The availability of resources affect the carrying capacity of ecosystems.
False
True

Answers

Answer 1
That is true.

The amount of resources determine competition and the ability for many (or little) organisms to survive.

Related Questions

When a cell uses fatty acids for aerobic respiration, it first hydrolyzes fats to Group of answer choices glycerol and fatty acids. glycerol and amino acids. fatty acids and sugars. sugars and glycerol.

Answers

Answer:

glycerol and fatty acids.

Explanation:

Fats as biological molecules can be used as energy sources by the cell when there is low or no carbohydrate (glucose) for use.

Fats, mainly triglycerides enter metabolic pathway in an aerobic condition where they undergo catabolism to produce glycerol and fatty acids, their monomeric units. This process leads to the synthesis of ATP (Adenosine triphosphate). In other words, fats are hydrolyzed to glycerol and fatty acids

Is the crRNA match the
DNA in the coding region or the promoter region?
HDR-NS ODN CGCCGGCG CTGGACGTCCGTACGTTCGAACCGTGACCGGCAGCAAAATGTTGCAGCACTGACCCTTTTGG 5' GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACT

Answers

The crRNA matches the DNA in the coding region.DNA is Deoxyribonucleic Acid a nucleic acid molecule that comprises a code that directs the synthesis of all proteins that make up an organism. It is composed of nucleotides that form a double helix structure.

CrRNA is a part of the CRISPR system and plays a significant role in the defense mechanism against viral infection. The crRNA provides a code to find a viral or bacterial genetic material for its degradation.

The coding region is the portion of DNA that provides information required for protein synthesis. It comprises exons and introns. The crRNA matches the DNA in the coding region in order to guide the Cas protein for the destruction of the target DNA sequences. Thus, we can conclude that the crRNA matches the DNA in the coding region.

CrRNA function in bacterial CRISPR system:

https://brainly.com/question/25558340

#SPJ11

Which animal will have more biotic potential. A rabbit who gives birth in 4 months or an elephant who gives birth in 18 months? Why?

Answers

Answer:

I suppose that a rabbbit who gives birth in 4 months sounds correct.

Explanation:

Biotic potential is described by the unrestricted growth of populations resulting in the maximum growth of that population. Biotic potential is the highest possible vital index of a species; therefore, when the species has its highest birthrate and lowest mortality rate. So the rabbit giving birth in 4 months has better Biotic Potential because it has a more higher rate in population compared to the elephant.

Pls Consider giving me Brainliest! It would help a lot!

why can we say that most life on Earth is powered by the sun​

Answers

Answer: The sun is the closest star to Earth. ... It radiates light and heat, or solar energy, which makes it possible for life to exist on Earth. Plants need sunlight to grow. Animals, including humans, need plants for food and the oxygen they produce.

what structure within the female pelvis lies posterior to the urinar bladder and anteior to the rectue

Answers

The structure within the female pelvis that lies posterior to the urinary bladder and anterior to the rectum is the uterus.

The uterus is a hollow, muscular, and pear-shaped organ responsible for housing and nourishing a developing fetus during pregnancy. It is a key component of the female reproductive system, and its main function is to facilitate the growth and development of a fertilized egg.

The uterus consists of three main layers: the endometrium, which is the inner lining and responds to hormonal changes during the menstrual cycle; the myometrium, a thick middle layer of smooth muscle responsible for contractions during childbirth; and the perimetrium, the outer protective layer of the uterus.

The position of the uterus between the bladder and the rectum provides essential support for these organs and helps maintain their proper functioning. Additionally, its location plays a crucial role in ensuring optimal conditions for conception and pregnancy. The cervix, which is the narrow lower part of the uterus, connects to the vagina and acts as a channel for sperm to enter the uterus and for menstrual blood and babies to exit during childbirth.

In summary, the uterus is a vital female pelvic organ that is situated posterior to the urinary bladder and anterior to the rectum, and it plays a central role in the reproductive process.

Learn more about uterus here: https://brainly.com/question/29598893

#SPJ11

The term _____________ means any disease of the mouth due to a fungus.
a. salmonellosis b. stomatomycosis c. stomatitis d. steatorrhea

Answers

The correct option is B, The term stomatomycosis means any disease of the mouth due to a fungus.

Stomatomycosis, also known as oral candidiasis or thrush, is a fungal infection that affects the mouth and throat. It is caused by the overgrowth of Candida, a type of yeast that is normally present in small amounts in the oral cavity. However, certain factors can disrupt the balance of microorganisms, leading to an overgrowth of Candida and the development of stomatocytosis.

The condition commonly occurs in individuals with weakened immune systems, such as those with HIV/AIDS, diabetes, or those undergoing chemotherapy. It can also affect individuals who use inhaled corticosteroids, wear dentures, have poor oral hygiene, or take certain medications.

To know more about Stomatomycosis refer to-

brainly.com/question/32223299

#SPJ4

Which of the following terms refers to a covering of connective tissue that surrounds (most of) the bones external surface? articular cartilage endosteum epiphyses metaphyses periosteum

Answers

Two layers make up the periosteum. The inner layer as well as the bone underneath it are shielded by the outer layer. It is crafted from strong collagen fibres. The outer layer of the periosteum contains the majority of the blood vessels,bones and nerves.

Periosteum refers to the tissue that covers the outside of bones. Endosteum is the term for the tissue lining internal bone cavities. composed mostly of connective tissue in modest amounts and one layer of osteoblast. Your bones' surfaces are covered in a membrane layer called the periosteum. Only the portions that are covered by cartilage and the points where tendons join to bone are left out. The periosteum, which has two different layers, is crucial for both bone growth and healing.

Learn more about bones

https://brainly.com/question/14810294

#SPJ4

The different forms of a gene are called *
O points
gametes
alleles
genes
zygotes

Answers

Answer:

An allele is a variant form of a gene. Some genes have a variety of different forms, which are located at the same position, or genetic locus, on a chromosome. Humans are called diploid organisms because they have two alleles at each genetic locus, with one allele inherited from each parent.

Explanation:

Important biogeochemical cycles in ecosystems include all of the following except the ________ cycle.

Answers

Important biogeochemical cycles in ecosystems include all of the following except the phosphrous cycle.


The question misses the list of cycles to choose from. However, with a brief overview of important biogeochemical cycles in ecosystems. These cycles include the water cycle, carbon cycle, nitrogen cycle, and sulfur cycle. Biogeochemical cycles are the movement of essential elements and compounds through living and non-living components of an ecosystem. These cycles are crucial for the survival of organisms and the maintenance of healthy ecosystems. Some of the most important biogeochemical cycles include the carbon cycle, nitrogen cycle, phosphorus cycle, and water cycle.

Understanding these cycles helps us appreciate the complex interactions between living organisms and the environment.

To know more about biogeochemical cycle, click

https://brainly.com/question/1204069?

#SPJ11

Which characteristics do fish and amphibians have in common? Select all that apply.

They use gills at some point in their life cycle.

They use lungs at some point in their life cycle.

Their eggs are laid in water for reproduction.

Their bodies match the temperature of their environment.

Answers

Answer:

A C D

Explanation:

They use gills at some point in their life cycle.

Their eggs are laid in water for reproduction.

Their bodies match the temperature of their environment.


Why are invasive alien species a problem? Name one invasive
alien species and explain.
The question is related to geography.

Answers

Invasive alien species are a problem because they can cause significant ecological and economic damage to their new environments. They outcompete native species for resources, disrupt ecosystems, and reduce biodiversity. One example of an invasive alien species is the zebra mussel (Dreissena polymorpha).

The zebra mussel is native to the Caspian Sea and was accidentally introduced to North America in the ballast water of ships.

They have since spread to many water bodies across the continent.

Zebra mussels reproduce rapidly and form dense clusters, clogging pipes and damaging infrastructure.

They also filter large amounts of phytoplankton from the water, impacting the food chain and causing declines in native species.

In geography, invasive alien species are studied because they can have significant impacts on ecosystems and human activities.

Governments and organizations monitor and manage invasive species to mitigate their negative effects.

In summary, invasive alien species pose a problem due to their ability to disrupt ecosystems and cause economic harm.

The zebra mussel serves as an example of an invasive alien species that has had widespread negative impacts.

To know more about Invasive alien species, visit:

https://brainly.com/question/10338283

#SPJ11

A nurse is caring for an adolescent who has hemophilia A and is scheduled for wisdom teeth extraction. Prior to the procedure, the nurse should anticipate that the client will receive which of the following productsA- fresh frozen plasmaB- Packed RBCsC- Prophylactic antibioticsD- Recombinant

Answers

A nurse is caring for an adolescent who has hemophilia A and is scheduled for wisdom teeth extraction. Before the procedure, the nurse should anticipate that the client will receive fresh frozen plasma.

What is Hemophilia A?

Hemophilia A is a genetically inherited bleeding disorder in which the blood cannot clot normally. People with hemophilia A have low levels of clotting factor VIII, a protein that helps blood to clot. As a result, they may experience prolonged bleeding after an injury or surgery.

Hemophilia A is more common in males than in females and can be mild, moderate, or severe. The nurse caring for an adolescent who has hemophilia A and is scheduled for wisdom teeth extraction should anticipate that the client will receive fresh frozen plasma.

Clotting factors present in blood:

Fresh frozen plasma contains clotting factors that can help the client's blood clot normally and prevent excessive bleeding during and after the procedure. Prophylactic antibiotics are often given before dental procedures to prevent infection but do not help with bleeding disorders such as hemophilia A. Packed red blood cells (PRBCs) and recombinant factor VIII concentrate may be used in severe cases of bleeding, but fresh frozen plasma is typically the first-line treatment for bleeding disorders.

To know more about hemophilia, visit:

https://brainly.com/question/18916729

#SPJ11

Out of the four measuring instruments (micropipette, serological pipette, transfer pipette, and eyedropper), which do you expect to be the most accurate? why?

Answers

Serological  pipettes are more accurate as the smallest increment.

What is the difference between serological pipettes and micropipette?

Pipettes and micropipette are  invaluable pieces of laboratory equipment used to draw up , measures and deliver accurate volume of liquid. The difference between the two is that micropipette measures between 1 and 100μl , while pipettes generally start at 1 mili liter.

Serological pipettes ,each has clear ascending and  descending graduation marked on the side. This accurate measurement when dispensing or aspirating.

To learn  more about pipettes refer

https://brainly.com/question/4522590

#SPJ4

Which of the following is considered the control group in this experiment

Answers

Answer:

the source

Explanation:

importance of respiration​

Answers

Answer:

Respiration is important because it converts food energy into chemical energy.

Explanation:

If a medical professional is talking to you about the back of your head, where your eyesight is controlled, which region is being referred to?
the facial region
the cranial region
the appendicular region
the occipital region​

Answers

The occipital region

“The occipital lobe is one of the four major lobes of the cerebral cortex. The occipital lobe is the visual processing center of the mammalian brain containing most of the anatomical region of the visual cortex.”

The sequence of part of an mRNA transcript is 5' – AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG – 3' What is the sequence of the DNA coding strand? 5' – ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG What is the sequence of the DNA template strand? 5' – ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG

Answers

The sequence of the DNA coding strand is 5' – ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG – 3'.

Could you please rephrase the main answer using different wording: What is the sequence of the coding strand of the DNA corresponding to the given mRNA transcript?

The DNA coding strand has the same sequence as the mRNA transcript, except that thymine (T) in DNA replaces uracil (U) in RNA. Thus, the given mRNA sequence 5' – AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG – 3' corresponds to the DNA coding strand 5' – ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG – 3'. The  relationship between mRNA and DNA in protein synthesis.

Learn more about sequence

brainly.com/question/30262438

#SPJ11

Identify the characteristic of life for the following statement below1. ____________________”My friend got 3 inches taller in one summer”

Answers

In this statement, the characteristic of life is growth, i.e the increase in number and size of cells.

Read the following information from a Material Safety Data Sheet (MSDS) about the chemical hydrochloric acid (HCI).
"Skin Contact: In case of contact, immediately flush skin with plenty of water for at least 15 minutes while
removing contaminated clothing and shoes. Wash clothing before reuse. Thoroughly clean shoes before reuse.
Get medical attention immediately."
Based on this information, which is the most important thing to do right away if a student spills HCI on his shirt?

Answers

Answer:

Remove the shirt, and rinse the skin with water

Explanation:

I just  got the right answer

For a skin contact with HCl, Immediately flush skin with plenty of water for at least 15 minutes while removing contaminated clothing and shoes.

What is the most important to do after skin contact with HCl?

Hydrochloric acid (HCl) is a very corrosive acid, and can be harmful to the skin after a contact.

The following are what should be done after a skin contact with HCl;

Immediately flush skin with plenty of water for at least 15 minutes while removing contaminated clothing and shoes.

Thus, for a skin contact with HCl, Immediately flush skin with plenty of water for at least 15 minutes while removing contaminated clothing and shoes.

Learn more about HCl here: https://brainly.com/question/11604882

#SPJ2

What are Okazaki fragments?
A. parts of DNA that were replicated incorrectly
B. the part of the DNA in the replication bubble
C. pieces that are replicated on the discontinuous strand
D. the sequence that guides enzymes where to begin separating strands​

Answers

Answer:

D. the sequence that guides enzymes where to begin separating stands.

Explanation:

Okazaki fragments are short, newly synthesized DNA fragments that are formed on the lagging template strand during DNA replication.

Pick a natural disaster, research the disaster, write 3-5 sentences where, when, casualties and name of disaster.

help :( i need this asap 33 i'll give brainly for best answer,, /33

Answers

Answer: Hurricane.

Explanation:

The official hurricane season for the Atlantic basin is from June 1 to November 30, but tropical cyclone activity sometimes occurs before and after these dates, respectively. The peak of the Atlantic hurricane season is September 10, with most activity occurring between mid-August and mid-October.The destructive power of storm surge and large battering waves can result in loss of life, buildings destroyed, beach and dune erosion and road and bridge damage along the coast. Storm surge can travel several miles inland. In estuaries and bayous, salt water intrusion endangers public health and the environment.A hurricane can last for 2 weeks or more over open water and can run a path across the entire length of the Eastern Seaboard. The 74 to 160 mile per hour winds of a hurricane can extend inland for hundreds of miles. Tropical storms and hurricanes most frequently occur off the Southeast and mid-Atlantic coasts, but they can also roam the Atlantic Basin anywhere between the northern Bahamas and Atlantic Canada, in the Gulf of Mexico, the eastern Caribbean Sea and the western tropical Atlantic (to the east of the Lesser Antilles).

The Galveston hurricane of 1900, the deadliest natural disaster in U.S. history, crashed ashore much like Hurricane Ian did last week. As a large Category 4 with 150 mph winds, it shoved Gulf of Mexico waters deep into the booming port city. A typical hurricane can dump 6 inches to a foot of rain across a region. The most violent winds and heaviest rains take place in the eye wall, the ring of clouds and thunderstorms closely surrounding the eye. Every second, a large hurricane releases the energy of 10 atomic bombs. Hurricanes can also produce tornadoes.

5 thing that cause a hurricane!

Image result for Hurricanes facts

Warm ocean waters and thunderstorms fuel power-hungry hurricanes.

A pre-existing weather disturbance: A hurricane often starts out as a tropical wave.

Warm water: Water at least 26.5 degrees Celsius over a depth of 50 meters powers the storm.

Thunderstorm activity: Thunderstorms turn ocean heat into hurricane fuel.

give other brainliest

Which ion is a found in a glass of water

Answers

In a glass of water, the most common ion found is the hydroxide ion (OH-) and the hydrogen ion (H+).

These ions are formed when water molecules dissociate through a process called self-ionization or autoionization.

In a glass of water, several ions can be found, originating from the dissociation of water molecules. The main ions present are hydrogen ions (H+) and hydroxide ions (OH-), resulting from the self-ionization of water.

Water molecules can break apart spontaneously into equal concentrations of H+ and OH- ions through a process called autoionization. This occurs when a water molecule donates a proton (H+) to another water molecule, forming H3O+ (hydronium ion) and OH-.

Additionally, other ions might be present in a glass of water depending on its source. For example, tap water can contain various dissolved ions like calcium (Ca2+), magnesium (Mg2+), sodium (Na+), chloride (Cl-), and bicarbonate (HCO3-). These ions come from minerals and other substances present in the water source, such as groundwater or surface water.

It's worth noting that the specific ion composition of water can vary depending on factors like location, treatment processes, and water source. However, the fundamental ions present in water are H+ and OH- resulting from the autoionization of water molecules.

For more such answers on Water

https://brainly.com/question/5060579

#SPJ8

Rosalind Franklin used what technique in her study of DNA molecules?

Answers

Answer: Rosalind Franklin used X-ray crystallography in her study of the DNA Molecules.

EASYYYYYY
If global warming continues, what do you think will happen to the glaciers and icecaps of the Earth? What consequences will this have for people and other living things?

Answers

Answer:

Glaciers and Icecaps will melt.

The Consequences would be,

- Animals will lose their habitat due to melted Icecaps. Animals like polar bears, arctic foxes, snowy owls, reindeer, etc. They may also get extinct.

- It will create more frequent and intense coastal storms like hurricanes and typhoons.

- Coniferous plants will have problems

Answer:

The glaciers and icecaps will eventually melt

why are the chloroplasts concentrated around the periphery of the cell?

Answers

The concentration of chloroplasts around the periphery of the cell is thought to be related to the way in which they capture light energy for photosynthesis.

Chloroplasts contain pigments called chlorophylls, which are responsible for absorbing light energy. To maximize their ability to capture light, chloroplasts are usually found in the outer regions of the cell, where they are more likely to be exposed to sunlight.

In addition, the placement of chloroplasts around the cell's periphery may also help to facilitate the movement of materials within the cell. Chloroplasts are responsible for producing sugars through photosynthesis, and these sugars must be transported to other parts of the cell for use. By being located around the cell's periphery, chloroplasts may be more easily able to transfer their products to neighboring cells or tissues.

To learn more about chloroplasts, visit here

https://brainly.com/question/11136550

#SPJ4

Suppose you are on a class field trip to collect fossil shark teeth in the Sandy Beach. Which of the following tools would be best for your teacher to take long for you to use to collect the shark's teeth? Choose all that apply.
A. Mobile x-ray machine (uses x-rays to "see" inside things)
B. Hand trowel (a small shovel with a pointed tip)
C. Hand sieve (separates particles of different sizes)
D. Power drill (hand-held tool that drills holes in things)

Answers

Answer:

B

Explanation:

what happens during an autoimmune disease such as multiple sclerosis? group of answer choices a primary immune response is triggered. immune system cells attack health body cells. memory cells are no longer produced. infectious agents are able to hide in immune system cells. immune cells are no longer able to make antibodies.

Answers

During an autoimmune disease like multiple sclerosis, the immune system cells mistakenly attack healthy cells in the body.

Autoimmune diseases occur when the immune system, which is designed to protect the body from harmful substances and infections, mistakenly identifies the body's own cells as foreign and launches an immune response against them. In the case of multiple sclerosis (MS), immune system cells, particularly T cells, cross the blood-brain barrier and attack the myelin sheath, a protective covering of nerve fibers in the central nervous system. This immune-mediated attack leads to inflammation, damage, and disruption of the nerve signals, resulting in various neurological symptoms such as muscle weakness, impaired coordination, sensory disturbances, and cognitive impairments.

In MS, the immune system's attack on the myelin sheath can lead to the formation of scar tissue (sclerosis) in affected areas of the brain and spinal cord. This disrupts the normal transmission of nerve impulses, causing the symptoms experienced by individuals with MS. It is important to note that the exact cause of autoimmune diseases like MS is not fully understood, and factors such as genetic predisposition, environmental triggers, and dysregulation of the immune system play a role in their development.

Learn more about the immunity system here:

https://brainly.com/question/32392480

#SPJ11

which individual would most likely possess normal plasma cell synthesis and fully differentiated myeloid

Answers

An individual who is free from any disease would be most likely to possess normal plasma cell synthesis and fully differentiated myeloid cells.

Plasma cells synthesize antibodies, and they are involved in humoral immunity. Myeloid cells include neutrophils, eosinophils, basophils, monocytes, and macrophages, and they play a critical role in the immune response.

An individual with a healthy immune system is expected to have normal plasma cell synthesis and fully differentiated myeloid cells. Plasma cells are responsible for antibody synthesis, which is a critical aspect of humoral immunity.

The myeloid cells are a type of white blood cell that includes neutrophils, eosinophils, basophils, monocytes, and macrophages. They are responsible for the elimination of pathogens by phagocytosis, and they also secrete cytokines that recruit other immune cells to the site of infection.

Individuals with certain medical conditions, such as leukemia, lymphoma, multiple myeloma, and autoimmune diseases, may experience abnormal plasma cell synthesis or myeloid cell differentiation. In such cases, medical intervention may be necessary to restore the immune system's normal functioning.

To know more about pathogens click on below link:

https://brainly.com/question/31994092#

#SPJ11

The sarbanes-oxley (sox) act blank______. multiple select question. has many implications for managers.

Answers

The Sarbanes-Oxley Act (SOX) blank has many implications for managers. This statement is true. The SOX Act has a wide range of implications for managers and companies, including increased accountability, transparency, and internal controls, among other things.


SOX was enacted in 2002 in response to numerous financial scandals and corporate governance failures. The Act was designed to improve the reliability and accuracy of financial reporting and to increase transparency and accountability in the corporate sector. As a result, SOX requires public companies to comply with a number of internal controls, disclosure requirements, and governance provisions.
One of the most significant implications of SOX for managers is the increased scrutiny placed on their financial reporting practices and internal controls. The Act requires companies to establish and maintain a system of internal controls over financial reporting, which must be reviewed and audited annually by independent auditors. Additionally, SOX requires companies to disclose any significant deficiencies or material weaknesses in their internal controls, which can have significant implications for a company's reputation and financial performance.
In conclusion, the SOX Act has many implications for managers and companies, and compliance with its provisions is essential for ensuring the reliability and accuracy of financial reporting and maintaining the trust of investors and other stakeholders.

To know more about managers visit :

https://brainly.com/question/32150882

#SPJ11

"A birth in which the baby is surgically removed from the uterus, rather than traveling through the birth canal, is called"

Answers

Answer:

Cesarean section

Explanation:

a surgical operation for delivering a child by cutting through the wall of the mother's abdomen.

Other Questions
Which phases of cellular respiration occur in the mitochondria? For the united states, importing involves the purchase of goods and services from foreign sources while exporting involves ______. please answer all requirements and follow any rounding instructionsor whole number instructionsMurden Corporation has three divisions: pulp, paper, and fibers. Murden's new controller, Marco Becker, is reviewing the allocation of fixed corporate-overhead costs to the three divisions. He is pres What is you favorite thing about christmas?1st person gets a crownplease help what are the advantages of expressing labor standards in term of labor dollars? in terms of labor hours? What was the result of the Berlin Conference? 6. At the football game they sold $3 hot dogsand $2 sodas, which made the school $300. Thenumber of sodas sold was 10 more than twotimes the number of hot dogs sold. Determine thenumber of hot dogs and sodas sold. what distinguishes the diagonals of rectangles from those of other parallelograms A car covers 100 km in 2 h , what is the speed of the car. {I want full answer} 2+2=Bdhenehgg gg rhbrhr An 80-m tower is supported by a guy wire attached to the top of the tower. If the wire forms anangle of elevation of 79, how long is it? Express your answer to the nearest tenth of a meter.Note: guy wires are used to add stability to the structure Lunar missions have helped scientists track the motion of the moon. What have they discovered about itsmotion? EagleEye Company, a manufacturer of digital cameras, is considering entry into the digital binocular market. EagleEye Company currently does not produce binoculars of any style, so this venture would require a careful analysis of relevant manufacturing costs to correctly assess its ability to compete. The market price for this binocular style is well established at $136 per unit. EagleEye has enough square footage in its plant to accommodate the new production line, although several pieces of new equipment would be required; their estimated cost is $4,800,000. EagleEye requires a minimum ROl of 15% on any product line investment and estimates that if it enters this market with its digital binocular product at the prevalling market price, It is confident of its ability to sell 22,000 units each year.Required:Identify the costs that EagleEye Company would consider for decision of entering the digital binocular market Is this an ionic substance a covalent substance or a metal? Which country has German or Portuguese as official language? Prepare a contribution format income statement at the company's break-even point that shows the appropriate levels of sales for the two products. (Do not round intermediate calculations. Round your answers to the nearest dollar amount.) Which song is to be performed a cappella? Look up the word a cappella if you do not know the meaning. A) Mangwani MpuleleB) Laudate DominumC) Sing With Pleasure What pair of angles must have the same measure?I'll give brainliest if its correct. evaluate the role of media in enhancing democratic progress in south africa forcusing on the fact that the media should be an independent voice informing the citizens about their rights in a democratic society Many slave families were separated through the domestic slave trade. If you were a free slave looking for a missingfamily member after the Civil War, how might you go about finding them?