Think about the system associated with the equation –x2 + x + 6 = 2x + 8. Which graph represents the system?

Think About The System Associated With The Equation X2 + X + 6 = 2x + 8. Which Graph Represents The System?
Think About The System Associated With The Equation X2 + X + 6 = 2x + 8. Which Graph Represents The System?
Think About The System Associated With The Equation X2 + X + 6 = 2x + 8. Which Graph Represents The System?
Think About The System Associated With The Equation X2 + X + 6 = 2x + 8. Which Graph Represents The System?

Answers

Answer 1

Answer:

Step-by-step explanation:

Set each equation equal to y, then graph each equation.

y = -x² + x + 6      (parabola)

y = 2x + 8            (line)

Notice that the system has NO SOLUTION because the parabola and the line never intersect.

Answer 2

Answer:

B

Step-by-step explanation:

i just did the question on edge


Related Questions

If triangles ABC and DEF are similar, what is y? Show your work.

If triangles ABC and DEF are similar, what is y? Show your work.

Answers

The value of y is 18

What are similar triangles?

Similar triangles have the same corresponding angle measures and proportional side lengths. The angles of the two triangle must be equal and it not necessary they have equal sides.

Therefore the corresponding angles of similar triangles are congruent and the ratio of corresponding sides of similar triangles are equal.

Therefore;

14/21 = 12/y

14y = 21 × 12

14y = 252

divide both sides by 14

y = 252/14

y = 18

Therefore the value of y is 18.

learn more about similar triangles from

https://brainly.com/question/14285697

#SPJ1

Calculator
Enter the unknown value that makes this statement true:
25% of O
is 30.
->
-
1
2
3

Answers

Answer:

X = 120

Step-by-step explanation:

here's your solution

=> we need to find the number whose 25%

is 30

=>. now , let the number be X

=> solve for X

=>. 25/100*X = 30

=> X = 30*100/25

=> X = 120

hope it helps

In Rebecca's neighborhood, 89% of the houses have garages and 48% have a
garage and a pool. What is the probability (in percent) that a house in her
neighborhood has a pool, given that it has a garage? Round your answer to 1
decimal place.

Answers

why are there two of these?
Answer:

53.9

Step-by-step explanation:

89% of all houses have garages and 48% have garages and pools. We try to find houses with a pool that have a garage. Let's assume that there are 100 houses in her neighborhood. then 89 of them have garages and 48 of them have garages and pools. 48 / 89 = about 0.5393. Conver this to percent and we get 53.9

plz help ill give brainliest

plz help ill give brainliest

Answers

Answer:

100% answer B

How many roots do the functions have in common f(x)=x^2+x-6

Answers

To find the common roots between two functions, we need to find the roots (or solutions) of each function individually and then identify the shared solutions.

For the function f(x) = x^2 + x - 6, we can find the roots by setting the function equal to zero and solving for x:

x^2 + x - 6 = 0

To factorize this quadratic equation, we need to find two numbers that multiply to -6 and add up to 1 (the coefficient of x). The numbers that satisfy these conditions are 3 and -2:

(x + 3)(x - 2) = 0

Setting each factor equal to zero:

x + 3 = 0 or x - 2 = 0

Solving for x in each equation:

x = -3 or x = 2

Therefore, the function f(x) = x^2 + x - 6 has two roots: x = -3 and x = 2.

To find the common roots between this function and another function, we would need to know the second function. If you provide the second function, I can help determine if there are any shared roots.

15. Kate has 63 pens. She gives all the pens to her 9 friends. Each friend gets
the same number of pens.
Kate said that when she divided the number of pens that each friend got by 9,
the answer was equal to 63. Her friend Margo said that when the number of
pens each friend got was multiplied by 9, the answer was equal to 63.
Which girl is correct? Explain your answer. I will mark as brainlist and vote if you answer

Answers

The girl which is correct between kate and her friend Margo is Margo.

The correct answer option is option B

How to multiply?

Number of pens Kate has = 63Number of Kate's friends = 9

If each friend gets the same number of pens;

Number of pens each friend get = Number of pens Kate has / Number of Kate's friends

= 63 / 9

= 7

Check:

Number of pens each friend get × Number of Kate's friends = Number of pens Kate has

7 × 9 = 63

Therefore, Kate's friend, Margo is correct.

Read more on multiplication:

https://brainly.com/question/10873737

#SPJ1

2log12 3 + 4log12 2 simplifying

Answers

Hello, I was happy to solve the problem. If you find a bug, post in the comments or click on the report, I will see it and try to fix it as soon as possible.

The answer to this problem: 2

2log12 3 + 4log12 2 simplifying

Your teacher needs to purchase some scientific calculators for $25 each and some graphing calculators for $65 each. Let x equal the number of scientific calculators and y equal the number of graphing calculators she buys She can only spend up to $800 for the calculators. Write an inequality that represents the number of each type of calculator she can buy.

Answers

The inequality that represents the number of each type of calculator she can buy will be 25x + 65y ≤ 800

Given that teacher needs to purchase some scientific calculators for $25 each and some graphing calculators for $65 each.

Consider that x equal the number of scientific calculators and y equal the number of graphing calculators she buys She can only spend up to $800 for the calculators.

The inequality that represents the situation becomes as;

25x + 65y ≤ 800

Learn more about inequality ;

brainly.com/question/14164153

#SPJ1

Find the value of y.

Find the value of y.

Answers

The value of y is 4√3

What are similar triangles?

Similar triangles have the same corresponding angle measures and proportional side lengths. The corresponding angles of similar triangles are congruent or equal.

Also , the ratio of corresponding sides of similar triangles are equal.

There are two triangles that are similar

Therefore;

y /16 = 4/y

y² = 48

y = √48

y = √16 × √ 3

y = 4√3

Therefore, the value of y is 4√3

learn more about similar triangles from

https://brainly.com/question/14285697

#SPJ1

Please help thank uuuuu

Please help thank uuuuu

Answers

Answer:

12

Step-by-step explanation:

You simply add the coefficients together.
3 + 4 + 5 = 12

What’s transformation is happening x,y ( x+2,y-3

Answers

The graph's curve "moves to the left/right/up/down," "expands or compresses," or "reflects" when a function is transformed.

What is transformation?

When a function is transformed, the graph's curve either "moves to the left/right/up/down," "expands or compresses," or "reflects." For instance, by simply moving the graph of the function g(x) = x² up by 3 units, the graph of the function f(x) = x² + 3 is obtained.

Given that the transformation of the coordinate is x,y ( x+2,y-3). Let the coordinate of the point be ( 2, 2 ).

The translation of the point will be:-

( 2 , 2 ) = ( 2 + 2 , 2 - 3 )

( 2 , 2 ) = ( 4 , -1 )

The graph of the translation of the point is attached with the answer below.

To know more about trnasformation follow

https://brainly.com/question/1548871

#SPJ1

Whats transformation is happening x,y ( x+2,y-3

Evaluate the expression 2l + 2w for l = 5.7 and w = 6.2.

Answers

Answer:

so 5.7 square root is 2.45 so minus that by 2K and you get 3.4

Step-by-step explanation:

The graph shows the printing rate of Printer A. Printer B can print at a rate of 25 pages per minute. How does the printing rate for Printer B compare to the printing rate for Printer A

The graph shows the printing rate of Printer A. Printer B can print at a rate of 25 pages per minute.

Answers

Answer:

The printing rate for Printer B is 10 pages more than the rate of printer A because the rate of 25 pages per minute is 10 pages more than the rate 15 pages per minute for Block A

Step-by-step explanation:

From the graph of the printing rate of Printer A, we can see that;

At 1 minute, number of pages printed = 15

At 2 minutes, number of pages printed = 30 minutes

At 3 minutes, number of pages printed = 45

Thus printing rate for printer A is; 15/1 = 30/2 = 45/3 = 15 pages per minutes

Since printer B can print 25 pages per minute, we can conclude that;

The printing rate for Printer B is 10 pages more than the rate of printer A because the rate of 25 pages per minute is 10 pages more than the rate 15 pages per minute for Block A

Malcolm has $50 gift card to a local car wash and order is the ultimate car wash each visit is $8.95

Answers

The amount cheaper is the car washes Malcolm orders than the car washes Martha's order is $13.

The correct answer choice is option B.

How much cheaper is the car washes Malcolm orders than the car washes Martha's order?

Malcolm's gift card = $50.

Cost Malcolm's car wash per visit = $7

Martha's gift card = $180

Cost Martha's car wash per visit = Difference between gift card balance of first and second visit

= $180 - $160

= $20

How cheap is the car washes Malcolm orders than the car washes Martha's order = $20 - $7

= $13

Therefore, Malcolm's car wash is cheaper than Martha's car wash by $13

The complete question is attached in the diagram.

Read more on graphs:

https://brainly.com/question/19040584

#SPJ1

Malcolm has $50 gift card to a local car wash and order is the ultimate car wash each visit is $8.95

27 points! please help me if you can <3 and yes I have been working on this for almost 4 hours

27 points! please help me if you can &lt;3 and yes I have been working on this for almost 4 hours

Answers

Answer:

330 milkshakes

Step-by-step explanation:

240 divided by 8 = 90

90 = number of large milkshakes

240 + 90 = 330

two glasses of milk and 4 snack bars have a total of 78 carbohydrates​ (carbs), and 4 glasses of milk and 3 snack bars have a total of 86 carbs. Determine how many carbs are in one glass of milk and in one snack bar.
there are ____ carbs in one glass of milk
there are ____ carbs in one snack bar

Answers

Step-by-step explanation:

Answer: there are 11 calories in one glass of milk and 14 calories in one snack bar.

Step-by-step explanation:

Take milk to to be M and snack bars to be S.

Use algebra, so

2m + 3s = 64 and also

4m + 2s = 72

Multiply the top equation by 2 so both have 4m, so

4m + 6s = 128 and also

4m + 2s = 72

Then minus the numbers form the top equation by the bottom equation, so

4m + 6s = 128

- - -

4m + 2s = 72

This gives you 4s=56 so divide by 4 so s=14

No put 14 into the equation for s and rearrange to solve for m, so

2m+3s=64 So

2m+3x14=64

2m+42=64

Then minus 42

2m=22

m=11

Here are two line segments with lengths e and f. Calculate the exact values of e and f. Which is larger? Use the Pythagorean Theorem: a^2 + b^2 = c^2

Answers

Just plug in the values, isolate the variables, then take the square root of the value

Sadie invested $13,000 in an account paying an interest rate of 2.3% compounded daily. Assuming no deposits or withdrawals are made, how long would it take, to the nearest tenth of a year, for the value of the account to reach $16,900?

Answers

Answer: 11.4 (on delta math)

Step-by-step explanation:

URGENT!!! Elementary school students were given a geometry assignment. They were to measure the area of several rectangles and to measure the diagonal of the rectangle as shown in the table.



The equation of the least-squares regression line is
ŷ = 3.6 + 0.113x, where ŷ is the diagonal and x is the area of the rectangle. Which shows the residual plot?

URGENT!!! Elementary school students were given a geometry assignment. They were to measure the area
URGENT!!! Elementary school students were given a geometry assignment. They were to measure the area
URGENT!!! Elementary school students were given a geometry assignment. They were to measure the area
URGENT!!! Elementary school students were given a geometry assignment. They were to measure the area

Answers

The plot of the residuals to the area indicates that the graph that corresponds to the residuals is the second option.

Please find attached the graph of the residual plot for the data created with MS Excel

What is a residual plot?

A residual plot is a tool used for assessment of statistical models, to determine how fit the model is to the data. A residual plot is a plot of the residuals to the input or x-values of the data.

The trend line for the data in the question obtained using MS Excel indicates that we get; y = 0.1128·x + 3.6158

The residuals, which is the difference between the actual values and the calculated value obtained using MS Excel are;

Area (in²)    \({}\)              Residuals

x-value

5 \({}\)                             -1.0178

10 \({}\)                           -0.2718

24 \({}\)                           0.605

46 \({}\)                           0.7874

53 \({}\)                           0.7018

78 \({}\)                           0.0758

84 \({}\)                           -0.129

100 \({}\)                         -0.7538

The above values for the areas and the residuals indicates that the residual plot is n shaped, with the first two values being below the x-axis, which corresponds to the second option

Learn more on residual values of a set of data here: https://brainly.com/question/31687998

#SPJ1

URGENT!!! Elementary school students were given a geometry assignment. They were to measure the area

. Suppose a government agency has a monopoly in the provision of internet connections.
The marginal cost of providing internet connections is 1
2
, whereas the inverse demand
function is given by: p = 1

Answers

The government agency as a monopolist will produce and sell internet connections up to the point where the marginal cost is 1/2. The price will be set at 1, given the perfectly elastic demand function.

In the scenario where a government agency has a monopoly in the provision of internet connections and the inverse demand function is given by p = 1, we can analyze the market equilibrium and the implications for pricing and quantity.

The inverse demand function, p = 1, implies that the market demand for internet connections is perfectly elastic, meaning consumers are willing to purchase any quantity of internet connections at a price of 1. As a monopolist, the government agency has control over the supply of internet connections and can set the price to maximize its profits.

To determine the optimal pricing and quantity, the monopolist needs to consider the marginal cost of providing internet connections. In this case, the marginal cost is given as 1/2. The monopolist will aim to maximize its profits by equating marginal cost with marginal revenue.

Since the inverse demand function is p = 1, the revenue received by the monopolist for each unit sold is also 1. Therefore, the marginal revenue is also 1. The monopolist will produce up to the point where marginal cost equals marginal revenue, which in this case is 1/2.

As a result, the monopolist will produce and sell internet connections up to the quantity where the marginal cost is 1/2. The monopolist will set the price at 1 since consumers are willing to pay that price.

For more such question on monopolist. visit :

https://brainly.com/question/28336090

#SPJ8

A store is having a sale on jelly beans and almonds. For 3 pounds of jelly beans and 5 pounds of almonds, the total cost is $27. For 9 pounds of jelly beans and
7 pounds of almonds, the total cost is $51. Find the cost for each pound of jelly beans and each pound of almonds.
Cost for each pound of jelly beans:
Cost for each pound of almonds:

Answers

Answer:

Cost for each pound of jelly beans:  $2.75

Cost for each pound of almonds:  $3.75

Step-by-step explanation:

Let J be the cost of one pound of jelly beans.

Let A be the cost of one pound of almonds.

Using the given information, we can create a system of equations.

Given 3 pounds of jelly beans and 5 pounds of almonds cost $27:

\(\implies 3J + 5A = 27\)

Given 9 pounds of jelly beans and 7 pounds of almonds cost $51:

\(\implies 9J + 7A = 51\)

Therefore, the system of equations is:

\(\begin{cases}3J+5A=27\\9J+7A=51\end{cases}\)

To solve the system of equations, multiply the first equation by 3 to create a third equation:

\(3J \cdot 3+5A \cdot 3=27 \cdot 3\)

\(9J+15A=81\)

Subtract the second equation from the third equation to eliminate the J term.

\(\begin{array}{crcrcl}&9J & + & 15A & = & 81\\\vphantom{\dfrac12}- & (9J & + & 7A & = & 51)\\\cline{2-6}\vphantom{\dfrac12} &&&8A&=&30\end{array}\)

Solve the equation for A by dividing both sides by 8:

\(\dfrac{8A}{8}=\dfrac{30}{8}\)

\(A=3.75\)

Therefore, the cost of one pound of almonds is $3.75.

Now that we know the cost of one pound of almonds, we can substitute this value into one of the original equations to solve for J.

Using the first equation:

\(3J+5(3.75)=27\)

\(3J+18.75=27\)

\(3J+18.75-18/75=27-18.75\)

\(3J=8.25\)

\(\dfrac{3J}{3}=\dfrac{8.25}{3}\)

\(J=2.75\)

Therefore, the cost of one pound of jelly beans is $2.75.

As part of a science experiment, Sam recorded the four values shown in the table, but one of them got smudged on his paper. He remembers that the sum of the trials was −1. What was the value that was smudged?
Trials
−9
12
(smudged)
−8

A) 2

B) −2

C) −4

D) 4

Answers

Answer:

C

Step-by-step explanation:

ok so sam started with 0 and got -9 then he got 12 then the next known number is -8 so those three numbers together are -5 and the end result was -1 so -1 minus -5 is -4 therefore the anser is C

CAN SOMEONE PLEASE HELP ME THIS IS DUE SOON!!

CAN SOMEONE PLEASE HELP ME THIS IS DUE SOON!!

Answers

Answer:

95 ft²

Step-by-step explanation:

Given:

regular pyramid with,

Square base of side length (s) = 5 ft

Slant height (l) = 7 ft

Required:

Surface area

Solution:

Surface area of a regular pyramid = ½*P*l + B

Where,

P = perimeter of the square base = 4(s) = 4(5) = 20 ft

l = slant height = 7 ft

B = area of base = s² = 5² = 25 ft²

Surface area = ½*20*7 + 25

= 10*7 + 25

= 70 + 25

Surface area of regular pyramid = 95 ft²

7 1/3 or 6 2/3 pls help

Answers

Answer:

7 3/3

Step-by-step explanation:

+3221654236583217089

2) An electronic gadgets distributor distributes various brands of mobiles to retailers.
The data for the number of smartphones distributed in nine months (Jan-Sep) are
collected to make a box-and-whisker plot. Read the plot and answer the questions.
H
20
30
40
a) Write the median from the above given plot.
b) What is the least number of smartphones distributed?
c) Write the third quartile from the given plot.
50
t>
60

Answers

The median is 40, the least number of smartphones distributed is 33, and the third quartile is 48.

What is the box and whisker plot?

A box and whisker plot is a method of abstracting a set of data that is approximated using an interval scale. It's also known as a box plot. These are primarily used to interpret data.

The question is incomplete.

The complete question is in the picture, please refer to the attached picture.

We have a box and whisker plot shown in the picture.

From the box plot, the line between the box ends represents the median of the data.

The median = 40

The least number of smartphones distributed = 33

Q3 = 48

Thus, the median is 40, the least number of smartphones distributed is 33, and the third quartile is 48.

Learn more about the box and whisker plot here:

brainly.com/question/3209282

#SPJ1

2) An electronic gadgets distributor distributes various brands of mobiles to retailers.The data for

Work out
74 x 58
What is 74x58

Answers

4292

Step-by-step explanation:

there happy that was easy to be honest

4,292

hope this helps

1)Find the quadratic equation
3(3x \( {}^{2} \)+ 1)=12x​
2)Find the quadratic equation
\(9y {}^{2} - 12y - 14 = 0\) ​

Answers

Step-by-step explanation:

"find" ?

the equations are already there.

do you mean solve in the sense of finding the zero points of the equations ?

if so,

the general solution of a quadratic equation is

x = (-b ± sqrt(b² - 4ac))/(2a)

3(3x² + 1) = 12x

9x² + 3 = 12 x

9x² - 12x + 3 = 0

a = 9

b = -12

c = 3

x = (12 ± sqrt(144 - 4×9×3))/18 = (12 ± sqrt(144-108))/18 =

= (12 ± sqrt(36))/18 = (12 ± 6)/18

x1 = (12 + 6) / 18 = 18/18 = 1

x2 = (12 - 6) / 18 = 6/18 = 1/3 = 0.3333333...

9y² - 12y - 14 = 0

same thing, we just use y instead of x.

a = 9

b = -12

c = -14

y = (12 ± sqrt(144 - 4×9×-14))/18 = (12 ± sqrt(144+504)/18 =

= (12 ± sqrt(648))/18 = (12 ± sqrt(324×2))/18 =

= (12 ± 18×sqrt(2))/18

y1 = (12 + 18×sqrt(2))/18 = 12/18 + sqrt(2) = 2/3 + sqrt(2) =

= 0.942809042...

y2 = (12 - 18×sqrt(2))/18 = 12/18 - sqrt(2) = 2/3 - sqrt(2) =

= -0.747546896...

of 2
Analysis Your friend says that the surface area of the prism is 148 square units. Use a net to find the correct surface area. What mistake might your friend have
5
3
17
4
(The figure is not to scale)

Answers

Using the net, the correct surface area of the prism is 216 square units

Using a net to find the correct surface area

From the question, we have the following parameters that can be used in our computation:

The triangular prism

Using the net, the surface area is

Surface area = Sum of areas of individual shapes

So, we have

Surface area = 2 * 1/2 * 3 * 4 + 17 * 5 + 17 * 4 + 17 * 3

Evaluate

Surface area = 216

Hence, the surface area of the prism is 216 square units

Read more about surface area at

https://brainly.com/question/26403859

#SPJ1

NEED HELP ASAP PLS AND THX PIC IS ATTACHED

NEED HELP ASAP PLS AND THX PIC IS ATTACHED

Answers

The trigonometric ratios for angle a are given as follows:

\(\sin{a} = \frac{3}{\sqrt{13}}\)\(\cos{a} = \frac{2}{\sqrt{13}}\)tan(a) = 3/2.

What are the trigonometric ratios?

The three trigonometric ratios are the sine, the cosine and the tangent, and they are defined as follows:

Sine of angle = length of opposite side to the angle divided by the length of the hypotenuse.Cosine of angle = length of adjacent side to the angle divided by the length of the hypotenuse.Tangent of angle = length of opposite side to the angle divided by the length of the adjacent side to the angle.

For this problem, the hypotenuse is of \(3\sqrt{13}\), while the side lengths relative to angle A are given as follows:

Opposite: 9.Adjacent: 6.

Hence the trigonometric ratios are given as follows:

\(\sin{a} = \frac{3}{\sqrt{13}}\)\(\cos{a} = \frac{2}{\sqrt{13}}\)tan(a) = 3/2.

More can be learned about trigonometric ratios at brainly.com/question/24349828

#SPJ1

prove that there exist only five regular polyhedron​

Answers

To prove that there are only these five regular polyhedra, we can consider Euler's polyhedron formula, which states that for any convex polyhedron, the number of vertices (V), edges (E), and faces (F) satisfy the equation V - E + F = 2.

Proving there exist Five Regular Polyhedron

The five regular polyhedra, also known as the Platonic solids, are the only convex polyhedra where all faces are congruent regular polygons, and the same number of polygons meet at each vertex.

The five regular polyhedra are:

1. Tetrahedron: It has four triangular faces, and three triangles meet at each vertex.

2. Cube: It has six square faces, and three squares meet at each vertex.

3. Octahedron: It has eight triangular faces, and four triangles meet at each vertex.

4. Dodecahedron: It has twelve pentagonal faces, and three pentagons meet at each vertex.

5. Icosahedron: It has twenty triangular faces, and five triangles meet at each vertex.

To prove that there are only these five regular polyhedra, we can consider Euler's polyhedron formula, which states that:

"for any convex polyhedron, the number of vertices (V), edges (E), and faces (F) satisfy the equation V - E + F = 2".

For regular polyhedra, each face has the same number of sides (n) and each vertex is the meeting point of the same number of edges (k). Therefore, we can rewrite Euler's formula for regular polyhedra as:

V - E + F = 2  

=>  kV/2 - kE/2 + F = 2  

=>  k(V/2 - E/2) + F = 2

Since each face has n sides, the total number of edges can be calculated as E = (nF)/2, as each edge is shared by two faces. Substituting this into the equation:

k(V/2 - (nF)/2) + F = 2  

=>  (kV - knF + 2F)/2 = 2  

=>  kV - knF + 2F = 4

Now, we need to consider the conditions for a valid polyhedron:

1. The number of faces (F), edges (E), and vertices (V) must be positive integers.

2. The number of sides on each face (n) and the number of edges meeting at each vertex (k) must be positive integers.

Given these conditions, we can analyze the possibilities for different values of n and k. By exploring various combinations, it can be proven that the only valid solutions satisfying the conditions are:

(n, k) pairs:

(3, 3) - Tetrahedron

(4, 3) - Cube

(3, 4) - Octahedron

(5, 3) - Dodecahedron

(3, 5) - Icosahedron

Therefore, there exist only five regular polyhedra.

Learn more about regular polyhedron here:

https://brainly.com/question/29134238

#SPJ1

Other Questions
what is 1/2 divided by 75.096868 find an equation for the plane consisting of all points that are equidistant from the points (7, 1, 1) and (3, 3, 5). Read "Sonnet to Twilight" by Helen Maria Williams. Then, respond to the prompt that follows.Meek Twilight! soften the declining day, And bring the hour my pensive spirit loves;When, o'er the mountain flow descends the ray That gives to silence the deserted groves.Ah, let the happy court the morning still, When, in her blooming loveliness array 'd,She bids fresh beauty light the vale, or hill, And rapture warble in the vocal shade.Sweet is the odour of the morning's flower, And rich in melody her accents rise;Yet dearer to my soul the shadowy hour, At which her blossoms close, her music dies For then, while languid nature droops her head,She wakes the tear 'tis luxury to shed.In a well-developed paragraph of at least five sentences, discuss how the poem's meaning is connected to the poet's choice of form.Identify the poem as a sonnet or a villanelle.Explain how the form, rhyme scheme, and other traits affect the poem's meaning.Describe the tone of the poem and provide textual support.Use academic language in your response. The images of Peter I and Catherine II of Russia best offerevidence of which of the following?A The emergence of constitutional-based monarchiesB The consolidation of European regional statesC The concept of rule by divine rightD The revival of classical Roman republicanism Please help I will mark branlyist a 4.00-kg object is moving east at 2.00 m/s when it collides with a 6.00-kg object that is initially at rest. after the collision the larger object moves east at 0.800 m/s. i need help!!look at the file attached please! What do the details of this poem reveal about the poets point of view towards being a grown man in the poem if >M12-LCMT-F D02.ab1CATGAATATTGTACGGTACCATAAA>M13-LCMT-F E02.ab1CATGAATATTGCACGGTACCATAAA >M14-LCMT-F F02.ab1CATGAATATTGTACGGTACCATAAA125 >M15-LCMT-F G02.ab1CATGAATATTGCACGGTACCATAAA ->M16-LCMT-F_H02.ab1CATGAATATTGTACGGTACCATAAA >M12-LCMT-F_D02.ab1TACTTGACCACCTGTAGTACATAAA M13-LCMT-F_E02.ab1TACTTGACCACCTGTAGTACATAAA >M14-LCMT-F_F02.ab1TACTTGACCACCTGTAGTACATAAA150 >M15-LCMT-F_G02.ab1TACTTGACCACCTGTAGTACATAAA>M16-LCMT-F_H02.ab1TACTTGACCACCTGTAGTACATAAA >M12-LCMT-F_D02.ab1AACCCAATCCACATCAAAACCCCCT >M13-LCMT-F_E02.ab1AACCCAATCCACATCAAAACCCCCT >M14-LCMT-F_F02.ab1AACCCAATCCATATCAAAACCCCCT175 >M15-LCMT-F_G02.ab1AACCCAATCCACATCAAAACCCTCC >M16-LCMT-F_H02.ab1AACCCAATCCACATCAAAACCCCCT >M12-LCMT-F_D02.ab1CCCCATGCTTACAAGCAAGTACAGC >M13-LCMT-F_E02.ab1CCCCATGCTTACAAGCAAGTACAGC >M14-LCMT-F_F02.ab1CCCCATGCTTACAAGCAAGTACAGC200 >M15-LCMT-F_G02.ab1CCCCATGCTTACAAGCAAGTACAGC >M16-LCMT-F H02.ab1CCCCATGCTTACAAGCAAGTACAGOcan you please compare the DNA sequences in this image, mark any insertion, deletion, polymorphism, and addition. Discuss about the yellow region in sequences and the nucleotides. discuss all the similarities and differences. I need a detailed description when aligning a rank of personnel what interval commands should you use Which frame forwarding method receives the entire frame and performs a crc check to detect errors before forwarding the frame?. fetzer company declared a $0.10 per share cash dividend. the company has 300,000 shares authorized, 285,000 shares issued, and 12,000 shares in treasury stock. the journal entry to record the dividend declaration is: multiple choice debit retained earnings $28,500; credit common dividends payable $28,500. debit common dividends payable $28,500; credit cash $28,500. debit retained earnings $30,000; credit common dividends payable $30,000. debit retained earnings $27,300; credit common dividends payable $27,300. debit common dividends payable $27,300; credit cash $27,300. just graduating from veterinary school and passing the test for her certification, siobhan is excited to begin using her new knowledge. she has learned about all kinds of animals in her training. siobhan joins a veterinary practice in a suburban area. although siobhan does, indeed, see different types of animals, which kind of animal will she see most often? Please put true or false 4 each one please answer this I really need help if you just take my points ill report I just need help pleassesssseessesesee!!!!!!!! (15 points!) Which of the following can we get from plant stems? A. flax seed B.cotton C.carrots D.hay IQ scores are normally distributed with a mean of 100 and a standard deviation of 15. What percentage of scores will fall between 70 and 115? You need tolightly when you are late so you wont wake up your parents.O treadO promoteO draughtO lair Kelvin company has 1 million outstanding shares of common stock and net earnings of 650,000. what are kelvin company's earnings per share? Please help will markA scientist uses the equation shown below to predict the future population of a species. In the equation, y represents the estimated population and trepresents the number of years.y=1504^tWhich number is closest to the value of y when t=3/2