It is true to say that the value in one or more cells can be kept track of using The Watch Window. The Watch Window makes it simple to check, verify, or audit formula results in extensive workbooks.
You can avoid frequently scrolling or moving to various worksheet locations by using the Watch Window. Like any other toolbar, this one may be dragged and docked. The Watch Window provides a single pane from which you may monitor cells on various sheets and books.
It allows you to inspect, audit, or confirm formula calculations and results in big worksheets as well as check the values and formulas in cells that are hidden from view in the active worksheet.
Learn more about Watch Window Visit: brainly.com/question/15843801
#SPJ4
Can someone help me pls
Answer:
respiratory and circulatory digestive and excretorydigestive and circulatory nervous and muscularExperiment #1: Aseptic Techniques and Use of Media Incubation and Observations Incubate all cultures. After approximately 48 hours of incubation, examine your cultures. Do no remove the caps of your tubes or the lid of the Petri dish during any observation, because this may result in contamination. Take pictures of your cultures. For photographs of microbial cultures, avoid use of the flash, which will simply be reflected off the glass or plastic culture container. You may need to experiment with lighting conditions and camera angles to get the best pictures in your workspace. Observe and photograph the cultures again after approximately 72 hours of incubation. Your inoculated media should exhibit increasing amounts of microbial growth throughout the incubation period. Record name of bacterial species used in this investigation,
1. 2.
3. 4.
Photo 1 Insert the photo(s) of your cultures taken after 48 hours of incubation.
Aseptic technique is the term used to describe the methods utilized to prevent contamination by microorganisms in microbiological experiments.
Experiment #1: Aseptic Techniques and Use of Media Incubation and ObservationsAfter approximately 48 hours of incubation, examine your cultures. Do no remove the caps of your tubes or the lid of the Petri dish during any observation, because this may result in contamination.
Take pictures of your cultures. For photographs of microbial cultures, avoid use of the flash, which will simply be reflected off the glass or plastic culture container. You may need to experiment with lighting conditions and camera angles to get the best pictures in your workspace. Observe and photograph the cultures again after approximately 72 hours of incubation.
Your inoculated media should exhibit increasing amounts of microbial growth throughout the incubation period. The experiment aims to use aseptic techniques and media incubation to observe microbial growth and characteristics.
Learn more about Aseptic Visit: brainly.com/question/30650507
#SPJ11
At the end of Chapter 5, Berck and Helfand find compensating variation (CV) and equivalent variation (EV) for wolves in Yellowstone Park - a publicly provided good. Assume wolves are a good to the individual whose preferences we are modeling, i.e., the individual wants more wolves in the wild, all else equal. Suppose there exists 5 wolves in Yellowstone Park, and the average individual has income of \$y. The individual's consumption bundle is A, and the initial indifference curve is I0. Suppose an environmental group provides funds for habitat, and it's expected this habitat will result in 5 more wolves in Yellowstone. Assume the individual's income stays the same. The new consumption bundle is B, and the new indifference curve is I'. Complete the following tasks all on one graph. A. Using our properties of indifference curves (i.e., make them crescent shaped), plot the initial bundle (A) and label with appropriate income and wolf count. Draw the initial indifference curve (I
0
). Be sure to label the graph completely. (Hint: Easiest to place a composite good on the vertical axis, wolf count on the horizontal axis) ( 2 pts) B. Draw the new indifference curve and identify the new consumption bundle (B) while labeling with the appropriate wolf count. ( 2 pts) C. Identify the theoretical consumption bundle (call it C ), that uses the original wolf count but lies on the new indifference curve I'. (2 pts) D. Label the area on the on the vertical axis that corresponds to the EV and CV of these changes. Then in the margins, define CV and EV as it relates to this specific problem
The initial bundle (A) is represented by the consumption combination (A, I0) with an income of y. Consumer surplus and compensating variation are both concepts in microeconomics that relate to the study of consumer behavior.
The initial indifference curve (I0) is a curved line that slopes upward to the right, indicating that as the individual consumes more of the good, their preference for that good increases, but their preference for the other good remains constant.
The new indifference curve (I') is a curved line that slopes upward to the right, indicating that as the individual consumes more of the good, their preference for that good increases, but their preference for the other good remains constant.
The new indifference curve (I') is plotted on the any type of graph as a curved line starting from the origin, with the vertical axis representing wolf count and the horizontal axis representing income.
Learn more about consumption Visit: brainly.com/question/30155938
#SPJ11
Correct Question:
At the end of Chapter 5, Berck and Helfand find compensating variation (CV) and equivalent variation (EV) for wolves in Yellowstone Park - a publicly provided good. Assume wolves are a good to the individual whose preferences we are modeling, i.e., the individual wants more wolves in the wild, all else equal. Suppose there exists 5 wolves in Yellowstone Park, and the average individual has income of y. The individual's consumption bundle is A, and the initial indifference curve is I0. What is the difference between consumer surplus and compensating variation?
All of these are attributed to deforestation EXCEPT:
A)
Less biodiversity
B)
A loss of soil nutrients
An increase in forested areas
D
An increase in greenhouse gases
Answer:
C
Explanation:
Deforestation is the process clearing large expanses of woodland; which destroys biodiversity, removes fertility in soil and increases greenhouse gases; but DECREASES the amount of forested areas. Hope this helps :D
Which conclusion is MOST STRONGLY supported by the data in the table?
A- Plants develop polyploidy only through selective breeding.
B- Plants may naturally increase their ploidy levels with each generation.
C- Plants can't survive 3, 4, or 5 times the haploid number of chromosomes,
D- Introducing polyploidy to plants can increase certain desirable traits.
The conclusion that is MOST STRONGLY supported by the data in the table is "D- Introducing polyploidy to plants can increase certain desirable traits."
option D is correct.
The table shows that introducing polyploidy in plants can increase the size of the leaves, cells, fruits, flowers, and seedless fruits.
Therefore, we can conclude that polyploidy can improve certain desirable traits in plants. This is also supported by the fact that many plants that are grown commercially are polyploid, which is an evidence that introducing polyploidy in plants has its advantages.
Option A is incorrect as polyploidy can be developed naturally.
Option B is not the MOST STRONGLY supported conclusion as it is not always the case that plants will increase their ploidy level with each generation.
Option C is incorrect because many polyploid plants exist and are able to survive with a higher chromosome number.
option D is correct.
For more such questions on polyploidy
https://brainly.com/question/29089800
#SPJ8
PLEASE HELP!!
Give two examples of geographic representations other than a map.
Answer:
Here are two types of geographic representations other than a map:
a photograph of an aerial view of Earth taken from a satellite
&
a blueprint of a building
Explanation:
A scientist is studying the Bear Creek swamp, which is wet most of the year and is filled with such animals as alligators, beavers, and numerous kinds of fish.
What kind of ecosystem is the Bear Creek swamp?
wetland
pond
stream
estuary
Answer:
Wetland
Explanation:
It is wet most of the year
There is also alligators, which tend to be there commonly.
AND in the start of the question, it says swamp, swamps are the most similar to wetlands.
g in an in vitro polymerization reaction of f-actin from its g-actin subunits, there is a lag phase (rate-limiting stage). what happens during this lag phase? a: f-actin is nucleated b: f-actin reaches a steady state c: f-actin exchanges nucleotides d: f-actin hydrolyzes atp e: f-actin undergoes treadmilling
There is a lag phase in the in vitro polymerization of F-actin from its G-actin subunits. F-actin nucleates during this lag phase.
G-actin or globular actin is the globular and monomer form of actin that forms the actin filament. F-actin or fibrous actin is the fibrous actin and a linear polymer that forms the contractile apparatus and cytoskeleton apparatus of the muscle cells.
Actin nucleation is the first stage in the development of an actin filament. Polarized filaments, or F-actin, are created by the assembly of actin monomers, or G-actin. This filament will have a pointed end that grows more slowly and a barbed end that grows quickly. Therefore, at this stage, a complex of three actin monomers, or an actin nucleus, is formed, from which an actin filament extends. Therefore, the time needed by the actin for nucleation is the lag phase. Here, option a is the correct statement.
To know more about G-actin:
https://brainly.com/question/15877344
#SPJ4
PLEASE QUICK!!!!
Complete the analogy
Cells : _______ :: Species : Population
Answer:
There are more but there is only one blank so,
The answer should be Organism (?)
if a water molecule entered a mature root at the root surface, it would cross what tissues, in their correct order, on its way to the center?
A water molecule will first cross the epidermis, then the cortex, endodermis, pericycle, and the vascular cylinder on its way to the center through the root surface.
1. Epidermis: This is the outermost layer of the root and is composed of one to several layers of cells with no intercellular spaces between them. It is a protective layer that helps keep out harmful substances and microorganisms.
2. Cortex: This layer consists of loosely packed cells that form a spongy middle layer of the root. These cells store carbohydrates, proteins, lipids, and other nutrients that the root needs to survive.
3. Endodermis: This layer is located inside the cortex and is composed of tightly packed cells with cell walls that contain a waxy layer called suberin. The suberin acts as a barrier to the diffusion of water and solutes into the inner regions of the root.
4. Pericycle: This layer is located inside the endodermis and is composed of living cells that give rise to lateral roots.
5. Vascular Cylinder: This is the innermost layer of the root and is composed of vascular tissue (xylem and phloem) that transports water, minerals, and sugars throughout the root. This layer is the final barrier the water molecule will cross on its way to the center of the root.
Therefore, the correct order in which a water molecule entering a mature root at the root surface will cross the tissues is the epidermis, cortex, endodermis, pericycle, and then the vascular cylinder on its way to the center.
To know more about the epidermis, refer here:
https://brainly.com/question/22469886#
#SPJ11
Pls I need these answers ASAP
Answer:
Okay, from what i understand, you should make a column with the kind of snake, and another one with Mortality percentage from the venom of those snake's bites.
Use the numbers to guide yourself... for example
Kind of Snake I Mortality Percentage
(1)southern United States copperhead I (1) less than 1%
Could the information found from the extracting strawberry DNA be important to strawberry farmers
Answer:
Yes, but farmers may not use this method on the farm
Explanation:
hope it helps
transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC
Answer:
RNA: UACGCUUUACGAGACCCAAUC
Explanation:
During transcription, a specific DNA sequence is used as template to synthesize a specific RNA sequence, usually a messenger RNA (mRNA). During this process (transcription), Uracil (U) bases replace Thymine (T) bases. Transcription has three stages: initiation, elongation and termination. Subsequently, the resulting mRNA is used to synthesize a protein, in a process known as translation.
Answer:
RNA: UACGCUUUACGAGACCCAAUC
Explanation:
22) in a sewage treatment facility, an optimal environment is maintained for the survival of naturally occurring species of microorganisms. these organisms can then break the sewage down into relatively harmless wastewater. for these microorganisms, the wastewater facility serves as question 40select one: a. a food chain b. its carrying capacity c. an energy pyramid d. an ecosystem
For these microorganisms, the wastewater facility serves as an ecosystem. (Option d)
In a sewage treatment facility, a complex ecosystem of microorganisms is established to effectively break down the sewage into harmless wastewater. This ecosystem consists of various species of microorganisms that work together in a coordinated manner to degrade and process the organic matter present in the sewage.
An ecosystem refers to a community of living organisms (microorganisms in this case) interacting with their physical environment. In the sewage treatment facility, the microorganisms play specific roles in the degradation process, with some breaking down complex organic compounds into simpler forms, while others utilize the byproducts produced by the first group. This interdependent relationship between different microorganisms forms the basis of an ecosystem.
The sewage treatment facility provides an optimal environment, including the necessary nutrients, oxygen levels, and temperature conditions, to support the survival and growth of these microorganisms. As a result, they are able to efficiently break down the sewage and convert it into relatively harmless wastewater, contributing to the overall functioning of the ecosystem within the facility.
To know more about ecosystem follow the link:
https://brainly.com/question/30237128
#SPJ4
Which molecule has hydrophilic and hydrophobic properties and would be found in plasma membranes?
The molecule that has hydrophilic and hydrophobic properties and is found in plasma membranes is phospholipids.
Phospholipids are molecules that are primarily found in plasma membranes, which encase all cells. They are made up of a hydrophilic phosphate head and two hydrophobic fatty acid tails. The phospholipid's head is attracted to water, while the tail is repelled by it. The hydrophilic head is polar and can interact with other polar molecules such as water. The hydrophobic tail is nonpolar and cannot interact with water.
This unique arrangement of hydrophobic and hydrophilic regions enables phospholipids to self-assemble into a bilayer that encloses a cell and forms the plasma membrane, a selective barrier that allows certain molecules to pass through while blocking others. Thus, the hydrophilic and hydrophobic properties of phospholipids are critical in the structure and function of plasma membranes.
Learn more about phospholipids here:
https://brainly.com/question/30414447
#SPJ11
in the graph below is shown the relationship between the number of offspring produced and the average size of offspring produced. what is the term (two words that are hyphenated) for this relationship?
The relationship between the number of offspring produced and the average size of offspring produced is called the reproductive trade-off. What is a reproductive trade-off A reproductive trade-off refers to the compromise that organisms make between reproductive traits, such as the number and size of offspring.
Reproductive trade-offs may occur within and between organisms, as well as between traits. A trait that is beneficial in one respect may have disadvantages in another, resulting in a trade-off. Trade-offs arise because organisms must allocate their finite energy and resources to various physiological functions, such as growth, maintenance, and reproduction.
Therefore, when organisms put more resources into one physiological function, such as reproduction, fewer resources are available for others. The number of offspring produced and the average size of offspring produced is an excellent example of a reproductive trade-off.
Some species may produce a few large offspring, while others may produce many small offspring. These strategies, however, come with different costs and benefits.
To know more about offspring visit:
https://brainly.com/question/14128866
#SPJ11
a transcription factor contains an amphipathic helix that is essential for the factor's function (allowing it form a dimer). which of the following mutations resulting in amino acid changes would most likely disrupt its function?
Because valine is an essential amino acid that the body cannot generate on its own, it is converted from valine to methionine. Methionine must be present in appropriate amounts in the diet.
An amino acid is defined as:Amino and carboxylic acid functional groups can both be found in organic compounds known as amino acids. Alpha-amino acids, which are the building blocks of proteins and are among the hundreds of distinct amino acids found in nature, are by far the most widespread. There are just 22 alpha amino acids in the genetic code.
What four tasks do amino acids perform?Protein building components. Despite both D- and non-L-amino acids being present in nature, only L-amino acids can be polymerized to form proteins.Biological barriers.Storage of nitrogen.Creation of different compounds.To know more about Amino Acids visit:
https://brainly.com/question/14583479
#SPJ4
Please answer thanks
grass goes first then insects then Meerkats
dna replication results in __________ copies of a cell's genome.
Dna replication results in two copies of a cell's genome.
What is cell?A cell is the basic unit of life in all living organisms. It is the smallest unit of an organism that is capable of performing all of the processes necessary for life. Cells are made up of a variety of organic molecules, such as proteins, carbohydrates, lipids, and nucleic acids, which are organized into structures called organelles. Together, these molecules and organelles enable cells to perform vital functions, such as reproduction, metabolism, and response to stimuli. Cells are also able to communicate with one another, allowing for the coordination of activities and the transfer of information.
To learn more about cell
https://brainly.com/question/13920046
#SPJ4
Bromothymol blue (BTB) is a pH indicator that is also used to detect carbon dioxide (CO2). BTB is blue when pH is basic and CO2 is low. BTB is yellow when pH is acidic and CO2 is high. BTB is green when pH is neutral. A group of students are planning to perform an investigation in which they will place either a stalk of the aquatic plant elodea or a snail in a test tube that contains water with a neutral pH of 7 and BTB. The students will also include a test tube that contains elodea and a snail. Observing color change once the tubes have been placed under a growth light for several hours will allow the students to answer which TWO of the following questions?
A. Do both elodea and snails require oxygen to survive?
B. Does elodea produce oxygen during photosynthesis?
C. Do snails respire faster when placed in a tube with elodea?
D. Do snails use the CO2 produced by elodea to produce oxygen?
E. Does photosynthesis performed by elodea remove CO2 from the water?
F. Does cellular respiration occur at a higher rate than photosynthesis in the tube with only elodea?
I need 2 answers! Thanks
Answer:
E. Does photosynthesis performed by elodea remove CO2 from the water? F. Does cellular respiration occur at a higher rate than photosynthesis in the tube with only elodea?Explanation:
The tubes were placed under a growth light and as the elodea is growing, it would need photosynthesis to provide food. The color changes will therefore allow the students to see the effect photosynthesis has on the CO2 in the water by checking to see if the BTB turns blue which would mean that CO2 was removed by photosynthesis.
The students will also be able to see which process occurs faster in the tube with only elodea because the dominant color would show if cellular respiration occurs faster than photosynthesis or if the case is the reverse. For instance, if respiration is occurring faster, there will be more CO2 which would turn the BTB towards yellow, if photosynthesis is faster the BTB will turn towards blue and if the rates are similar, the BTB will remain green.
Which activities of a cell that include cellular growth, DNA
replication/duplication, and cell division?
Where are the high tides if the moon is in first quarter?
The first and third halves of the moon, when the moon seems to be "half full," are when neap tides occur.
When tides are at their peak, where is the moon?Every month, at perigee, when the moon is closest to Earth, tidal-generating forces are stronger than usual, resulting in tide ranges that are higher than typical. When the moon is at its furthest distance from Earth, or apogee, about two weeks later, the lunar tide-raising effect is weaker and the tidal ranges are smaller than usual.
How does a first quarter moon affect things?The Moon is facing the Earth and Sun at a 90-degree angle during this phase. The Moon appears to be partially lighted and partially in shadow. We observe what appears to be the right half during the first quarter.
To know more about neap tides visit:-
https://brainly.com/question/29417771
#SPJ1
What are the 7 parts of nephron?
The 7 parts of nephron are: glomerulus, Bowman's capsule, proximal convoluted tubule, loop of Henle, distal convoluted tubule, collecting duct, and papillary duct.
The nephron is the basic functional unit of the kidney, and each nephron is made up of these 7 parts. The glomerulus is a tiny blood vessel surrounded by Bowman's capsule. The proximal and distal convoluted tubules are involved in the reabsorption of vital substances back into the bloodstream. The loop of Henle is responsible for creating a concentration gradient of ions, which helps regulate the balance of salt and water in the body. The collecting duct collects the filtrate from the distal tubule and carries it to the papillary duct, which then drains the filtrate into the renal pelvis, from which it is carried to the bladder as urine.
Learn more about glomerulus here:
https://brainly.com/question/30174227
#SPJ4
5. The basic process of gas exchange requires no structures at all and is
called _
A. gills
B. spiracles
C. diffusion
The best one word summary of what blood does is
insulates
carries
signals
cleans
Answer:
Carries
Explanation:
The blood is a tissue composed of plasma (liquid) and various cells. It is a major component of the circulatory system. The blood serves majorly as a "CARRIER" helping to transport different substances throughout the body.
The blood CARRIES oxygen, nutrients, hormones and other important materials throughout the body as it circulates.
Which of the following is an organic molecule?
A.NaCl
B.H2O
C.FeO
D.CH4
Answer:
D.CH4
Explanation:
Methane (CH4) is the prototypical organic molecule. Stick drawings of methane and some other organic molecules follow. Although uncommon, there are organic compounds that don't contain a C-H bond. For example, CCl4 is almost always classified as organic.
How does CAH affect internal ducts, external genitalia, and
brains of XX individuals?
CAH can cause abnormalities in the internal ducts, external genitalia, and brains. This can manifest as an abnormally in females, hypospadias in males, and underdeveloped or absent reproductive organs.
Congenital adrenal hyperplasia (CAH) can affect the internal ducts, external genitalia, and brains of XX individuals in the following ways:Internal ducts: CAH can cause the internal ducts of XX individuals to develop abnormally, leading to problems with the reproductive system and fertility.External genitalia: CAH can cause the external genitalia of XX individuals to develop abnormally, resulting in ambiguous genitalia or masculinization of the genitalia.Brains: CAH can affect the development of the brain in XX individuals, leading to cognitive and behavioral abnormalities, such as learning disabilities, attention deficit disorder, and mood disorders.Overall, CAH can have a significant impact on the physical and mental health of XX individuals, and it is important for these individuals to receive appropriate medical treatment and support.
Learn more about Congenital adrenal hyperplasia at https://brainly.com/question/5011089
#SPJ11
An animal with any type of symmetry is termed ___________ whereas an animal with no symmetry is called _____________.
Answer:
The animals have symmetry and no symmetry. The symmetry animals bodies are divided into two halves passing through the centre. They may be bilateral symmetry or radial symmetry.
The bodies of the asymmery or animals have no symmetry never cut into two equal halves passing through their centre of the body
Explanation:
I hope that helped srry its kinda confusing
Answer:
An animal with any type of symmetry is termed ___________ whereas an animal with no symmetry is called _____________.
Explanation:
1) symmetrical
2) asymmetrical
what are the three primary regions of mrna sequences in bacterial cells?
In bacterial cells, the three primary regions of mRNA sequences are the leader sequence, coding sequence, and trailer sequence.
What is mRNA?Messenger RNA (mRNA) is a type of RNA that carries genetic information from DNA to ribosomes, which are the cellular factories that produce proteins. In the process of transcription, which occurs in the nucleus of eukaryotic cells and the cytoplasm of prokaryotic cells, mRNA is synthesized from a DNA template.The three primary regions of mRNA sequences in bacterial cells include:
Leader Sequence:This is the first region of an mRNA molecule, located at the 5' end. It contains a short untranslated region (UTR) that precedes the start codon and is necessary for ribosome binding. It is composed of several purine nucleotides followed by several pyrimidine nucleotides. The Shine-Dalgarno sequence, which is located within the leader sequence, is important for translation initiation in prokaryotes.
Coding Sequence:This is the second region of an mRNA molecule. It contains the codons that specify the amino acid sequence of the protein. Each codon consists of three nucleotides. The reading frame of the coding sequence begins at the start codon (AUG) and ends at one of the three stop codons (UAA, UAG, or UGA).
Trailer Sequence:This is the last region of an mRNA molecule, located at the 3' end. It contains a short untranslated region (UTR) that follows the stop codon. It is not required for translation but may be important for mRNA stability or transport. It is composed of several pyrimidine nucleotides followed by several purine nucleotides.
Read more about mRNA here: https://brainly.com/question/12388408
#SPJ11
The hero has something that sets her apart from others at the beginning. * A. The Temptation B. Crossing the Threshold C. An Unusual Birth/Early Childhood D. The Return Home
Answer: c
Explanation: you can notice she is special unlike others she has something unic. btw this belongs to inglish clas not biology sorry to break it up to you
Answer:
The Answer is C.
Explanation:
It makes more sense than the other answers...right? look at it. see it now?