suppose a spring with spring constant is horizontal and has one end attached to a wall and the other end attached to a mass. suppose that the friction of the mass with the floor (i.e., the damping constant) is . set up a differential equation that describes this system. let to denote the displacement, in meters, of the mass from its equilibrium position, and give your answer in terms of . assume that positive displacement means the mass is farther from the wall than when the system is at equilibrium. help (equations) find the general solution to your differential equation from the previous part. use and to denote arbitrary constants. use for independent variable to represent the time elapsed in seconds. enter as c1 and as c2. your answer should be an equation of the form . help (equations) is this system under damped, over damped, or critically damped? ? enter a value for the damping constant that would make the system critically damped. help (numbers)

Answers

Answer 1

A value for the damping constant that would make the system critically damped

let x be the displacement of the spring.

Now,

Forcing function = 7sin(2t)

damping forces (acting in opposite direction) are spring force and frictional force

spring force = 8x

frictional force = 3*velocity = 3x' ----( as velocity is differential of x)

so net force on the block is [7sin(2t) - 8x - 3x']

also by newton's law, net force = m.a

and, a = x'' (acceleration is double derivative of displacement)

so by newton's law the net force on block is 3x''

so balancing gives,

7sin(2t) - 8x - 3x' = 3x''

hence position of clock 'x' is the solution of non-homogeneous equation

3x'' + 3x' + 8x = 7sin(2t)

with conditions that x(0) = x'(0) = 0 ... (velocity and position of block at t=0 is 0)

we will solve this by laplace transformation

taking L(x) = F(s)

take laplace of each terms

L(3x'') = 3s2F(s) .................. (as rest terms of 0)

L(3x') = 3sF(s) ......................(as rest terms are 0)

L(8x) = 8F(s)

and

L(7sin(2t)) = 7*2/(s2+4) = 14/(s2+4)

so writing LHS and RHS

[3s2 + 3s + 8].F(s) = 14/(s2+4)

or,

F(s) = 14/[(3s2 + 3s + 8)(s2+4)]

now take laplace inverse of RHS and what you will get is a particular solution xp

Learn more about displacement  https://brainly.com/question/11934397

#SPJ4


Related Questions

With specific reference to the case study, describe some of the soft skills needed at university and in the workplace

Answers

Answer:

Soft skills are personal qualities and attributes that are not related to specific knowledge or technical skills, but rather to the way a person interacts with others and approaches tasks and challenges. Some examples of common soft skills that may be important at university and in the workplace include:

Communication skills: The ability to express oneself clearly and effectively, both in written and oral form, is important at university and in the workplace. This includes being able to listen actively and understand others' perspectives, as well as being able to articulate one's own ideas and opinions.

Collaboration skills: The ability to work well with others is important in both educational and professional settings. This includes being able to contribute effectively to group projects and discussions, as well as being able to resolve conflicts and negotiate solutions with others.

Problem-solving skills: The ability to think critically and creatively, and to come up with effective solutions to problems, is important in both academic and professional contexts. This includes being able to identify and analyze problems, generate and evaluate potential solutions, and implement and follow through on the chosen solution.

Time management skills: The ability to manage one's time effectively is important in both academic and professional settings. This includes being able to prioritize tasks, set and meet deadlines, and manage workload effectively.

Interpersonal skills: The ability to build and maintain positive relationships with others is important in both educational and professional contexts. This includes being able to work well with a diverse range of people, being able to empathize with others, and being able to handle difficult situations and conflicts in a professional manner.

two expenditure heads included in total cost?​

Answers

The two expenditure heads included in total cost are fixed costs and variable costs.

Fixed costs are the expenses that remain constant regardless of the level of production or sales. These include costs like rent, salaries, insurance, and depreciation. Fixed costs do not change as the production level changes, providing stability and predictability in the overall cost structure.

Variable costs, on the other hand, are the expenses that vary directly with the level of production or sales. These include costs like raw materials, direct labor, and utilities. Variable costs change as the production level increases or decreases, making them more dynamic and responsive to changes in the business environment.

In conclusion, total cost consists of fixed costs and variable costs, which together provide a comprehensive view of the overall expenses associated with producing and selling a product or service.

Note: The question is incomplete. The complete question probably is: What are the two expenditure heads included in total cost?

Learn more about Fixed costs:

https://brainly.com/question/20670674

#SPJ11

Which needs to happen to the price indicated by p2 on the graph in order to achieve equilibrium? it needs to be increased. it needs to be decreased. it needs to reach the price ceiling. it needs to remain unchanged.

Answers

The rate suggested via the means of p2 on the graph to gain equilibrium needs to be decreased.

What is equilibrium?

Equilibrium is the nation wherein the marketplace delivers and calls for stability from each other, and as a result, costs grow to be stable.

Generally, an over-deliver of products or offerings causes costs to head down, which leads to better call for—while an under-deliver or scarcity of products causes costs to head up, resulting in much less call for.

The balancing impact of delivery and call for outcomes in a nation of equilibrium. The equilibrium rate is the rate at which the delivery of products fits the call for.

When a primary index studies a length of consolidation or sideways momentum, it could be stated that the forces of delivery and call for are tremendously the same and the marketplace is in a state of equilibrium.

So, from the above statement, it is clear that, it needs to be decreased, is the right answer.

Learn more about Equilibrium, refer to:

https://brainly.com/question/13458865

Answer:

b

Explanation:

can anybody help me please i will mark brainlyest

can anybody help me please i will mark brainlyest

Answers

Telephone, internal combustion engine,
and electrical light
Explanation:
telephone: it allowed for instant
communication, communication by voice,
and it paved the way for future inovations
in telephone technology.
engine: it was powered by gas and air,
which made it impractical for widespread
public use.
light: Electric lights allowed factories to stay
open longer and produce more goods.

PLS HELP ME I NEED THIS DONE TODAY!!! What does the audience focus on when an entire photograph is in focus? OA. OB. O c. O D. They focus only on the subject of the image. They review the entire image. They mainly focus on the foreground. They mainly focus on the background.​

Answers

The answer is C. They mainly focus on the foreground in photograph.

When an entire is in focus, the audience's focus is not solely limited to the subject of the image. Instead, they tend to review the entire image, taking in all the details and elements present. While the subject may still attract initial attention, viewers often explore the composition as a whole.Photographs that are in sharp focus throughout offer a balanced visual experience, allowing viewers to engage with the foreground, middle ground, and background equally. This encourages them to examine various elements and relationships within the frame. To improve decision making and creativity in teams, several strategies can be employed. First, fostering open and inclusive communication is essential. Encouraging team members to freely express their ideas, opinions, and concerns creates a collaborative environment where diverse perspectives can be considered.Secondly, establishing a clear decision-making process can streamline the team's efforts. Defining roles and responsibilities, setting goals and objectives, and outlining the steps to reach a decision can enhance efficiency and effectiveness.

Encouraging creative thinking and innovation is also crucial. Providing space for brainstorming sessions, idea generation, and exploration of different possibilities allows team members to think outside the box and come up with unique solutions.

for similar questions on photograph.

https://brainly.com/question/2888544

#SPJ8

The person being interviewed is known as:

A. potential employee
B. employee
C. job applicant
D. interviewee

Answers

Answer:

D

Explanation:

Virtue ethics places great focus on which of the following

Answers

Answer:

character i think.

Explanation:

the key reasons that an organization should adopt planning and strategic management are to:

Answers

Let understand that Strategic planning is the approach used to for process of documenting and establishing the direction of the organisation goals and objectives.

Strategic planning creates an organization vision, mission and priorities etc

Let understand that "Strategic management" refers to the overall process of strategic planning to implementation and executing of other plan.

The key reason for adopting these plan are:

Gives direction and momentum: The plans gives an organization direction on how to operate.Encouragement of new ideas: The plans helps to encourage new ideas because the business new to expand.Its gives Sustainable competitive advantage.

Learn more about this here

brainly.com/question/4564918

A congress is an official gathering, and people who attend as participants have formal status.


True

False

Answers

Answer:

Explanation:

false

In a small company's accounting department, the accounts receivable coordinator often takes the role of the ___.

Answers

Answer: B. credit and collection manager

Explanation:

In a small company, employees will typically have to act in more than one role but usually in roles that are related. As the Accounts Receivable coordinator, the closest role in the options would be that of Credit and Collection manager.

As Accounts receivable coordinator, the person is in charge of the accounts of those who owe the company so that there are no problems in payments, records or other errors and problems.

As Credit and Collection manager, their jobs will be similar as the credit and collection manager is in charge of evaluating potential debtors as well as following up on actual debtors to ensure that they pay what they owe the company.

Suppose after the semester ends, you take a trip to an Island of Vieques. Upon arriving at the island, you make a stop at one of the markets and notice that everyone is carrying around jars full of cowry shells. You also notice the person in line in front of you just paid for a twelve-pack old Milwaukee beer with 8 cowry shells. Someone else just bought a Whopper Pizza Combo for 6 cowry shells. Thinking back to your economics class (as painful as that may be), you would conclude that
a) this is a barter economy.
b) those cowry shells are serving as money.
c) cowry shells are valueless.
d) cowry shells soup is a delicacy.

Answers

A) this is a barter

Disadvantages of choosing a job that is extremely popular or in demand

Answers

The disadvantage of choosing a job that is very popular or a job that is in high demand is that after a while such a job may become saturated or it would become monotonous.

What is a high demand job?

This is the term that is used to refer to a job that the people that wpould employ labor are constantly in need of. Such a job is one that would require the people that have the qualification to opt in and get the places and the roles that they are to fill.

The issues that may arise from such a job that is in high demand is that after a period, such a job may have a lot of persons that would want to fulfil the role.

The number of qualified persons may become more than the job that is available for the people to do in the long run.

Hence this is a disadvantage. Therefore I would conclude by saying that the disadvantage of choosing a highly popular job is that the number of persons that are willing to fulfil the role may exceed the job overtime.

Read more on jobs here: https://brainly.com/question/26355886

#SPJ1

what type of federal funding is free money but is based on financial need only?

Answers

Answer:

Explanation:

Answer:

parks and recreation? brainliest?

Explanation:

which one of these is an example of a necessary debt

Answers

Answer:

An example of unnecessary debt is when you change your clothes and don't really need on a high-interest score. Thus option C is correct.

What is unnecessary debt?

An unnecessary debt can be caused by a variety of issues such as expensive life events, having children, or moving to a new house. It may also be due to poor money management. The debt is due to those things that are not needed and hence are unnecessary.

Explanation:

Type the correct answer in the box. Spell all words correctly.
Which good customer service skill does Tony seem to possess?
Tony works as a customer service professional for a store that sells refrigerators. He met a customer who was furious with the store's service.
Apparently, the store had delivered the wrong refrigerator model to the customer's home address. Tony apologized on behalf of the store. He
told the customer that the store would quickly replace the product. He Interacted with the customer for a while and promised that the store
would never give the customer a chance to complain in the future. Tony's ________
helped him make the customer believe
In the store's service.

Answers

Answer:

professional manner and reassurance

Under the LIFO retail method, we determine that:__________.
a) a new layer of inventory has been added during the period if the ending inventory at retail is greater than the beginning inventory at cost.
b) the ending inventory at retail is greater than the beginning inventory at retail.
c) the ending inventory at retail is less than the beginning inventory at retail.

Answers

Answer: the ending inventory at retail is greater than the beginning inventory at retail

Explanation:

In the Last-In-First-Out(LIFO) method, it is assumed that the units that are sold are the ones that were recently bought.

Under the LIFO retail method, to determine a new layer at retail, the beginning inventory at the retail will have to be deducted from the ending inventory at retail.

This means that a new layer of inventory will be added when the ending inventory at retail is greater than the beginning inventory at retail.

All of the following statements are true regarding negotiated municipal underwritings EXCEPT the:A initial offering price of each maturity must be disclosedB spread must be disclosedC participation amount of each underwriter must be disclosedD customer must be sent a copy of the Official Statement, if available

Answers

Answer:

D

Explanation:

customer must be sent a copy of the official statement, if available

Bruce loves his job. He is completely involved in his work and is highly committed to his company. Bruce is demonstrating ________________.

Group of answer choices

employee engagement

job specialization

job evaluation

a bona fide occupational qualification

self-mitigation

Answers

Bruce is demonstrating employee engagement. This term refers to an employee's level of involvement, commitment, and satisfaction with their job and the organization they work for.

Bruce's love for his job, high level of involvement, and commitment to his company all indicate a strong sense of employee engagement. Employee engagement is important for organizational success as it leads to increased productivity, better job performance, and higher job satisfaction.

To know more about job visit:

brainly.com/question/33408039

#SPJ11

Which of the following is a reason why managerial decision making is challenging? Managers must apply sophisticated analysis techniques, such as Porter's strategies, to make decisions. Managers need to analyze small amounts of data. Managers have more time than ever before in history to make decisions. Managers have access to limited amounts of information for making strategic decisions. Managers are best able to internalize information.

Answers

The reason why managerial decision making is challenging is that managers must apply sophisticated analysis techniques to make decisions, such as Porter's strategies, and they often have limited amounts of information available to them for making strategic decisions.

Additionally, decisions often involve trade-offs between multiple competing objectives, and managers must consider the potential risks and uncertainties associated with each option. Furthermore, managers are often under pressure to make decisions quickly, which can be further complicated by changing market conditions and other external factors.

Learn more about decision making  from

https://brainly.com/question/27004710

#SPJ11

Companies may use ________ and ________ to allow employees to have secure, rapid access to their compensation.

Answers

Companies may use electronic payroll systems and  direct deposit to allow employees to have secure, rapid access to their compensation.

Payroll is the strategy for paying representatives of a firm, to just put it. It involves gathering the rundown of representatives who need to paid, monitoring the hours worked, sorting out every worker's remuneration, speedily dispensing the installment, and checking Payroll costs. Programming that computerizes the finance cycle is known as a finance framework. These frameworks, which are utilized to follow representatives' functioning hours, figure compensations, process assessments and derivations, print pay slips, and so on, can be joined with leave and participation global positioning frameworks and worker self-administration gateways. Payroll is the complete of all advantages that a business should give to its workers to a foreordained time span or on a foreordained date.

Know more about Payrolls - https://brainly.com/question/30066465

#SPJ4

2.
Which of the following refers to the amount of money that a retailer makes after
accounting for expenses?

Answers

You did not type a problem so I cannot help.

Cost of goods sold is determined only at the end of the accounting period in.

Answers

The Cost of goods sold is known only at the end of the accounting period in the periodic inventory system.

What is an inventory System?

Inventory systems is one that has a periodic and perpetual inventory systems. The  inventory systems is known to be the way of recording and evaluating the value of inventories in a timeframe.

In the periodic inventory system, cost of goods sold is known by only at the end of a specific accounting period.

Learn more about periodic inventory system from

https://brainly.com/question/25887081

When searching for a school that is a good match for you, which of the following is NOT important to consider.
Financial options
Other degrees offered
Your priorities
Your preferences

Answers

Answer:

Explanation:

C

Answer:

Your preferences

Explanation:

Your preferences is not a factor to consider when searching for a good school match. It is important to consider financial options, other degrees offered, and your priorities when searching for a good school match.

What would be the amount(s) related to the bonds baddour would report in its balance sheet, income statement and statement of cash flows for the year ended september 30, 2024?

Answers

Balance Sheet: On September 30, 2024, Baddour would report the bonds payable as a liability in its balance sheet in the amount of $160 million.

Income Statement: For the year ended September 30, 2024, Baddour would report the following amounts related to the bonds in its income statement:

a. Interest expense: $16 million (10% x $160 million x 6/12)

b. Accrued interest payable: $2.2 million ($160 million x 10% x 3/12)

Statement of Cash Flows: For the year ended September 30, 2024, Baddour would report the following amounts related to the bonds in its statement of cash flows:

a. Cash inflows from interest payments: $8 million (10% x $160 million x 6/12)

b. Cash outflows for interest payments: $8 million (10% x $160 million x 6/12)

To know more about Bonds

brainly.com/question/10777799

The correct question is

Bonds Accrued Interest and Financial Statement Effects (i) 4 On March 1, 2024, Baddour, Incorporated, issued

10%

bonds, dated January 1 , with a face amount of

$160

million. - The bonds were priced at

$141.00

million (plus accrued interest) to yield

12%

. - The price if issued on January 1 would have been

$138.25

million. - Interest is paid semiannually on June 30 and December 31 . - Baddour's fiscal year ends September 30. Required: 1. to 3. What would be the amount(s) related to the bonds Baddour would report in its balance sheet, income statement and statement of cash flows for the year ended September 30,2024 ? Note: Enter your answers in whole dollars. Negative amounts should be indicated by a minus sign.

#SPJ4

What would be the amount(s) related to the bonds baddour would report in its balance sheet, income statement

Mason Co. issued $460,000 of five-year, 13% bonds with interest payable semiannually, at a market (effective) interest rate of 12%. Determine the present value of the bonds payable.
Do not copy from Chegg and give complete answer with explanation

Answers

The present value of the bonds payable is $461,342.01.

To calculate the present value of the bonds payable, we need to find the present value of both the principal amount and the periodic interest payments.

Present value of principal amount:

   The principal amount of the bond is $460,000, which will be received at the end of the fifth year. To calculate its present value, we use the formula for present value of a single sum: PV = FV / (1 + r)^n, where PV is the present value, FV is the future value, r is the discount rate, and n is the number of periods. Plugging in the values, we have PV = $460,000 / (1 + 0.12/2)^(5*2) = $320,244.99.

Present value of periodic interest payments:

   The bond pays semiannual interest at a rate of 13% on the face value of $460,000. The interest payment for each period is calculated as (Face Value) * (Stated Interest Rate) / 2 = $460,000 * 0.13 / 2 = $29,900. To calculate the present value of the interest payments, we use the formula for present value of an annuity: PV = PMT * (1 - (1 + r)^(-n)) / r, where PMT is the periodic payment, r is the discount rate, and n is the number of periods. Plugging in the values, we have PV = $29,900 * (1 - (1 + 0.12/2)^(-5*2)) / (0.12/2) = $141,097.02.

Finally, to find the present value of the bonds payable, we sum the present values of the principal amount and the interest payments: $320,244.99 + $141,097.02 = $461,342.01.

Therefore, the present value of the bonds payable is $461,342.01.

Learn more about bonds here: brainly.com/question/25965295

#SPJ11

When preparing a segment margin income statement ______.

Answers


When preparing a segment margin income statement, one should look at the income statement for the individual business segment and determine the gross margin for that segment. This involves subtracting the cost of goods sold from the segment's sales to determine the gross margin. One should then subtract the other expenses associated with the segment to determine the net margin for that segment.



In order to complete this analysis, one should begin by gathering the necessary financial data. This would include the sales and cost of goods sold for each segment, as well as any other associated expenses. Once all of the information has been gathered, one should subtract the cost of goods sold from the segment’s sales to determine the gross margin. One should then subtract the other expenses associated with the segment to determine the net margin for that segment.


One should also take into account any one-time items that could impact the segment’s results. This includes items such as restructuring charges, acquisition costs, and write-offs. Once all of the items have been taken into account, one should be able to determine the segment’s margin. The segment margin income statement is a useful tool for analyzing the performance of an individual business segment. By taking into account all of the necessary financial data, one should be able to accurately determine the segment’s margin and make informed decisions about the performance of the segment.

Know more about gross margin  here:

https://brainly.com/question/28390697

#SPJ11

The steady growth line best supports which conclusion about the economy
represented in the graph?
The Business Cycle
Production output
h w
Time
A The economy never experiences significant periods of contraction
.
B. The economy does not display consistent patterns in its business
cycles
C. The economy improves steadily over several business cycleding
D. The economy has pronounced troughs but no clear peaks.

The steady growth line best supports which conclusion about the economyrepresented in the graph?The Business

Answers

Answer is the letter C

The steady growth line indicates that the economy improves steadily over several business cycles.

Business cycle refers to the period whereby there is growth and decline in the economy of a nation and this can be measured through the gross domestic product of such economy.

The four stages in the business cycle are the expansion, the peak period, the contraction period and the trough period. In the expansion period, there a relatively rapid growth.

Based on the graph given, the steady growth lines shows that there was a steady improvement in the economy improves over the business cycles.

In conclusion, the correct option is C.

Read related link on:

https://brainly.com/question/19048508

The steady growth line best supports which conclusion about the economyrepresented in the graph?The Business

Example On November 1 , the company issued 10,000 preferred shares to a private investor at a cost of $100 each. The shares have a mandatory redemption price of $100 per share, and each year 1,000 shares must be redeemed, commencing in 2027. The shares have a monthly dividend of $0.85, which is cumulative and must be paid on redemption. Required: Prepare a memo outlining the accounting and reporting alternatives for the transaction. Also include a discussion around the impact on the SFP and SCI for the year ended 20×4.

Answers

The main answer is that the accounting and reporting alternatives for the issuance of preferred shares include treating them as either debt or equity.

When issuing preferred shares, companies have accounting and reporting alternatives. They can treat the shares as either debt or equity. If the shares are treated as debt, the company would record the proceeds as a liability and the periodic dividend payments as interest expense. On the other hand, if the shares are treated as equity, the company would record the proceeds as additional paid-in capital. The impact on the statement of financial position (SFP) would depend on the chosen treatment, affecting either liabilities or equity. The impact on the statement of comprehensive income (SCI) would be influenced by the interest expense or the absence of it.

Learn more about  debt or equity here:

https://brainly.com/question/30472739

#SPJ11

identifying novel niches is more difficult than conventional marketing or new product development because:

Answers

Identifying novel niches is more difficult than conventional marketing or new product development because it requires a deeper understanding of the customer's unmet needs and preferences.

To find a new niche, marketers need to conduct extensive research and analysis to identify gaps in the market that can be filled with a unique and valuable product or service. This requires a detailed understanding of the target audience's behavior, demographics, and psychographics. Additionally, finding a new niche often involves taking risks and being creative, which can be more challenging than following established marketing or product development strategies. Therefore, identifying novel niches requires a detailed answer that involves a thorough understanding of the market, customer behavior, and innovative thinking.

Identifying novel niches is more difficult than conventional marketing or new product development because:

1. Lack of existing data: Novel niches usually have limited or no historical data to analyze, making it harder to predict consumer behavior and preferences.

2. Increased risk: Due to their innovative nature, novel niches carry higher risks for businesses. The probability of success is lower compared to conventional marketing, where proven strategies can be followed.

3. Limited target audience: Novel niches often target a smaller, niche market, which may be harder to identify and reach. This makes it challenging to effectively market the product and drive sales.

4. Need for unique strategies: Novel niches require the development of new marketing strategies, which can be more time-consuming and expensive than using established methods.

5. Adaptability: Businesses venturing into novel niches must be flexible and willing to adapt their products and strategies based on the feedback and preferences of their target audience.

In summary, identifying novel niches is more difficult than conventional marketing or new product development because it requires businesses to navigate limited data, higher risks, and smaller target audiences, while also developing unique strategies and remaining adaptable.

Learn more about product development

at https://brainly.com/question/16760106

#SPJ11

Identifying novel niches is more difficult than conventional marketing or new product development due to several reasons.

Firstly, novel niches involve venturing into uncharted territory, where there is limited existing market data or established customer behaviors to rely on. This makes it challenging to assess market demand and potential profitability accurately. Secondly, identifying novel niches requires a deep understanding of emerging trends, consumer preferences, and societal changes, which may be unpredictable and constantly evolving.

Additionally, the risks associated with entering unexplored markets are higher, as there is a higher likelihood of encountering unforeseen challenges and competition. Overall, the complexity and uncertainty surrounding novel niches make them more difficult to identify and navigate compared to conventional marketing or new product development approaches.

Learn more about conventional marketing

https://brainly.com/question/15029227

#SPJ4

I need help ASAP!!!!



Answers

Answer:Feet

Explanation:

with what?

Other Questions
can I use the product rule on the denominator to plug into the quotient rule to find t derivative? What does an ecosystem's nonliving surroundings include? (Select all that apply.) sun water bacteria soil g Jenny is currently 20 years old and is planning for her retirement. She has $10,000 in her savings account today. She plans to retire at age 40, and receive an annual benefit payment (pension) of $80,000 for the following 40 years, i.e., until she is 80. If she wants her contributions over the next 20 years to grow at a rate of 5% per year, what must her first contribution (occurring one year from today) be? Assume a constant interest rate of 8%. The space probe Cassini has engines whichcan allow it to travel at 72,000 km/hr.However, physicists have discovered that byusing a "gravity assist maneuver," the probehas the ability to increase its speed by 75%.When using the gravity assist maneuver, howfast will the space probe travel, in kilometersper hour? Is it false to state that "The Irish language fluency has increased and the language is increasing too in terms of speakers"? Please see image attached. I was told by the instructor the answer is B but I dont understand why? each daugher cell inherits a daughter strand and original template strand from parent, so shouldnt the answer be A? Why do the strands split up to each daughter cell?Although DNA polymerases replicate DNA with extremely high fidelity, these enzymes do make mistakes at a rate of about 1 per every 100,000 nucleotides. Given that each human cell contains 23 pairs of DNA molecules with a collective 3 billion base pairs, it would amount to about 60,000 mistakes every time a cell replicates its DNA! Fortunately, there are extremely sophisticated mechanisms that fix most, but not all, of those mistakes. Suppose a cell (let's call it cell X ) in the regenerating liver of a patient is replicating its DNA molecules for mitosis, and suppose an " A " to " C " mismatch (see the sequences below) is present in one of the newly synthesized chromosome DNA because somehow this mismatch has escaped detection by repair mechanisms. Original template strand: 5'GGTTCAGTACGATTGCAAGGCCTTAAGGT3Newly synthesized strand: 3'-CCAAGTCATGCTAACGCTCCGGAATTCCAA- 5Which one of the following statements is most likely correct? A. After mitosis of the cell X, both daughter cells possess a permanent mutation. B. After mitosis of the cell X, one daughter cell possesses a permanent mutation. C. After mitosis of the cell X, one daughter cell will possess the AC mismatch, which will give rise to a permanent single base mutation after the DNA is replicated once. D. After mitosis of the cell X, both daughter cells possess the AC mismatch, which will give rise to a permanent single base mutation to be inherited by all of their daughter cells. FILL IN THE BLANK. ___ is a normal human glycoprotein produced in response to immune stimuli and can be used therapeutically to fight viruses and cancer. Why is it important for technical writing to be clear correct grammatically and structurally? which statement about case studies is true?multiple choicetraining with case studies does not require any interaction among trainees.case studies do not encourage trainees to take risks.trainees play a passive role while being trained with case studies.case studies stimulate learning by actively involving participants and the competitive nature of business.cases encourage trainees by giving them practice in acting on uncertain outcomes after evaluating a situation. u = b + ak Solve for aThanks antibiotics were used clinically beginning in the choose one: a. 1990s. b. 1740s. c. 1940s. d. 1840s. Alex tries to reduce stress by examining the negative assumptions that are making him anxious and challenging them with counterarguments. Which technique is Alex using? Why might someone want to file a tax return even if they dont meet the minimum income requirement Please help! What mistake did I make? how much water could you get if you started with 250.0 grams of oxygen? Name the four border slaveholding states that remained loyal to the Union. Bramble Corp. borrowed $870000 from Liber Bank on January 1, 2019 in order to expand its mining capabilities. The note required annual payments of $220776 and carried an annual interest rate of 8.5%. What is the balance in the notes payable account at December 31, 2020 if payments are made at the end of each year i have 12 addressed letters to mail, and 12 corresponding pre-addressed envelopes. for some wacky reason, i decide to put the letters into the envelopes at random, one letter per envelope. what is the expected number of letters that get placed into their proper envelopes? If you have a rod with an initial diameter 12 mm, final diameter is 10 mm and yield stress 100Mpa, it drawn with a pulling force of 300N. Calculate the requisite drawing stress. O 78.44Mpa. O 104.34Mpa. O 36.46Mpa. O 109.39Mpa. TRUE / FALSE. keynes was skeptical of the notion that the market woudl automatically operate at a full-pemployment. low inflation level