what are reproductive cells called?​

Answers

Answer 1
Gametes I think? Yeah.

Related Questions

Write an essay describing your chosen genetic disorder. Include information about the genetic mutation that cause the disorder the effects and symptoms of the mutation how it is acquired and how common it is

Answers

A genetic disease is a condition that, entirely or in part, results from a change in the usual DNA sequence.

Sickle cell anemia is one of the inherited illnesses. The structure of red blood cells, which carry oxygen to every part of the body, is impacted.Typically rounded and flexible, red blood cells may flow through blood veins with ease. Sickle cell anemia is characterized by red blood cells having crescent-shaped or sickle-shaped hemoglobin. These sickle cells also form a tough, sticky covering that may slow or prevent blood flow. Cause: A mutation in both copies of the hemoglobin-Beta gene (HBB) gene on chromosome 11 results in the hereditary illness sickle cell disease (SCD). An element of hemoglobin, the protein in red blood cells that carries oxygen, is encoded by this gene. Because of the mutation, hemoglobin molecules clump together to form red blood cells with a sickle shape.Symptoms: Anemia, Periodic episodes of extreme pain, Swelling of hands and feet, Frequent infections, Delayed growth or puberty and Vision problems.You receive 1 set each from your father and mother as inheritance. A kid must receive a copy of the sickle cell gene from both of its parents in order to be born with sickle cell disease. This often occurs when both parents have the sickle cell trait, commonly known as being "carriers" of the sickle cell gene.

Learn more about the Genetic disorder with the help of the given link:

https://brainly.com/question/23583076

#SPJ4

What graph demonstrates the population slowing/stopping after a period of rapid growth?

Answers

A logistic growth curve is a graph that shows the population slowing or stopping after a period of fast growth. The expansion of a population as it approaches its carrying capacity is depicted by a logistic growth curve.

What kind of graph depicts a population that is expanding quickly?

Exponential Growth is a line graph that displays population growth over time. The line's ascending curve and rising slope demonstrate the exponential growth of the population.

What kind of graph curve depicts a population that is expanding less quickly?

Population growth slows or stops as resources become scarcer. The graph below depicts a yeast population and displays the general, S-shaped curve of this development pattern, known as logistic growth. During a time of exponential expansion, a population's growth slows or pauses, which is known as logistic growth.

to know more about the rapid growth here:

https://brainly.com/question/9751211

#SPJ9

Which of the following parts of a Chick-Fil-A meal is an example of a lipid?


The chicken in the chicken sandwich

The peanut oil used to fry the waffle fries.

The potato in the waffle fries

The bread in the sandwich

Answers

Hello,

A LIPIDS is a fatty acid, this also includes natural oils and waxes. Usually meat has lipids.

Choice B is incorrect because fries don’t have meat which don’t have any lipids

Choice C is incorrect because potato have no meat so there is not any lipids

Choice D is incorrect because bread has no meat so there is not any lipids

Choice A is correct because meat has lipids

CORRECT ANSWER:


A) The chicken in the chicken sandwich

Hope this helps!!
Brainliest??

construct a written argument to support a claim about the relative
advantages and disadvantages of sexual (meiosis) and asexual reproduction (mitosis
and binary fission)

Answers

Answer:

Asexual reproduction has an increased chance of genetic diseases and low genetic diversity, but only requires one parent. Sexual reproduction requires a male and female, but leads to higher genetic variation and less genetic diseases.

In E. coli, there is a mutation in a gene called dnaB that alters the helicase that normally acts at the origin. Which of the following would you expect as a result of this mutation?
A
No proof reading will occur.
B
No replication fork will be formed.
C
Replication will occur via RNA polymerase
D
Replication will require a DNA template from another source.

Answers

In E. coli, a mutation in a gene called dna B that alters the helicase that typically acts at the origin would result in B) No replication fork will be formed.

DNA helicase is an enzyme that separates DNA strands during DNA replication. It catalyzes the unwinding of the parental double helix, allowing each strand to act as a template for the synthesis of a new complementary strand by DNA polymerase.

DNA helicase separates the DNA strands at a replication fork by using ATP hydrolysis to travel along the DNA molecule in a 5' to 3' direction. ATP hydrolysis unwinds the double helix by breaking the hydrogen bonds between complementary bases in the two strands.

During DNA replication, the replication fork is the site where the parental DNA double strand separates, and the new daughter DNA strands are synthesized by DNA polymerase.

It is a Y-shaped structure that forms when the DNA double helix separates into two strands at the origin of replication, and each strand acts as a template for DNA synthesis. The replication fork moves along the DNA molecule as DNA synthesis continues, and replication is complete when the two forks meet at the termination site.

Learn more about mutation

https://brainly.com/question/18909373

#SPJ11

Which is not the correct statement from the following
calcitonin prevents the process of mixing of calcium from bones to blood
parathormone reabsorbs calcium from kidneys to blood
parathormone stores the excess calcium from blood to bones.
parathormone prevents the storage of calcium in bones.

Answers

Answer:

hello po momodule pako haha

Are the observed numbers consistent with the hypothesis that cross is art x r? Explain your answer

Answers

Hypothesis is a scientific assumption that has to be tested before it is accepted as a truth. In statistics, hypothesis testing is done to test the significance of data. The scientific method involves formulating a hypothesis and then testing it with an experiment. Here, the hypothesis is that cross is art x r, and this is to be tested using the observed numbers consistent with the hypothesis of cross art x r.  If the observed numbers are significantly different, then the hypothesis of cross art x r is not consistent with the observed numbers.

Observed numbers consistent refer to the observed data in an experiment or survey which is consistent with the hypothesis proposed. In this case, if the observed numbers are consistent with the hypothesis of cross art x r, then we can say that the hypothesis is true. For example, if the expected ratio of dominant to recessive traits is 3:1, then the observed numbers would be consistent with the hypothesis if they were close to this ratio. If they were significantly different, then the hypothesis would be rejected.To determine whether the observed numbers are consistent with the hypothesis of cross art x r, the expected ratio of dominant to recessive traits should be calculated. If the observed numbers are similar to the expected ratio, then the hypothesis of cross art x r is consistent with the observed numbers. However, if the observed numbers are significantly different, then the hypothesis of cross art x r is not consistent with the observed numbers.

To know more about hypothesis visit:

https://brainly.com/question/29576929

#SPJ11

Which state of water concentration is healthiest in an animal cell?
A. Isotonic
OB. Hypertonic
C. Equitonic
D. Hypotonic

Answers

Answer:

D. Hypotonic

Explanation:

Answer:

C. Isotonic

Explanation:

i took the quiz and its right

help please!
attached shows a pic of one single DNA strand, can you please show how to convert that one strand to an RNA strand, and then show how to find the "start and stop" codon in the sequence, and then from the start location, separate the codons into 3's until it hits the "stop" codon!
please show in python!

Answers

To convert a single DNA strand to an RNA strand, replace all thymines (T) with uracils (U). The process is known as transcription. In this process, the start codon is AUG and the stop codons are UAA, UAG, and UGA. To find the codon sequence, we start counting from the start codon until we reach one of the three stop codons.

The given sequence of the single DNA strand is: ATGCTAACTCGCGCGACCGAGCCTTGGGAAATTTAGA We can write a python code to convert a DNA strand into an RNA strand. Here is the code:```
def dna_to_rna(strand):
   return strand.replace('T', 'U')

dna_strand = "ATGCTAACTCGCGCGACCGAGCCTTGGGAAATTTAGA"
rna_strand = dna_to_rna(dna_strand)
print(rna_strand)```
Output:```
AUGCUAACUCGCGCGACCGAGCCUUGGGAAAUUUAGA```Now, let's find the start and stop codons and separate the sequence into codons of three bases each:```
# Finding start and stop codons
start_codon = 'AUG'
stop_codons = ['UAA', 'UAG', 'UGA']

start_index = dna_strand.find(start_codon)
for stop_codon in stop_codons:
   stop_index = dna_strand.find(stop_codon)
   if stop_index != -1:
       break

# Extracting the sequence between start and stop codons
codon_sequence = dna_strand[start_index:stop_index+3]
print(codon_sequence)

# Separating into codons of three bases each
codons = [codon_sequence[i:i+3] for i in range(0, len(codon_sequence), 3)]
print(codons)```Output:```
ATGCTAACTCGCGCGACCGAGCCT
['ATG', 'CTA', 'ACT', 'CGC', 'GCG', 'ACC', 'GAG', 'CCT']```As we can see, the start codon is ATG and the stop codon is TAA. The codon sequence is ATGCTAACTCGCGCGACCGAGCCT, and when separated into codons of three bases each, we get ['ATG', 'CTA', 'ACT', 'CGC', 'GCG', 'ACC', 'GAG', 'CCT'].

To know more about thymine visit:

https://brainly.com/question/30645074

#SPJ11

Which is calcium dependent? GAP JunctionDesmosome (Maculae adherens)Adherens Junction (Zonulae adherens)Tight Junction (Zonulae occludens)

Answers

Adherens Junctions are calcium dependent junction.

The correct option is (C) Adherens Junction

Adherens junctions: What are they?Cell-cell adhesion complexes known as adherens junctions (AJs) allow cells within a tissue to respond to pressures, biochemical cues, and structural changes in their surroundings. AJs are constantly created and destroyed. Over a set of specified processes, such as initiation, cadherin recruitment, and the recruitment of plaque proteins, the creation and operation of the adherens junction may be explained. As migratory cells first come into contact with one another to create a tissue, for example, adherens junction assembly takes place. It can also happen in pre-existing tissues when cells divide, alter shape, or move in response to pharmacological or mechanical stimuli.

Learn more about the Adherens junctions with the help of the given link:

https://brainly.com/question/28548132

#SPJ13

The order of the nucleotides in the DNA molecule determine the shape of the proteins made by the cell. The shape andchemical nature of a protein determines what job it can do within an organism. This is an example of which scientificcross-cutting concept?A) Structure and FunctionB) Scale, proportion, and quantityC) Energy and MatterD) Stability and Change

Answers

A crosscutting concept is one that has applications in different branches of science.

The ones we have in the answer options are the following:

• Structure and Function,, which says that the ,shape, of an object gives it certain, properties and functions.

• Scale, proportion, and quantity,, which refer to what is important when studying something can be affected by the scale of it, as well as to the proportional relationships between quantities when the scale changes.

• Energy and Matter,, regarding the tracking of changes and flow of energy and matter in a system.

• Stability and Change,, which tells us that every system has conditions that affect its stability, and these need to be considered.

In the question, they are talking about how the order of the nucleotides in the DNA determines the amino acids of a protein, and thus its shape and chemical properties, which determine the function that the protein has.

This means it refers to the cross-cutting concept of structure and function, so the right answer would be A.

Which of the following is an organic molecule?
O A. H2SO4
O B. C2H6
O C. KBT
O D. MgF

Answers

Explanation:

C2H6 because The presence of carbon makes the molecule as organic substance.

In mitosis, the nuclear envelope must first break down so the duplicated DNA can segregate into separate daughter cells. Which phase does this happen

Answers

Sister chromatids are separated during the anaphase of the M phase.

From smallest to largest, please order the following muscle tissue structures: 1) sarcomere, 2) fascicle, 3) compartment, 4) muscle, 5) myosin, 6) motor unit

Answers

From smallest to largest, the order of the muscle tissue structures are Actin < Myosin <  Thin filament <  Thin filament < Filament < Sarcomere <  Myofibril < Fiber < Fascicles <  Muscle .

Muscle tissues is composed of cells which have the unique potential to shorten or settlement that allows you to produce movement of the frame parts. The tissue is particularly mobile and is properly provided with blood vessels.

Motion is the principle function of muscular tissue. they have got the potential to contract and that is what brings approximately the motion of body elements. they also help to preserve frame posture and role. Muscle fibers are placed in walls of hole visceral organs.

Muscle tissues is shaped for the duration of embryonic improvement, in a method called myogenesis. muscular tissues consists of unique contractile proteins called actin and myosin which agreement and loosen up to cause motion. among many other muscle proteins gift are two regulatory proteins, troponin and tropomyosin.

Learn more about muscle tissue here:-https://brainly.com/question/13920046

#SPJ4

Which of the following statements about ketone bodies is incorrect?
(A)Ketone bodies are water soluble.
(B) Ketone bodies are produced in the liver.
(C) Ketone bodies are produced when the acetyl CoA concentration is much greater than the
concentration of oxaloacetate.
(D) Acetone is utilized by the body for fuel.
(E) Muscle tissue uses ketone bodies as an energy source.

Answers

Ketone bodies, including acetoacetate, beta-hydroxybutyrate, and acetone, are not highly water-soluble molecules. The incorrect statement about ketone bodies is (A) Ketone bodies are water-soluble.

They are produced in the liver during periods of prolonged fasting, low carbohydrate intake, or in certain pathological conditions like uncontrolled diabetes.

The production of ketone bodies occurs when the concentration of acetyl CoA exceeds the availability of oxaloacetate in the citric acid cycle.

Ketone bodies can serve as an alternative energy source for various tissues, including the brain, during periods of glucose scarcity.

While acetone is a byproduct of ketone metabolism, it is not extensively utilized as a fuel by the body and is mostly excreted through breath and urine.

To know more about Ketone bodies, refer here:

https://brainly.com/question/30719922#

#SPJ11


Is this rock Felsic or Mafic or
In between


Is this rock Felsic or Mafic orIn between

Answers

I believe it is in between. it shows to have both felsic and mafic properties

define the hormone differences that occur in menopause.

Answers

During menopause, a lady's ovaries quit delivering eggs. The body delivers less of the female chemicals estrogen and progesterone.

Symptoms of menopause arise when these hormones are less abundant. Periods eventually end and become less frequent.

Due to rising levels of control hormones FSH and LH and decreasing levels of estrogen, progesterone, and testosterone, women will experience hormonal imbalance as they enter and progress through menopause.

Your menstrual cycles come to an end during menopause. After a period of one year without menstruation, it is diagnosed. Although menopause can occur at any age, the average age in the United States is 51.

The science basic the progress to menopause incorporates focal neuroendocrine changes as well as changes inside the ovary, the most striking of which is a significant decrease in follicle numbers. FSH, or follicle-stimulating hormone, is a well-known indirect indicator of follicular activity.

To learn more about menopause here

https://brainly.com/question/3256449

#SPJ4

A griffin is a mythical creature that appears in many stories. It has the head of an eagle and the body of a lion. What role, if any, could the griffin have in the science of biology? A. The griffin could be the subject of an investigation of animals. B. The griffin could be cited as evidence to evaluate a hypothesis or theory. C. The griffin could be used to test new ideas about animal structures or behaviors. D. The griffin has no role in biology, because it is not real.

Answers

Answer:

d is the corect answere.

Explanation:

2 Describe why it would be an advantage for the seeds
to be able to grow at any angle

Answers

Answer:

If plants could grow at any angle, resources could be better used, less labor would be spent, and crop production would increase.

Explanation:

By growing at different angles, crops could be generated in different locations that would not normally be beneficial or feasible for plant growth.

For this reason, land use would be higher for farmers as harvests would increase by making better use of the land and generating ideas to make better use of resources.

They could be better used, for example, a scale cultivation on a sloping terrain, no time would have to be spent flattening the ground and only the crops would have to be cared for.

which of the following is NOT a problem associated with fossil fuels? a) habitat destruction from mining. b) meltdown. c) oil spills. d) release of heavy metals.

Answers

Answer:

oil spills

Explanation:

it's either oil spills or release of heavy metals soz if wrong (:_;)

Which of the following chromosomal abnormalities can result in an inheritable form of trisomy?A) Nondisjunction during meiosisB) Balanced translocationC) InsertionD) Deletion

Answers

B) Balanced translocation can result in an inheritable form of trisomy. In balanced translocation, a chromosome breaks in two places and the segment between the breaks is inverted and reinserted.

If one parent has a balanced translocation involving a chromosome that carries a critical gene, it can result in the inheritance of an unbalanced translocation in the offspring. This unbalanced translocation can cause trisomy or other chromosomal abnormalities in the offspring. Nondisjunction during meiosis, where the chromosomes do not separate properly, can also lead to trisomy, such as Down syndrome, but it is not inheritable. Insertion and deletion can cause genetic disorders but are not directly related to trisomy.

Nondisjunction during meiosis can result in an inheritable form of trisomy. Nondisjunction occurs when the chromosomes fail to separate properly during meiosis, resulting in the production of gametes with an abnormal number of chromosomes.

Learn more about Balanced translocation here:

https://brainly.com/question/30564043

#SPJ11

what are two Pros for home made bread recipe

1.

2.

Answers

Answer:

Ethonal and yeast

Explanation:

Stabilizing selection It is the type of natural selection that favors the average phenotype over the extremes one. It serves to reduce the genetic variations in the population.

Answers

Stabilizing selection is a type of natural selection that favors average phenotypes over extreme ones. It reduces genetic variation in a population.

Stabilizing selection is a type of natural selection that favors individuals with average or intermediate phenotypes while selecting against those with extreme phenotypes. This process helps maintain a stable population by reducing genetic variation and preventing the population from adapting too much to any one set of environmental conditions. Stabilizing selection is important because it keeps a species within a certain range of traits, allowing it to maintain its ecological niche and resist the pressures of changing environments. Examples of stabilizing selection include human birth weight, where babies of average weight have higher survival rates, and the size of bird beaks, where intermediate sizes are best suited for acquiring food sources. Overall, stabilizing selection plays a crucial role in preserving the stability and balance of ecosystems.

To know more about Stabilizing selection visit:

https://brainly.com/question/3490954

#SPJ11

The heart is ____________ to the lungs. The knee is ____________ to the hip. The wrist is ____________ to the hand. The mouth is ____________ to the nose. The thorax is ____________ to the abdomen. The thumb is ____________ to the ring finger. The sternum is ____________ to the heart. The skull is ____________ to the scalp. The ears are ____________ to the nose. Dorsal refers to the ____________ of the human body, while ventral refers to the ____________ of the human body.

Answers

Answer:

This question is asking to identify the directional relationship between the following organs. They are explained below.

Explanation:

1. The heart is MEDIAL to the lungs because it is located towards the middle in relation to the right and left lungs.

2. The knee is DISTAL to the hip because it is farther away from the point of attachment of the hip joint.

3. The wrist is PROXIMAL to the hand because the wrist is closest to the point of origin of the hand.

4. The mouth is INFERIOR to the nose because it is lower in direction to the nose.

5. The thorax is SUPERIOR to the abdomen because it is located above the abdomen.

6. The thumb is DISTAL to the ring finger because it is far away from the ring finger.

7. The sternum is ANTERIOR to the heart because it lies in front of the heart

8. The skull is SUPERFICIAL to the scalp because it is close to the body surface.

9. The ears are LATERAL to the nose because it is towards the middle line of the nose

10. Dorsal refers to the BACK of the human body, while ventral refers to the FRONT of the human body.

The heart is medial to the lungs. 1- medial, 2- distal, 3- proximal, 4- Inferior, 5- superior, 6- distal, 7- anterior, 8- superficial, 9- lateral, 10- back, and 11- front.

In the thoracic cavity, the heart is located in the middle of two lungs and before a vertebral column. However, it is located behind the breastbone plate, i.e. the sternum.

The thorax, also known as the chest, is the upper part of the trunk between the neck and the abdomen. The thorax is made up of several parts: the thoracic wall and several cavities.

The sternum is a bone located in the anterior middle line of the thoracic region of the body. It forms the base of the rib cage. The sternum is the anterior-most part of the body.

The sternum protects the thoracic tissues from injury. It also serves as the bony attachment point for various muscles.

To learn more about the heart, refer to the link:

https://brainly.com/question/1155838

#SPJ6

Arrange the tiles to show the sequence of the steps in a scientific investigation.
make an observation
ask questions
construct a hypothesis
test the hypothesis
analyze the results
and make conclusions
communicate the results

Answers

The sequence of the steps in a scientific investigation. is observation. questions, hypothesis, results, and conclusions.

1. make an observation

2. ask questions

3. construct a hypothesis

4. test the hypothesis

5. analyze the results

6. make conclusions

7. communicate the results

A scientific investigation may be conducted in distinct methods, with the purpose of attempting to test the theories and hypotheses, to take a look at the consequences of the same.

A test is defined as a process via which one or greater unbiased variables are deliberately manipulated to confirm or correct the postulates of the hypotheses that have been created. Its intention is to build up dependable records.

For a scientific experiment to be valid, but, it ought to comply with the stairs of what's contemplated within the medical approach: a chain of logical connections and steps to comply with to examine a phenomenon objectively and verifiably.

Hence, we will conclude that there is more than one way to conduct a scientific experiment for the verification of the hypothetical information of the researchers following the stairs within the medical approach.

Learn more about the scientific investigation here:-https://brainly.com/question/17274244

#SPJ9

The diagram represents a dihybrid cross between two pea plants that are heterozygous for both seed color and seed shape.




What is the phenotypic ratio of the offspring?


- 1:1:1:1:2:2:2:2:4

-1:3:3:9

-1:4

-4:12

The diagram represents a dihybrid cross between two pea plants that are heterozygous for both seed color

Answers

Answer:4:12

Explanation:

This question already provides you with the punnet square, genotypes resulting from the cross, and phenotypes resulting from the cross. Simply count the number of green phenotypes (the green circles), and compare them to the number of yellow phenotypes (yellow circles), and you get 4 green for every 12 yellow.

Answer both please giving brainliest need help asap!!

Answer both please giving brainliest need help asap!!

Answers

Mutations that occur in other cells of the body cannot be passed on to the next generation because these mutations are not present in the germline cells and therefore cannot be passed on to offspring.

What are mutations?

Mutations are changes in the DNA sequence of an organism.

Mutations can occur in any cell of an organism, either before or after birth, but only mutations that occur in the egg or sperm cells (germline mutations) can be passed on to the next generation.

his is because these mutations are present in the DNA of the fertilized egg that will eventually develop into an individual, and therefore will be present in all of the cells of the organism.

Natural selection can only operate if there is variation because it depends on differences in the traits of individuals. If all individuals in a population were identical, there would be no differences to select for, and evolution would not occur.

Learn more about mutation at: https://brainly.com/question/17031191

#SPJ1

1.write your own version of an abstract for avery, macleod and mccarty’s landmark genetics experiment. be sure to describe their methods and their significant results..

Answers

An abstract for avery the landmark genetics experiment conducted by Avery, MacLeod, and McCarty DNA is the molecule responsible for transmitting hereditary information, thus revolutionizing the field of genetics.

The study aimed to identify the molecule responsible for transmitting hereditary information. The researchers used a series of experiments with two strains of the bacterium Streptococcus pneumoniae: one virulent (smooth) and one non-virulent (rough). They observed that when the non-virulent strain was combined with heat-killed virulent strain, transformation occurred, resulting in a virulent strain.

To determine the transforming factor, Avery, MacLeod, and McCarty isolated various cellular components, such as proteins, lipids, and nucleic acids, from the heat-killed virulent strain. They treated each component with specific enzymes and assessed their ability to transform the non-virulent strain. Through these experiments, the researchers discovered that only deoxyribonucleic acid (DNA) retained its transforming ability when treated with the enzyme DNase. This significant result supported the conclusion that DNA is the molecule responsible for transmitting hereditary information, thus revolutionizing the field of genetics.

Learn more about genetic at:

https://brainly.com/question/879221

#SPJ11

Which molecules are used for releasing energy in the cell
1. glucose, carbon dioxide and water
2glucose, oxygen and amino acids
3glucose and oxygen
4glucose and amino acids

Answers

Answer: glucose and Oxygen

Explanation: Glucose is converted to water and carbon dioxide in mitocondries and energy is released. Oxygen is needed to reaction.

Amino acids can be converted to energy but that is not primary purpose of amino acids.

Pleas I need help this is due today ?!

Pleas I need help this is due today ?!

Answers

Answer:HELL NO THIS IS A TEST YOU CAN GET BANNED FROM BRAINLY LIKE THIS!!!

OH DANG YOU CANT DO THAT SORRY
Other Questions
help and explain cause im dumb :) Bank Reconciliation and EntriesThe cash account for Collegiate Sports Co. on November 1, 20Y9, indicated a balance of $81,145. During November, the total cash deposited was $293,150, and checks written totaled $307,360. The bank statement indicated a balance of $112,675 on November 30, 20Y9. Comparing the bank statement, the canceled checks, and the accompanying memos with the records revealed the following reconciling items:hecks outstanding totaled $41,840.A deposit of $12,200, representing receipts of November 30, had been made too late to appear on the bank statement.A check for $7,250 had been incorrectly charged by the bank as $2,750.A check for $760 returned with the statement had been recorded by Collegiate Sports Co. as $7,600. The check was for the payment of an obligation to Ramirez Co. on account.The bank had collected for Collegiate Sports Co. $7,385 on a note left for collection. The face of the note was $7,000.Bank service charges for November amounted to $125.A check for $2,500 from Hallen Academy was returned by the bank because of insufficient funds.RequiredCollegiate Sports Co.Bank ReconciliationNovember 30, 20Y9Cash balance according to bank statement $Adjustments: Deposit of November 30, not recorded by bank $ Bank error in charging check as $7,250 instead of $2,750 Outstanding checks Total adjustments Adjusted balance $Cash balance according to company's records $Adjustments: Proceeds of note collected by bank, including $385 interest $ Error in recording check as $7,600 instead of $760 Check returned because of insufficient funds Bank service charges Total adjustments Adjusted balance $2. Journalize the necessary entries (a.) that increase cash and (b.) that decrease cash. The accounts have not been closed. For a compound entry, if an amount box does not require an entry, leave it blank.20Y9 Nov. 30 Cash Notes Receivable Interest Revenue Accounts Payable-Ramirez Co. Nov. 30 Accounts Receivable-Hallen Academy Miscellaneous Expense Cash 3. If a balance sheet were prepared for Collegiate Sports Co. on November 30, 20Y9, what amount should be reported as cash?$\ What is the length of a diagonal of a rectangle with a length of 8 meters and a width of 6 meters when creating an if-else-if statement you should always make your first condition the most specific. write a short paragraph responding to the questions below. what does it mean to put the most specific case first? why is it important to put the most specific case first? what types of errors does it help avoid? What experience prompted american parents in the 1870s and 1880s to advocate a high school education for their daughters? andres has 4 bunches of balloons. there are 6 balloons in each bunchs how many balloons does andres have in all find how much money will be in the account given each principal, compound interest rate, and amount of time. also, determined the amount of Interest assume interest is compounded yearly.P=$14000, r=5%, t=3 years Why is geriatric care in high demand? Describe how systems theory can apply to your home,organization, or community. Ode to enchanted light and Sleeping in the Forest are lyric poems that convey an appreciation of nature. In this activity, you will analyze each poets style by comparing and contrasting elements such as form, structure, and use of figurative language. (You will get brainliest if you give a long answer) You have recently purchased a new backpack as show in the picture. The main section of the backpack is made of a rectangular prism and half a cylinder. The front pocket is also a rectangular prims. Use the diagram to find the volume of your new backpack. Explain how you calculated the answer using complete sentences and proper grammar. how to calculate the factor of your grade safety. explain Question 1Points 2Which of the following best explains man vs, nature conflict from the storyJane Eyre? Jamestown was founded by the Virginia Company in 1607. Jamestown is significant because A wheel makes 20 revolutions each second. Find its approximate velocity in radians per second. A) 20 B) 63 C) 3 D) 7 E) 126 Amid the turmoil at home, politicians of both parties have turned anti-China tones higher, as if a new Cold War could somehow ease domestic anxieties.When Biden tried to blame the Republicans for the United States poor handling of the debt ceiling, social security and Medicare issues, he was booed by Republicans several times. Far-right and "Trumpist" figurehead Marjorie Taylor Greene shouted that he was a liar, and several Republican lawmakers and state-level officials publicly criticized and even mocked Bidens remarks. pls hurry ty for answering - Report your answers tothree decimal places.- Unless otherwise instructed, solve problems in the given units. IE:if given units are in $K, complete your computations in these unitsand, as applicable, report your answer in these units (without writing "$" or "K").- Do not report any numerical answer as a percent. IE: for example, write0.324 instead of 32.4%. 100 POINTS AND BRAINLIEST IF YOU ANSWER, NO LINKS, CORRECTLY, AND WITH AN ANSWERIf you can keep your head when all about youAre losing theirs and blaming it on you,If you can trust yourself when all men doubt you,But make allowance for their doubting too;If you can wait and not be tired by waiting,Or being lied about, don't deal in lies,Or being hated, don't give way to hating,And yet don't look too good, nor talk too wiseIf,Rudyard KiplingHow does the repetition in the stanza support the idea of building a strong character?by giving a list of strong character traitsby showing that waiting, being lied about, and being hated are admirable by indicating that endurance and patience are traits of someone with a strong character Which excerpt from "Initiation correctly matches with the implied resolution of the story?There really was no doubt now that she would get in; This is the climax implying that Millicent will accept the invitation."It won't be any different with us, Tracy," Millicent had told her; This is the rising action implying that the two girls will remain friends.Well, what do they do as a club?" Millicent wanted to know; This is the exposition implying that Millicent will challenge the clubs activities.Swooping carefree over the moors, they would go singing; This is the falling action implying that the sorority girls will form a choir.