gametes.


Identify the different possible alleles for each gene in the AABbcc genotype. In this case, the alleles for A are AA and Aa, the alleles for B are BB and Bb, and the alleles for c are cc and c.Multiply the different possibilities for each gene. In this case, it is 2 x 2 x 2 = 4 different gametes.

There are four types of gametes that will be produced by individuals of AABbcc genotype because there are two possible combinations for each gene, which when multiplied together gives us four different gametes.

To know more about gametes refer to-

brainly.com/question/29882202#
#SPJ11

True or False water particles are not actually water molecules
True or false

Answers

True because the water molecules are only present in condensation processes and within droplets of water.

each chromosome originally is made of how many DNA molecules and how does this molecule appear in the chromosome

Answers

Answer:

each chromosome is composed of one coiled DNA double helix molecule, which is called a chromatid. At the end of this stage, each chromosome has two identical DNA double helix molecules, and therefore is composed of two sister chromatids

One chromosome is composed of two chromatids, each of which is a DNA molecule. Each DNA molecule is made up of two helixes. So each chromosome has two DNA molecules.

What are chromosomes?

A chromosome is a long DNA molecule that contains some or all of an organism's genetic material.

Most eukaryotic chromosomes contain packaging proteins called histones, which bind to and condense the DNA molecule to maintain its integrity.

A chromosome is made up of two chromatids, each of which contains a DNA molecule. Each DNA molecule consists of two helixes. As a result, each chromosome has two DNA molecules.

The primary function of chromosomes is to transport DNA and genetic information from parents to offspring.

During cell division, chromosomes play an important role. They keep DNA from becoming tangled and damaged.

Thus, there are two DNA molecule each in a chromatid.

For more details regarding chromosomes, visit:

https://brainly.com/question/1596925

#SPJ2

In tomatoes, red fruit (r) is dominant over yellow fruit (r). A plant that is homozygous for red fruit is crossed with a plant that has yellow fruit. What would be the genotypes and phenotypes of the f1 generation?.

Answers

Answer: genotype: All Rr

Phenotypes: all red

Explanation:

Define Phenotype and Genotype in simple term

Answers

Answer:

phenotyp : is the outward appearance of the organis

genotype: is the genetic make up of organism

A large number of________
and the pacific yew tree. *
come from plants, such as willow tree bark

Answers

Yew is a tree. People use the bark, branch tips, and needles to make medicine. Despite serious safety concerns, yew is used for treating diphtheria, tapeworms, swollen tonsils (tonsillitis), seizures (epilepsy), muscle and joint pain (rheumatism), urinary tract conditions, and liver conditions. I don’t know if that’s what your asking or not, but have a good day :)

Which of the following images shows a chemical change occurring?

water condensation
© akchamczuk / iStock 2018
crushing a can
© gbrundin / iStock 2018
stretching an elastic
© emregologlu / iStock 2018
old rusted boat
Public Domain

Answers

Answer: Old rusted boat or stretching an elastic. If your good at math can you please help me and provide an explanation. Olivia has read 40 pages of a 70 page book, 60 pages of an 85 page book and 43 of a 65 page book. What is the percentage of pages Olivia has not read?

Explanation:

Briefly describe the function of polymerase chain reaction (PCR)

Answers

Polymerase chain reaction, or PCR, is a technique to make many copies of a specific DNA region in vitro (in a test tube rather than an organism). PCR relies on a thermostable DNA polymerase, Taq polymerase, and requires DNA primers designed specifically for the DNA region of interest.

what factors are responsible for increasing the size of a population?

Answers

Answer:

Economic development

Explanation:

There are several factors that can contribute to the growth of a population. These include:

1. Natural increase: This refers to the difference between the number of births and the number of deaths in a population. If the number of births is greater than the number of deaths, the population will grow.
2. Immigration: If people move into a population from other areas, it can contribute to population growth.
3. High fertility rates: A high fertility rate, or the average number of children a woman has during her reproductive years, can also contribute to population growth.
4. Increased life expectancy: If people are living longer due to advances in medicine and public health, the population will grow.
5. Changes in social norms: Changes in social norms, such as the acceptance of smaller families, can also impact population growth.

It's worth noting that population growth is not always a positive thing, as it can put strain on resources and the environment. Some countries have implemented policies to encourage smaller families and slow population growth.

Pls award brainliest!

A CD4 count that is below which amount classifies an infected person as having AIDS?
A 200 cells per mm3
B 800 cells per mm3
C 400 cells per mm3
D 600 cells per mm3

Answers

Answer:

A. 200 cells per mm3

Explanation:

Answer:

I hope this helps.

Explanation:

A CD4 count that is below which amount classifies an infected person as having AIDS?A 200 cells per mm3B
Other Questions
In the figure below, ABC ~ DEF. Which equation is correct? A. sin a= DE/DF B. sin c= DE/EF C. cos a= DE/DF D. cos c= DE/DF The vertices of ABC are A(-4,4), B(-2,4), and C(-3,2). If ABC is reflected across the y-axis to produce the image A'B'C', find the coordinate of the vertex A'. What did Trump and his insurrectionist mob teach the world? 1) Is air matter? Why or why not? find the two numbers having sum is 31 and product is 192 How does economic and social factors play a role in causing teenage pregnancy Why is it important to protect ourselves from cybercrime? Trivia Q2 10pts(2x)yx=2y=9 A) what do you think of the kind "evidence" that the red guards used to justify the search and destruction of the fourth aunt's apartment? b) do you think this is enough evidence? c) what does this tell you about these "defenders of the cultural revolution" and the cultural revolution itself? answer using 4-5 complete sentences. describe the importance of international capital structure. what risks can you identify when working with cash, credit and inventory management? provide your rationale and any supporting data. A:B = 6:7 and A=30. Find B.Please help me out with this, i dont know how to work it out, thank you. Apply the scientific method in answering the questions below. Use the template below in presenting your answers.I. ProblemII. Preliminary InformationIII. HypothesisIV. Facts about the ProblemV. Conclusion1. Why is ultraviolet radiation commonly used in sanitizing hospitals and operating rooms?2. Using the photon theory, explain how atomic spectra are formed.3. Give the contribution of Max Planck and Albert Einstein in the current understanding of the particle nature of light Please help me out ASAP Find the value of z.73ZZ =[? Which event occurred before Stephen F. Austin started a colony in Texas?Select one:a.Texas won its independence. b.Mexico declared independence. c.General Santa Anna was captured. d.The battle at the Alamo was fought. At the end of a birthday party there is 3/ of a cake left. The next day janelle eats 1/3 of the cake how much of the whole cookie cake did she eat combine like terms to create an equivalent expression 6(1/2 w - 3/4) The part of a business letter that is NOT a part of a personal letter is the _______.A. salutationB. headingC. conclusionD. inside address Chandra invests $75 every month at 4.8%/a compounded monthly for 8 years. What is the total amount ofChandra's investments after 8 years? How did Temperance Movement supportersview alcohol?