Answer:
T is 9s.
Explanation:
In power formula Power (P) = work done(W)/time (t) . Make time(T) the subject.
Therefore time is work done÷ power
Time (T) = 225J÷25W
Time(T) = 9s
Therefore T is 9s.
2.56x10-3 to m,cm,gm,mm and nm
Answer:
need help search it up
Explanation:
hehe..
10. Duncan needs to lift a 31.0kg rock. If he exerts an upward force of 500 N on the rock, what is the rock's acceleration?
Explanation:
(taking g = 10 m/s^2)
F - W = m * a
500 - 310 = 31 * a
190 = 31 * a
a (Acceleration of rock ) = 6.12 m/s^2
Why does Mars provide the best opportunity for habitation by humans?
Answer:
Mars is an opportunity for humans to carry forward the light of consciousness, plus it is the closest planet like earth, it has land humans can land on and although its small, theres still water
1. A force of ION causes aspring to extend by 20mm. find A.the spring constant of the spring in N/m
B.the extentsion of the spring in N/m
C. the force applied that causes an externos Of 9mm.
Answer:
F = - k x restoring force for spring constant k
k = F / x = 10 N / .02 m = 500 N / m force and x are in different directions
B. N / m = force / distance given as k
x = F / k = 10 N / 500 N / m = .02 m
C. F = -k x = 500 N / m * .009 m = 4.5 N
To the right are U vs t and KE vs t graphs of a mass oscillating back and forth on a spring attached to a wall. At 2.7 seconds the U = 48 J and KE = 20 J
a) find the potential energy at t = 1.0 seconds.
b) find the kinetic energy at t=3.6 s if the potential is 40 J at 3.6 s
The potential energy is 68 J.
The kinetic energy is 28 J.
How to find potential and kinetic energy?Since U + KE is constant throughout the motion of the mass, use this fact to answer both parts of the question.
a) At t = 2.7 seconds, U = 48 J and KE = 20 J, so the total energy is U + KE = 68 J. At t = 1.0 seconds, the kinetic energy is zero because the mass is momentarily at rest, so the potential energy must be U = 68 J - KE = 68 J - 0 J = 68 J.
b) At t = 3.6 seconds, the potential energy is U = 40 J. Using the fact that U + KE = constant, we can find the kinetic energy at this time:
U + KE = constant
40 J + KE = 68 J
KE = 68 J - 40 J = 28 J
Therefore, the kinetic energy at t = 3.6 seconds is 28 J.
Learn more on potential and kinetic energy here: https://brainly.com/question/18683052
#SPJ1
Find the angular acceleration of a spinning amusement-park ride that initially travels at 0.50 rad/s then accelerates
to 0.60 rad/s during a 0.50 s time interval.
The angular acceleration of a spinning amusement park ride is 0.2 rad/s^2.
What does circular motion's angular acceleration mean?The pace at which an object moving in a circle changes angular velocity over time is referred to as angular acceleration. Rotational acceleration is another name for angular acceleration. It has both magnitude and direction, making it a vector quantity.
What are angular acceleration and angular velocity?The rate of change in angular displacement is known as angular velocity, and the rate of change in angular velocity is known as angular acceleration.
What is the name for zero acceleration?Zero magnitude acceleration is still acceleration. Motion with uniform (i.e. zero) acceleration is a specific case of motion with constant velocity.
Given:
Initial acceleration = 0.50 rad/s
Final acceleration = 0.60 rad/s
Time = 0.50 s
Angular Acceleration:
α = Δω/Δt
\(\alpha = \frac{0.60-0.50}{0.50}\)
\(\alpha =\frac{0.1}{0.50}\)
\(\alpha =0.2rad/s^2\)
To know more about angular acceleration visit:
https://brainly.com/question/21278452
#SPJ1
Drew likes to take the long way to school each morning. He walks 3 blocks west and then 3 blocks north to arrive at the school. Today he is running late and decides go directly to school to save time. (Assume there is nothing obstructing his path.) If one block is 310 feet, how many feet will he travel if he goes directly to school
If one block is 310 feet, he will travel 1,315.21 feet if he goes directly to school.
What is foot?The British imperial and American customary systems of measurement both use the foot as a unit of length (standard symbol: ft). One alternate symbol that is frequently used is the prime symbol, ′. Since the International Yard and Pound Agreement of 1959, one foot is precisely equal to 0.3048 metres. One foot equals 12 inches in both customary and imperial units, while one yard equals three feet.
The "foot" has historically been a component of numerous regional systems of units, including the Greek, Roman, Chinese, French, and English systems. It varied in length from nation to nation, city to city, and occasionally trade to trade. Its length was typically between 250 mm and 335 mm, and it was typically, but not always, divided into 12 inches.
Given that:
Total block in north = 3
Total block in west = 3
1 block = 310 feet
Then,
Total distance in north = 3 × 310 = 930 feet
Total distance in west = 3 × 310 = 930 feet
Distance travelled by Drew = √(Total distance in north² + Total distance in west²)
Distance travelled by Drew = √(930² + 930²)
Distance travelled by Drew = √(864,900 + 864,900)
Distance travelled by Drew = √1,729,800
Distance travelled by Drew = 1,315.21 feet
Thus, If one block is 310 feet, he will travel 1,315.21 feet if he goes directly to school.
Learn more about feet
https://brainly.com/question/15658113
#SPJ4
Aball is thrown upward and outward from a height of 6 feet. The height of the ball, f(x), in feet, can be modeled by f(x) = — 0.1x2 +1.4x+ e where x is the ball's horizontal distance, in feet, from where it was thrown. Use this model to solve parts (a) through (c). O M a. What is the maximum height of the ball and how far from where it was thrown does this occur? The maximum height is 10.9 feet, which occurs 7 feet from the point of release. .(Round to the nearest tenth as needed.) . b. How far does this ball travel horizontally before hitting the ground? El feet (Round to the nearest tenth as needed.)
The given equation, f(x) = -0.1x^2 + 1.4x + e, models the height of a ball thrown upward and outward from a height of 6 feet, where x represents the horizontal distance in feet from where the ball was thrown. Let's solve parts (a) through (c) using this model.
To find the maximum height of the ball and the distance from where it was thrown, we need to determine the vertex of the quadratic equation. The vertex can be found using the formula x = -b / 2a. In this case, a = -0.1 and b = 1.4.
\(x = -1.4 / (2 * -0.1) = 7\)
The maximum height occurs at x = 7. Substituting this value into the equation gives us:
\(f(7) = -0.1(7)^2 + 1.4(7) + e\)
=\(-0.1(49) + 9.8 + e\)
=\(-4.9 + 9.8 + e\)
= \(4.9 + e\)
So, the maximum height of the ball is 4.9 feet + 6 feet (initial height) = 10.9 feet. It occurs 7 feet from where the ball was thrown.
To know more about horizontal visit:
https://brainly.com/question/29019854
#SPJ11
A rollercoaster travels with a velocity of 12.5 m/s. the rollercoaster takes 4.5 seconds to travel up a steep ramp and the velocity changes to 6.2 m/s. what is the rollercoaster's average acceleration
The rollercoaster's average acceleration is - 1.4 m/s²
Initial velocity, \(V_{1}\) = 12.5m/s
Final velocity ,\(V_{2}\) = 6.2m/s
Time taken = 4.5 sec
acceleration = rate of change of velocity
A(avg) = dV / dt
dV = Final velocity - initial velocity
\(dV =\) \(V_{2} -V_{1}\)
= 6.2m/s - 12.5m/s
= - 6.3m/s²
A(avg) = -6.3m/s / 4.5 s
A(avg) = - 1.4 m/s²
The negative sign indicates that the object is slowing down.
To know more about acceleration :
https://brainly.com/question/11632129
#SPJ4
4.25 a person gives a box a shove so that it slides up a ramp, then it reverses its motion and slides down. The direction of the force of friction is
A always down the ramp
B up the ramp and then down the ramp
c always down the ramp
d down the ramp and then up the ramp
The requried, direction of the force of friction is down the ramp and then up the ramp. Option D is correct.
The direction of the force of friction depends on the direction of motion of the box and the surface it is sliding on. When the box is sliding up the ramp, the force of friction acts in the opposite direction to the motion of the box, which is down the ramp. This is because the frictional force always opposes the relative motion between two surfaces in contact.
When the box reverses its motion and slides down the ramp, the direction of the force of friction also reverses, acting in the opposite direction to the motion of the box, which is up the ramp.
Thus, the correct option is (D) down the ramp and then up the ramp.
Learn more about the force of friction here:
https://brainly.com/question/30280752
#SPJ1
a fictional news report stated that starship enterprise had just returned from a 10-year voyage while traveling at 0.70ccpart a if the report meant 10 years of earth time, how much time elapsed on the ship? part a if the report meant 10 years of earth time, how much time elapsed on the ship?(in years) part b if the report meant 10? years of ship time, how much time passed on earth?(in years)
10.416 years passed on the spacecraft if the report represented 10 years in earth time.
5.6 years would have elapsed on Earth if the report had indicated 10 years of ship time.
Δt =t₀÷ m
t = time
₍1÷√1-v²÷c²₎
Δt= 1÷ √1-₍1÷0.7₎²
Δt=0.56 t₀
1) Δt = 0.56 t₀
10= 0.56 t₀
t₀= 10.416 years
2) Δt =0.56 t₀
Δt =0.56× 10
Δt = 5.6 years
Earth: the world, the planet on which we reside,
Spacecraft : an object utilized for space travel.
To know more about elapsed visit this:
https://brainly.com/question/29775096
#SPJ4
To which category does galaxy #2 belong? Why does it belong in this category?
Galaxy #2 belongs to spiral. This is because it has a bulge at the centre, a disk as well as the curved arms. Contains both Young and Old stars - contains gas and dust - contains more red giants and red supergiant's than disk - some regular rotation about centre.
What Is Dark Matter?Dark matter is a form of matter thought to account for approximately 85% of the matter in the world. Dark matter consists of particles that do not absorb, reflect or emit light, so they cannot be detected by observing electromagnetic radiation. Dark matter is material that cannot be directly seen. We know dark matter exists because it affects objects we can directly observe.
To learn more about Dark Matter, visit;
https://brainly.com/question/11226283
#SPJ13
Molly does not have many activities after school, so she has plenty of time to exercise. She has never been very athletic and plans to start by exercising two hours a day five days a week. Is this a good plan?
OPTIONS:
A.
Yes, she should dive right in.
B.
No, no one can exercise that much.
C.
Yes, if she has the time there is no excuse.
D.
No, smaller goals would be better.
PLEASE NO LINKS
If each of the following metals is exposed to light with a wavelength of 240 nm, which will emit photoelectrons with the greatest kinetic energy?a. Ironb. Platinumc. Nickeld. Palladiume. Sodium
Sodium metals will release photoelectrons with the highest kinetic energy when they are exposed to light with a wavelength of 240 nm.
The metal, whose work function is the lowest, will release photoelectrons with the highest kinetic energy. The photoelectrons emitted from sodium will have the highest kinetic energy because sodium has the lowest work function in the given situation.If the metal's ionization potential is low, the photoelectric effect is easily observed. Because of its low ionization potential, the alkali metal cesium is ideally suited for the photoelectric effect.Four metals are exhibiting photovoltaic effect as a result.Due to the high ionization energy, lithium metal does not emit photoelectrons.
Learn more about kinetic energy here :
https://brainly.com/question/26472013
#SPJ4
1. A capacitor is made of 2 rectangular metal plates with side length of 3cmx6cm separated by a distance of 2. 36cm with water in between the plates. The capacitor has a voltage of 110v and is not connected to a battery. Calculate the capacitance. What is the new capacitance if we replace water with a new dielectric material with a constant of 3. 75 in between the plates? What is the new voltage? What is the charge on each plate?
2. A capacitor of 3. 23µF has an area of 6. 35mm^2. Determine the separation distance between the two plates. If the new capacitance is now 5. 63mF, what is the value of the dielectric inserted to the capacitor? What is the new voltage if the capacitor is connected to a 110 volts source? If the electric field created by two plates 8. 99x10^4 N/C and a working voltage of 63 volts. Will the capacitor experience a dielectric breakdown? Prove your answer.
USE GRESA
the electric field is more than the threshold value and the capacitor will experience dielectric breakdown.
1. Given values are,
side length of metal plates, a = 3 cm and b = 6 cm
distance between the plates, d = 2.36 cm
voltage, V = 110 V
dielectric constant of water, k = 80.4
dielectric constant of new material, k2 = 3.75
a) To calculate the capacitance of capacitor, the formula is, C=εA/d ……………… (1)
where A = area of plate, ε = permittivity, and d = separation distance between two plates.
We know that the permittivity of vacuum is given as, ε0 = 8.854 x 10^-12 F/m
The capacitance of capacitor can be expressed as,
C1 = ε0 (kA/d) …………….. (2)
where, ε0 = permittivity of vacuum, k = dielectric constant and A = area of plate.
Substituting the given values in equation (2),
C1 = 8.854 x 10^-12 x 80.4 x (0.03 x 0.06)/0.0236
C1 = 0.000132 F
Therefore, the capacitance of capacitor is 0.000132 F.
b) To calculate the new capacitance, the formula is given as,
C2 = k2ε0A/d ……………… (3)
where k2 is the dielectric constant of new material.
Substituting the given values in equation (3),
C2 = 3.75 x 8.854 x 10^-12 x (0.03 x 0.06)/0.0236
C2 = 0.000263 F
Therefore, the new capacitance is 0.000263 F.
c) The new voltage can be calculated as,
V2 = V1(C1/C2) …………… (4)
Substituting the given values in equation (4),
V2 = 110 (0.000132/0.000263)
V2 = 55 V
Therefore, the new voltage is 55 V.
d) The charge on each plate is given as,
Q = CV ………….. (5)
Substituting the given values in equation (5),
Q = 0.000132 x 110
Q = 0.0145 C
Therefore, the charge on each plate is 0.0145 C.
2. Given values are,
capacitance, C = 3.23 µF
area of plate, A = 6.35 mm^2
separation distance between two plates, d = ?
new capacitance, C2 = 5.63 mF
new dielectric constant, k2 = ?
voltage, V = 110 V
electric field between two plates, E = 8.99 x 10^4 N/C
working voltage, Vw = 63 V
a) The separation distance between two plates can be calculated as,
C1/C2 = d2/d1 …………….. (6)
where d1 and d2 are the initial and final separation distance, respectively.
Substituting the given values in equation (6),
3.23 x 10^-6/5.63 x 10^-3 = d2/d1
d2 = 5.63 x 10^-3 x (d1/3.23 x 10^-6)
Area of plate, A = 6.35 mm^2 = 6.35 x 10^-6 m^2
The capacitance can be expressed as,
C = εA/d
d = εA/C
where ε = permittivity of dielectric material.
Therefore, substituting the given values in above equation,
d1 = ε x 6.35 x 10^-6/3.23 x 10^-6
d1 = 12.50 ε
Substituting the value of d1 in equation (6),
5.63 x 10^-3 = d2/12.50 ε
d2 = 70.38 ε
The separation distance between two plates is 70.38 ε.
b) The new dielectric constant can be calculated as,
C2 = k2ε0A/d2
k2 = C2d2/ε0A
Substituting the given values in above equation,
k2 = 5.63 x 10^-3 x 70.38 ε/(8.854 x 10^-12 x 6.35 x 10^-6)
k2 = 3.95
Therefore, the new dielectric constant is 3.95.
c) The new voltage can be calculated as,
V2 = V1(C1/C2)
Substituting the given values in above equation,
V2 = 110(3.23 x 10^-6/5.63 x 10^-3)
V2 = 0.063 V
Therefore, the new voltage is 0.063 V.
d) The electric field can be expressed as,
E = V/d
d = V/E
Substituting the given values in above equation,
d = 63/8.99 x 10^4
d = 7.01 x 10^-4 m
The voltage, V = 110 V > working voltage, Vw = 63 V
Learn more about electric field here :-
https://brainly.com/question/11482745
#SPJ11
What is the density of a 14.4 g of chromium in a rectangle with a volume of 2 cm3?
Answer:
\(density = \frac{mass}{volume} \\ \\ density = \frac{14.4}{2} \\ \\ { \boxed{ \boxed{density = 7.2 \: g {cm}^{ - 3} }}}\)
5 points
What did Alfred Wegener think happens during Continental Drift?
A. Continents move
B. The mantle warms
C. Convection Stops
D. Continents freeze
Answer:
Continents move
Explanation:
9. What voltage is applied to a 20 ohm fixed resistor if the current through the resistor is 1.5 amps?
Question :-
What Voltage is applied to a 20 Ohm fixed Resistor, if the Current through the Resistor is 1.5 Ampere ?Answer :-
Voltage of the Device is 30 Volt's .Explanation :-
As per the provided information in the given question, The Resistance is given as 20 Ohm's . Current is given as 1.5 Amperes . And, we have been asked to calculate the Voltage .
For calculating the Voltage , we will use the Formula :-
\( \bigstar \: \: \: \boxed {\sf { \: Voltage \: = \: Current \: \times \: Resistance \: }} \)
Therefore , by Substituting the given values in the above Formula :-
\( \Longrightarrow \: \: \: \sf { Voltage \: = \: Current \: \times \: Resistance } \)
\( \Longrightarrow \: \: \: \sf { Voltage \: = \: 1.5 \: \times \: 20 } \)
\( \Longrightarrow \: \: \: \bf { Voltage \: = \: 30 } \)
Hence :-
Voltage of Device = 30 Volt's .\( \underline {\rule {180pt}{4pt}} \)
Additional Information :-
\(\Longrightarrow \: \: \: \sf {Voltage \: = \: Current \: \times \: Resistance} \)
\( \Longrightarrow \: \: \: \sf {Current \: = \: \dfrac {Voltage}{Resistance}} \)
\( \Longrightarrow \: \: \: \sf {Resistance \: = \: \dfrac {Voltage}{Current} } \)
Answer:
30 VoltsExplanation:
Given:
Resistance = 20 ohmCurrent = 1.5 AmperesTo Find:
VoltageSolution:
Using formula:
Voltage = Current × ResistanceBy Substituting the required values,
⇢ Voltage = 1.5 × 20
⇢ Voltage = 30 Volts.
Hence,
The required Voltage is 30 voltsThe velocity – time graph of an object moving along a straight line is shown in
fig. Find (a) the distance covered and (b) the displacement of the object in time
interval between t = 0 s and t = 10 s
(a) The distance travelled by the object is 100 m.
(b) The displacement of the object in time interval between t = 0 s and t = 10 s is 60 m.
What is the distance covered by the object?(a) The distance travelled by the object is calculated from the total area of the curve.
total distance = area of triangle 1 + area of triangle 2 + area of rectangle.
total distance = (¹/₂ x base x height)₁ + (¹/₂ x base x height)₂ + length x width
total distance = (¹/₂ x 6 s x 20 m/s) + (¹/₂ (8 - 6) 20) + (10 - 0)(10 - 8)
total distance = 60 m + 20 m + 20 m
total distance = 100 m
(b) The displacement of the object in time interval between t = 0 s and t = 10 s is calculated as follows;
displacement = final position - initial position
displacement = (¹/₂ x base x height)₁ + (¹/₂ x base x height)₂ + length x width
displacement = (¹/₂ x 6 s x 20 m/s) + (¹/₂ (8 - 6) (-20)) + (10 - 0)(10 - 8)
displacement = 60 m - 20 m + 20 m = 60 m
Learn more about displacement here: https://brainly.com/question/2109763
#SPJ1
Particles q₁ = +9.33 µC, q₂ = +4.22 µC, and 93 = -8.42 µC are in a line. Particles q₁ and q₂ are separated by 0.180 m and particles q₂ and q3 are separated by 0.230 m. What is the net force on particle q₂? Please help up to 100 points.
Answer:
Fnet = 16.98204316 N will point right
Explanation:
q₁ and q₂ both positive ⇒ F₁₂ will point right, repel
q₂ pos and q₃ neg ⇒ F₂₃ will point right, attract
Fnet = F₁₂ + F₂₃
Fnet = k.q₁.q₂/r₁₂² + k.q₂.q₃/r₂₃²
Fnet = 9x10⁹x 9.33x10⁻⁶x4.22x10⁻⁶/(0.18)² + 9x10⁹x 4.22x10⁻⁶x8.42x10⁻⁶/(0.23)²
Fnet = 0.3543534/(0.18)² + 0.3197916/(0.23)²
Fnet = 10.93683333 + 6.04520983
Fnet = 16.98204316 N
the rate of diffusion is ___________ related to concentration, temperature, and pressure meaning that an increase in concentration, temperature, or pressure results in an ___________ in the rate of diffusion.
The rate of diffusion is directly related to concentration, temperature, and pressure meaning that an increase in concentration, temperature, or pressure results in an increase in the rate of diffusion.
This is because diffusion is a process where particles move from an area of high concentration to an area of low concentration, driven by a concentration gradient. As the concentration gradient increases, more particles move from the high concentration area to the low concentration area, resulting in a faster rate of diffusion.
Temperature also affects the rate of diffusion because it affects the kinetic energy of the particles. At higher temperatures, particles have more kinetic energy and move faster, leading to a higher rate of diffusion.
Pressure affects the rate of diffusion because it affects the concentration gradient. An increase in pressure can compress the gas and increase the concentration gradient, resulting in a higher rate of diffusion.
To know more about the diffusion, here
brainly.com/question/14392880
#SPJ4
Cassie pulled the boat onto the ice and adjusted its sails. Once she got started she would be able to steer, change direction and control her speed with a few twists of the ropes. Giving the boat a mighty heave across the ice, Cassie jumped in. What kind of energy will Cassie use to power the boat
Wind Energy is the kind of energy will Cassie uses to power the boat.
What is wind energy?
The method of producing electricity using air or wind currents that naturally occur in the earth's atmosphere is known as wind energy (or wind power). Electricity is produced by modern wind turbines that harness the kinetic energy of the wind. Wind passing across the turbine's blades is the initial step.
What is the major problem with wind energy?
Wind energy has the potential to have negative environmental effects, including the possibility of reducing, fragmenting, or deteriorating habitat for wildlife, fish, and plants, as with all energy supply choices. Furthermore, flying animals like birds and bats may be harmed by turbine blades in operation.
Learn more about wind energy: https://brainly.com/question/27997211
#SPJ4
A single stranded sequence of a gene is shown below. An investigator wants to amplify and isolate this small gene using PCR. Design two PCR primers, each 15 nucleotides long, that can be used to amplify this DNA segment. (remember that DNA sequences are written 5' to 3' by convention) ACTTTCCAAACGCCCCGTGTCGATACTGAACGAATCGATGCACGCTCCC TTCCTTGAAAACGCATAAACATACAAGTGGGCAGATGATGCGTACGCCC CTCTAATACATCCAACACTCTACGCCCTCTTCAAGAGCTGGAAGGGCA CCCTGCACTTGGATAGGGGATTATCTCGTAAGGCAAGCTCGTACCGTC ATTCATGCGGAAGAGTTAACACGATTGGAAGTAGGGATAGTTTCGAA CCTCGGTTACTAGTCCTAATAAGGGAACGCTGTCTGAAGGATGAGTGT CAGCCAGTGTA Forward Primer Reverse Primer
The forward primer for PCR amplification of the given gene sequence is 5'-ACTTTCCAAACGCCC-3', and the reverse primer is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.
To design the PCR primers for amplifying the given gene sequence, we need to identify regions that flank the target segment. The primers should be complementary to the template DNA and positioned in such a way that DNA synthesis occurs in the desired direction.
Based on the provided gene sequence, the forward primer is designed to bind to the coding (sense) strand of DNA. It starts at position 1 (5'-end) and extends for 15 nucleotides. The forward primer sequence is 5'-ACTTTCCAAACGCCC-3'.
The reverse primer, on the other hand, is designed to bind to the non-coding (antisense) strand of DNA. It starts at a position near the end of the gene sequence (position 241) and extends for 15 nucleotides in the opposite direction. The reverse primer sequence is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.
These primers will anneal to their complementary sequences on the template DNA during the PCR amplification process. The resulting amplicon will span the target gene segment and can be subsequently isolated and studied further.
To learn more about amplification click here brainly.com/question/30300512
#SPJ11
A ball is thrown vertically upward with an initial velocity of 25 m/s. What is its velocity after 3 seconds in the air? (assume air resistance is negligible)
Answer:
v = -5 m/s
Explanation:
It is given that,
The initial velocity of the ball, u = 25 m/s
We need to find its velocity after 2 seconds in the air.
Let v is the velocity of the ball after 2 seconds. Using equation of motion to find it.
v = u + at
Here, a = -g
v = u -gt
Putting all the values,
v = 25 - (10)(3)
= 25-30
= -5 m/s
So, the velocity of the ball after 3 seconds is 5 m/s and it is in downward direction.
when was the potential energy the highest in this experiment and why
The potential energy is highest at a point that is at the maximum height with respect to ground.
Who is the formula to find the potential energy near earth's surface?The formula to find the potential energy near earth's surface is -
U = mgh
Given is to identify the point where potential energy is largest.
The potential energy is highest at a point that is at the maximum height with respect to ground.
Therefore, the potential energy is highest at a point that is at the maximum height with respect to ground.
To solve more questions on potential energy, visit the link-
brainly.com/question/29014197
#SPJ1
Determine the energy conversion for the following:
a. Light bulb
b. Firework
c.flute
d. Leaf
Answer:
the answer is b.
because it will use energy and maybe its letter A.plsss pa brainliest po ako
and also youre welcomeAnswer:
a. Light bulb - electrical to light
b. Firework - chemical to light / thermal / sound
c. Flute - kinetic to sound
d. Leaf- solar to chemical
Jenna took an open bowl of leftover mashed potatoes from the refrigerator and noticed a difference in smell. She determined that chemical changes occurred since the potatoes were first placed there.
Which observations most likely led to Jenna’s conclusion?
a change of odor
a decrease in temperature
a change in moisture content
a decrease in mass
Answer:
A change of odor
Hope this helps! :)
A car accelerates from 5m/s to 20m/s in 2.5 seconds
Acceleration of the car is 6 m / s ².
a = ( v - u ) / t
a stands for acceleration
u stands for initial velocity
v stands for final velocity
Given ,
u = 5 m / s
v = 20 m / s
t = 2.5 s
a = ( v - u ) / t
a = ( 20 - 5 ) / 2.5
= 15 / 2.5
a = 6 m / s ²
Hence , Acceleration of car is 6 m / s ² .
To learn more about acceleration , kindly check :
https://brainly.com/question/605631
#SPJ9
The given question is incomplete kindly refer below for complete question :
A car accelerates from 5m/s to 20m/s in 2.5 seconds . Find the acceleration of the car .
on fm the frequencies range from 88 mhz to 108 mhz (megahertz) and travel at the same speed. what are their wavelengths?
Their wavelengths for an FM radio frequency of 88 MHz is 34.1 cm and for a frequency of 108 MHz 27.8 cm.
Wavelength of an electromagnetic waveThe wavelength of an electromagnetic wave is inversely proportional to its frequency. So, the higher the frequency, the shorter the wavelength.
what is The formula to calculate the wavelength (λ) of an electromagnetic wave is ?
λ = c / f
where c is the speed of light (3 x 10^8 meters per second) and f is the frequency in hertz.
So, for an FM radio frequency of 88 MHz, the wavelength can be calculated as follows:
λ = c / f = 3 x 10^8 / 88 x 10^6 = 0.0341 meters = 34.1 cm
And for a frequency of 108 MHz:
λ = c / f = 3 x 10^8 / 108 x 10^6 = 0.0278 meters = 27.8 cm
These are the approximate wavelengths for FM radio frequencies in the range of 88 MHz to 108 MHz.
To learn more about wavelength follow the given link: https://brainly.com/question/29790283
#SPJ4
The waves that heat a cup of water in the microwave are an example of electromagnetic waves. True or False
That's true.
They're radio waves, at the frequency of 2.45 GHz (in all microwave appliances manufactured in the US).