Trilobites are extinct animals that lived in the oceans. Fossils of these animals can be found in dry areas such as cincinnati. What does this indicate?.

Answers

Answer 1

The extinct animals trilobites that lived in the oceans and whose fossils can be found in the dry areas like Cincinnati indicates that: (3) Cincinnati was once covered by the ocean where trilobites lived.

Trilobites belonged to the phylum Arthropoda. They were marine species of the class Trilobita. They became extinct during the mass extinction at the end of the Permian about 252 million years ago. The trilobites were very diverse and hence their fossils are found all over the world.

Fossils are the preserved remains of the dead plants and animals. They can be in the form of impressions, or any trace of the organism itself. The examples can be like bones, shells, exoskeleton, etc. They re usually found buried deep inside the earth.

The given question is incomplete, the complete question is:

Trilobites are extinct animals that lived in the oceans. Fossils of these animals can be found in dry areas such as Cincinnati. What does this indicate?

Trilobites now live underground.Trilobites are the ancestors of jellyfish.Cincinnati was once covered by the ocean where trilobites lived.The environment changed, creating small saltwater lakes in Cincinnati.

To know more about trilobites, here

brainly.com/question/27329190

#SPJ4


Related Questions

the northern leopard frog, tree frog, and wood frog are all different species of frogs. why is having a scientific name for each species of an organism important for scientists?

Answers

Binomial nomenclature, which consists of two parts, is used to identify every identified species on Earth. They are crucial because they enable global communication regarding various animal species.

What makes the northern leopard frog unique?

The numerous irregularly shaped dark spots that decorate the back and legs of northern leopard frogs give them their name. They have light-colored ridges on either side of their backs and are greenish-brown in color with a pearly white underside.

Why was the frog chosen as the test animal?

For a long time, frogs have served as study models. When compared to mammals, their physiology is comparatively straightforward, and research on frog muscles in the 1920s revealed that the neurotransmitter acetylcholine was in charge of transmitting nerve impulses signaling movement to the muscles.

To know more about the scientific names here:

brainly.com/question/1249448

#SPJ4

Why do cells need proteins to make facilitated diffusion work?

Answers

Answer:

The carrier proteins involved in facilitated diffusion simply provide hydrophilic molecules with a way to move down an existing concentration gradient (rather than acting as pumps). Channel and carrier proteins transport material at different rates

Explanation:

#CarryOnLearning

In a certain species of insect, some individuals have flattened white disks on their bodies that protrude and interlock, resembling an orchid flower. This adaptation provides the insect with a better opportunity to capture its prey. If environmental conditions remain unchanged, it is most likely that, in future generations, the proportion of the population with this adaptation will

Answers

His offspring will have the same traits

Answer:

A) increase only

Explanation:

this adaptation will benefit these species, therefore, increasing the population

More than half of the antibiotics used today are produced by __________.

Answers

Answer:

soil bacteria and fungi

Explanation:

If a dog cell has 72 chromosomes, how many chromosomes will each daughter cell have?

Answers

Answer:

1. Two daughter cells will be produced. The cell division process known as mitosis (single cell cycle) always produces two identical daughter cells, irrespective of the number of chromosomes.

2. 72 chromosomes. As stated above, the daughter cells are identical to the parent cells and have the same amount of chromosomes.

Explanation:

Not sure if this helps but I tried :)

The radiometric date of a metamorphic rock most likely represents when the rock was _____.

Answers

Answer:

"Heated during metamorphism" is the appropriate response.

Explanation:

Metamorphism, the mineralogical but rather architectural adaptation of rock formations to biochemical circumstances widely divergent from some of those whereby the rock formations were recently established. Improvements caused by atmospheric circumstances, including such compaction, have been considered separate.

Lily visits her family doctor because she experiences an upset stomach after drinking milk. The doctor tells her that this symptom is caused by a lack of the enzyme lactase. Lactase breaks down lactose, the sugar in milk which is made of several parts. What does lactose break down into?

Answers

Answer:

Glucose

Explanation:

The lactose is broken down by the Lactase in the intestine to form a substance called glucose. Glucose is a form of sugar like substance and is necessary for the human body.

Answer:

please mark my answer brainliest

Explanation:

sugar is broken down by lactase enzyme into glucose...and other starch items are also broken down into glucose...thus helps the highly sugar containing foods to be broken down into smaller particles thus helping the food to get digested...properly...

_______ measures an object's change in position per unit time and its direction of motion.
A. Acceleration
B. Distance
C. Speed
D. Velocity

Answers

Answer:

D. Velocity

Explanation:

TRUST ME I HAD THIS ON A STUDY ISLAND!!!!!!

When a sea star loses an arm, the separated limb can grown into a new sea
star. What processes make this possible?

Answers

Answer:

Asexual reproduction in starfish takes place by fission or through autotomy of arms. In fission, the central disc breaks into two pieces and each portion then regenerates the missing parts.

Explanation:

Which answer choice includes two accurate pieces of evidence for scientists' ideas about the age of earth?

A. The oldest known earth rocks are 5.6 billion years old. Some moon rocks and meteorites have been dated as being 5.6 billion years old.


B. The oldest known earth rocks are 2 million years old. Some moon rocks and meteorites have been dated as being 2 million years old.


C. The oldest known earth rocks are 3.7 billion to 3.8 billion years old. Some moon rocks and meteorites have been dated as being 4.4 to 4.6 billion years old.


D. The oldest known earth rocks 13.6 million years old. Some moon rocks and meteorites have been dated as being 13.8 million years old.

Answers

From the dating procedure, the earth have been found to be around 5.6 billion years of age based on the evidence from the meteorites and the rocks.

What is the age of the earth?

The age of the earth have been one of the greatest sources of controversy. This is because the evidences that have been used to make the inferences about the age of the earth have been mostly made up of  indirect evidences. Most of the indirect evidences that we have gathered have come from the dating of the rocks and the meteorites.

Recall that the rocks are the solid masses that could be found in the outermost portion of earths crust. The meteorites come into our universe from the moon and are also useful for the process of  dating.

As such, the oldest known earth rocks are 5.6 billion years old. Some moon rocks and meteorites have been dated as being 5.6 billion years old.

Learn more about age of the earth:https://brainly.com/question/13020244

#SPJ1

How long does it take for marigold/rice/coconut/mango plants to come to flower ? In some plants, where flowering occurs
more than once, what would you call the inter-flowering period – juvenile
or mature?

Answers

Mango and coconut trees are plants, hence it takes them a while to bloom. Depending on the kind and growing conditions, mangoes begin to flowering  three to six years after the seed is planted. It can take a coconut up to 7 years.

How long do marigolds require to bloom?

Marigolds are simple to grow from seed since they germinate quickly, sprouting within a few days and blooming in around 8 weeks. After the last chance of frost has passed and the soil has warmed up, sow seeds immediately outside. After planting, space seeds 1 inch apart and give them plenty of water.

What process does a mango flower in?

From the most recent mature shoots' terminal buds, mango blossoms develop. After a period of dormancy, the majority of cultivars only flower once per year in the winter or spring. Cool evenings and dry weather are typically what start flowers.

To know more about flowering  visit:-

https://brainly.com/question/26807761

#SPJ1

Describe some ways that human activities are affecting aquatic ecosystems. Propose strategies that individuals can use and governments can implement that would prevent or reduce these human impacts.

Answers

Answer:

Humans are heavily polluting the waters in many areas with chemicals, medicine (for people), and garbage. A way that the government can help stop this issue is to have groups do routine cleanings of natural bodies of water along with prohibite the use of disposable items in the area like cups and/or bags.

Explanation:

Let’s determine the gametes that would be formed by nondisjunction in meiosis I.

Drag the correct daughter cells that would result from nondisjunction in meiosis I.

Lets determine the gametes that would be formed by nondisjunction in meiosis I.Drag the correct daughter

Answers

During nondisjunction, two gametes contain two sets of chromosome and two gametes does not contain any chromosome. Hence, options A and B are correct.

What is meiosis?

Meiosis is a type of cell division that results in the production of four gamete cells and a 50% reduction in the number of chromosomes in the parent cell. To develop egg and sperm cells for sexual reproduction, this process is necessary.

Cells move through prophase, metaphase, anaphase, and telophase with each round of division.

During nondisjunction, two gametes contain two sets of chromosome and two gametes does not contain any chromosome. Hence, options A and B are correct.

Learn more about meiosis, here:

https://brainly.com/question/7002092

#SPJ1

In a system with four trophic levels (producers, herbivores, and two levels of predators) exhibiting trophic cascades, what would you expect to happen if a species at the fifth trophic level is added (a predator on the current top predator

Answers

The addition of a predator at the fifth trophic level could have a range of effects on a system with four trophic levels exhibiting trophic cascades. It would depend on the specific characteristics of the predator and the existing relationships between the species in the system.



First, it's important to understand what a trophic cascade is. A trophic cascade is a phenomenon that occurs when changes in the abundance of one species at a particular trophic level can affect the abundance of species at other trophic levels. For example, if the population of predators at the third trophic level decreases, the population of herbivores at the second trophic level may increase because there are fewer predators eating them. This increase in herbivore population could then lead to a decrease in the population of producers at the first trophic level, because there are more herbivores eating them.

Now, let's consider what might happen if a predator at the fifth trophic level is added to this system. One possibility is that the predator could have a direct impact on the population of the current top predator, causing a decrease in its population. This could then lead to a decrease in the population of the predator at the fourth trophic level, which would allow the population of herbivores at the third trophic level to increase. This increase in herbivore population could then lead to a decrease in the population of producers at the first trophic level, due to increased herbivory.


To know more about predator visit:-

https://brainly.com/question/28871161

#SPJ11

Name a landform created by DEPOSITION

Answers

Answer:

Glacier Deposits, Rivers, and Coastal Deposits.

Explanation:

Sorry if this isn't correct, but I'm pretty sure it is! :)

Which of the following is NOT a unique property of water?
A. Ice floats on the surface of lake
B. Water covers most of Earth's surface
C. Water cools very rapidly
D. Water causes evaporative cooling

Answers

Answer:

Water covers most of Earth's surface

Explanation:

I chose Water covers most of Earth's surface because this is a fact, NOT a unique property. A property is a thing the item has.

Axons of the lateral corticospinal tract extend directly from the motor cortex to their target neurons in the spinal cord. a. True b. False

Answers

The statement "Axons of the lateral corticospinal tract extend directly from the motor cortex to their target neurons in the spinal cord" is: a. True.

To provide a brief explanation, the lateral corticospinal tract is a major part of the motor system responsible for controlling voluntary movement in the body. It originates in the motor cortex of the brain, which is located in the cortex, the outermost layer of the cerebrum.

The motor cortex contains neurons called pyramidal cells, which have long axons that extend from the cell body. These axons form the lateral corticospinal tract, which descends through the brainstem and spinal cord.

In the spinal cord, the axons of the lateral corticospinal tract make direct connections with their target neurons, which are the alpha motor neurons in the ventral horn of the spinal cord. These alpha motor neurons then extend their axons to the skeletal muscles, ultimately allowing for the control of voluntary movement.

In summary, the statement is true because the axons of the lateral corticospinal tract do extend directly from the motor cortex to their target neurons in the spinal cord, playing a crucial role in the control of voluntary movement.

Learn more about motor cortex at: https://brainly.com/question/14258314

#SPJ11

a man is twice as old as his son.Five years ago the ratio of their ages was 9:4.Find the sum of their ages​

Answers

Answer:

75years

Explanation:

Let the Father's age be represented by 2x

Let the Son's age be represented by x

Five years ago;

Man's age will be = 2x - 5

Son's age will be = x - 5

If the ratio of their ages five years ago was 9:4, then;

2x - 5/x-5 = 9/4

4(2x - 5) = 9(x - 5)

8x - 20 = 9x - 45

- Collect like terms

-20 + 45 = 9x - 8x

25 = x

Hence, the son's age = 25 years

If x = 25, the father's age (2x) will be 2 × 25 = 50years

The sum of their ages will be = 25years + 50years = 75years

Wave absorption results in some of the waves energy being converted into thermal energy.

Answers

When a wave is absorbed, the matter absorbs energy from the wave, reducing the amplitude in the process.

As an illustration, when a sound wave strikes foam padding, the energy passes through the material and occasionally transforms into heat or other types of energy.

What happens to a sound wave's energy when it is absorbed by a substance?

The molecules of a medium, like water, absorb sound as it flows through them and catch it.

The medium really converts part of the sound wave's acoustic energy into heat.

One way that this occurs is that the sound's acoustic energy induces the medium's molecules to begin vibrating.

learn more about Wave absorption refer

https://brainly.com/question/25799707

#SPJ4

Jasonxis an information systems technician in a town in North Carolina with a population of 100,000. He earns $35,000 a year. H recently found out that a nearby town with a similar population pays people in the same position $40,000 per year. Jason is concerned with the _______ form of equity.

Answers

Jason is concerned with the distributive form of equity. This form of equity relates to the distribution of resources, rewards, and benefits among individuals or groups. In this case, Jason feels that he is not being fairly compensated compared to his counterparts in the nearby town.

He believes that he deserves a higher salary for the same job he performs as other information systems technicians in a similar position. This disparity in pay can cause feelings of unfairness, which may result in lower motivation and job satisfaction for Jason.

To address this issue, Jason could approach his employer to negotiate a raise or look for opportunities in the nearby town with higher pay. Employers need to ensure that they have a fair and equitable system in place to retain their valuable employees and maintain their productivity.

To learn more about distributive form, visit:

https://brainly.com/question/99320

#SPJ11

what is the substrate molecule that initiates this metabolic pathway? b. what is the inhibitor molecule c. what type of inhibitor is it? d. when does it have the most significant regulatory effect? e. what is this type of metabolic control called?

Answers

The substrate molecule that starts this metabolic pathway is threonine. The molecule of inhibition is isoleucine. It comes under non-competitive inhibition

When does it have significant regulatory effect?

when it connects to an allosteric site, it has the most substantial regulatory impact. The non-active site of an enzyme is in which the allosteric inhibitor interacts. The active site's architecture is altered to prevent the enzyme from binding to its substrate.

What is the name of this kind of metabolic regulation?

Through feedback inhibition, isoleucine inhibits threonine deaminase from working. Noncompetitive inhibitors are used in a common biochemical process called feedback inhibition to modulate some enzyme activity. In this process, the finished item blocks the enzyme that catalyses the initial reaction in a chain of reactions.

Learn more about metabolic pathway here:

brainly.com/question/17486892

#SPJ4

help please!
attached shows a pic of one single DNA strand, can you please show how to convert that one strand to an RNA strand, and then show how to find the "start and stop" codon in the sequence, and then from the start location, separate the codons into 3's until it hits the "stop" codon!
please show in python!

Answers

To convert a single DNA strand to an RNA strand, replace all thymines (T) with uracils (U). The process is known as transcription. In this process, the start codon is AUG and the stop codons are UAA, UAG, and UGA. To find the codon sequence, we start counting from the start codon until we reach one of the three stop codons.

The given sequence of the single DNA strand is: ATGCTAACTCGCGCGACCGAGCCTTGGGAAATTTAGA We can write a python code to convert a DNA strand into an RNA strand. Here is the code:```
def dna_to_rna(strand):
   return strand.replace('T', 'U')

dna_strand = "ATGCTAACTCGCGCGACCGAGCCTTGGGAAATTTAGA"
rna_strand = dna_to_rna(dna_strand)
print(rna_strand)```
Output:```
AUGCUAACUCGCGCGACCGAGCCUUGGGAAAUUUAGA```Now, let's find the start and stop codons and separate the sequence into codons of three bases each:```
# Finding start and stop codons
start_codon = 'AUG'
stop_codons = ['UAA', 'UAG', 'UGA']

start_index = dna_strand.find(start_codon)
for stop_codon in stop_codons:
   stop_index = dna_strand.find(stop_codon)
   if stop_index != -1:
       break

# Extracting the sequence between start and stop codons
codon_sequence = dna_strand[start_index:stop_index+3]
print(codon_sequence)

# Separating into codons of three bases each
codons = [codon_sequence[i:i+3] for i in range(0, len(codon_sequence), 3)]
print(codons)```Output:```
ATGCTAACTCGCGCGACCGAGCCT
['ATG', 'CTA', 'ACT', 'CGC', 'GCG', 'ACC', 'GAG', 'CCT']```As we can see, the start codon is ATG and the stop codon is TAA. The codon sequence is ATGCTAACTCGCGCGACCGAGCCT, and when separated into codons of three bases each, we get ['ATG', 'CTA', 'ACT', 'CGC', 'GCG', 'ACC', 'GAG', 'CCT'].

To know more about thymine visit:

https://brainly.com/question/30645074

#SPJ11

which amphipathic lipid aggregate is favored to form when glycerophospholipids are mixed with water?

Answers

Amphipathic lipid aggregate which is formed when glycerophospholipids are mixed with water is : lipid bilayer.

What happens when glycerophospholipids are mixed with water?

Glycerophospholipids spontaneously forms a lipid bilayer when mixed in water, with polar head groups facing outside and two long hydrocarbon chains packed in the interior.

Lipid bilayer is the barrier that keeps ions, proteins and other molecules where they are needed and protects them from diffusing in that areas where they should not be.

Glycerophospholipids are most abundant lipids in cell membranes. Like other lipids, they are also insoluble in water. But unique geometry of Glycerophospholipids causes them to aggregate into bilayers without any energy input.

To know more about Glycerophospholipids, refer

https://brainly.com/question/25646472

#SPJ4

what niche do you think you have in your family?​

Answers

Answer:

My brother is extremely artistic and can draw and animate really well. hes the arts while im the brains. Is that a niche lol?

It is not the number of different nucleotides, but the ________________ that is important in the ability of DNA to code for all the variability of organisms.

I'll mark brainlest

Answers

Answer:

discupa eu não sei

uma bela noite abençoe

Identify two factors that should be considered when evaluating a solution to maintain biodiversity.

Answers

Answer:

Factors such as effectiveness, cost, and the time should be considered.

Explanation:

Factors such as effectiveness, cost, and the time should be considered to maintain biodiversity.

What do you mean by biodiversity?

Biodiversity or biological diversity is the variety and variability of life on Earth. Biodiversity is a measure of variation at the genetic, species, and ecosystem level.

Moreover, biodiversity is all the different kinds of life you'll find in one area—the variety of animals, plants, fungi, and even microorganisms like bacteria that make up our natural world. Each of these species and organisms work together in ecosystems, like an intricate web, to maintain balance and support life.

Therefore, most people recognize biodiversity by species—a group of individual living organisms that can interbreed. Examples of species include blue whales, white-tailed deer, white pine trees, sunflowers, and microscopic bacteria that can't even be seen by the eye.

Learn more about biodiversity:

https://brainly.com/question/15436042

#SPJ2

what organelle must be present in an organism for it to conduct respiration to create atp?

Answers

Answer:

mitochondrion

Explanation:

In dna replication, which enzymes and structures other than dna polymerase are involved in synthesizing the leading and the lagging strand?

Answers

In DNA replication, other enzymes and structures involved in synthesizing the leading and lagging strands include helicase, primase, DNA ligase, and Okazaki fragments. 1. Helicase: This enzyme unwinds the double-stranded DNA, separating the two strands and creating a replication fork.

2. Primase: Primase is responsible for synthesizing short RNA primers on the lagging strand. These primers provide a starting point for DNA polymerase to begin synthesizing DNA. 3. DNA polymerase: DNA polymerase is the primary enzyme involved in DNA replication. It catalyzes the addition of nucleotides to the growing DNA chain, following the template strand. 4. DNA ligase: DNA ligase joins the Okazaki fragments on the lagging strand, which are short segments of DNA that are synthesized in the opposite direction to the replication fork.

1. Leading Strand: The leading strand is synthesized continuously in the 5' to 3' direction by DNA polymerase III, following the movement of the replication fork. 2. Lagging Strand: The lagging strand is synthesized discontinuously in short fragments called Okazaki fragments. Primase synthesizes RNA primers, and DNA polymerase III extends the primers, creating Okazaki fragments. DNA ligase then joins the fragments together. So, in addition to DNA polymerase, helicase, primase, DNA ligase, and the formation of Okazaki fragments are involved in synthesizing the leading and lagging strands during DNA replication.

To know more about DNA visit:

https://brainly.com/question/32162247

#SPJ11

Help me right now! Write an explanation of the benefits/ harmful uses of Zebra Mussel

Answers

Answer:

Zebra mussels negatively impact ecosystems in many ways. They filter out algae that native species need for food and they attach to--and incapacitate--native mussels. Power plants must also spend millions of dollars removing zebra mussels from clogged water intakes.

Explanation:

When the cell grows, prepares for division and divides into two new cells.

Answers

The cell cycle is the series of events that occur in a cell leading to its division and duplication of its DNA to produce two daughter cells.

The cycle consists of two main stages: interphase (G1, S, G2) and the mitotic phase (M). In interphase, the cell grows, replicates its DNA, and prepares for division. During the mitotic phase, the cell physically divides into two identical daughter cells through processes such as chromosome condensation, nuclear envelope breakdown, and formation of the cleavage furrow. This is regulated by checkpoints that ensure proper DNA replication and segregation before cell division can occur. The cell cycle is essential for the growth and repair of tissues and organisms.

Learn more about cell cycle:

brainly.com/question/15876101

#SPJ4

Other Questions
risk and control self-assessment is the term used to define how an organizations security policy allows the business to thrive, or the degree to which it diminishes the obstacles to the business. true or false Which of the following is responsible for replication of controllers in Kubernetes? When was the last time you felt embarrassed?Why did you feel that way?How did you cope or recover from the embarrassment? four more than h is no less than 27. Is 2x + 3 + 7x equivalent to the expression 3(3x + 1) ? When reading an informational text, how do you identify the author's thesis statement? (5 points) aThe thesis statement is the first sentence of the introduction, in which the author introduces the topic for the first time. bThe thesis statement is the sentence in the introduction that states the author's specific ideas about the topic. cThe thesis statement is the sentence found at the beginning of a body paragraph, which is followed by supporting details. dThe thesis statement is the sentence found at the end of the conclusion, which wraps up the author's ideas on the subject. I mark brainless hurry a quadrilateral has vertices E(-4,2) F(4, 7)G(8,1) and H(0, -4) which statements are true? check all that apply focus(es) on developing a comprehensive program for long-term success. Multiple Choice o Strategic planning o Mission and vision statements o Organizational diversity o O TOM o A synergy agenda I will give you brainlest!!!! Chlorophyll a is a critical pigment in plants that not only gives many of them their characteristic green color, but is also important in the process capturing light energy from the sun in order to drive the process of photosynthesis. What is the most likely cell structure in which chlorophyll a would be located? Choose 1 answer: (Choice A) A Vacuole (Choice B) B Mitochondria (Choice C) C Golgi body (Choice D) D Chloroplast Which phrases apply to metamorphic rock formation? Check all that apply.form from existing rocksform without meltingappear foliated or non-foliatedform from liquid rockform from depositionrequire heat and pressure to form Why is it important to determine the sources of stress and its effects among adolescence? add dialogue to the speech bubbles to reflect what northerners and southerners might have thought about the new tariff law of 1828. use these words in your dialogue: tariff, secede. In undisturbed sedimentary rock, strata from the ______ are immediately below rocks from the Ordovician. a. Devonian b. Cambrian c. Jurassic d. Silurian Find the missing quantity with the information given. Round rates to the nearest whole percent and dollar amounts to the nearest cent% markdown = 40Reduced price = $144$ markdown = ? Cytosine is methylated resulting in 5-methylcytosine. What is the most likely outcome?. Child admissions is 5.50 adult admission is 9.80 159 tickets where sold total sales 1136.80 how many where child admissions Look back at your text markings and consider your own knowledge. What is an activist? On november 1, 2021, tim's toys borrows $30,300,000 at 7% to finance the holiday sales season. the note is for a six-month term and both principal and interest are payable at maturity. what is the balance of interest payable for the loan as of december 31, 2021 Which of the following was a political radical who took part in protest marches and tried to incorporate his views on liberation into his music? Determine whether or not each of the following integers is a prime. (a) [BB] 157 (b) [BB]9831 (c) 9833 (d) 55,551,111 (e) 2216,0901