Answer:
Carbondioxide gas, release oxygen and provide food.
Explanation:
Plant absorb carbondioxide gas, release oxygen and provide food to the animals are the was that plants impact the cycle. Plant absorb carbondioxide gas from the surrounding air in the presence of sunlight and absorb water from the soil. Both carbondioxide and water react with each other in leaves producing glucose and oxygen. Glucose is stored in different parts of plant body whereas some oxygen is used by the plant for respiration and the remaining is released in the atmosphere. The food produced in the plant can be eaten by the primary consumer for their growth and in that way the ecosystem moves in forward direction.
9
Which process is an example of facilitated transport?
AA carrier protein moves water across the cell membrane against the concentration gradient.
B A protein embedded in the cell membrane allows glucose to move to a region of lower concentration.
Waste materials from cellular processes are moved to a region of higher concentration outside the cell.
The cell membrane wraps around a large molecule and forms a a vesicle that takes the molecule into the cytoplasm.
Answer:
the answer would be a
Explanation:
In facilitated transport, transport proteins act as channels or carriers to facilitate the movement of specific molecules that may not be able to cross the cell membrane freely. The correct answer is B. A protein embedded in the cell membrane allows glucose to move to a region of lower concentration.
Facilitated transport, also known as facilitated diffusion, is a type of passive transport where specific transport proteins in the cell membrane assist in the movement of molecules across the membrane. It does not require energy input and moves molecules down their concentration gradient (from an area of higher concentration to an area of lower concentration).
In the given example, a protein embedded in the cell membrane facilitates the movement of glucose to a region of lower concentration. This process allows glucose to pass through the membrane more efficiently than by simple diffusion alone.
Therefore, the correct answer is B. A protein embedded in the cell membrane allows glucose to move to a region of lower concentration.
For more details regarding cell membranes, visit:
https://brainly.com/question/15232148
#SPJ1
Because bacteria frequently grow on poorly stored food, this often leads to what?
Poorly stored food usually experiences spoilage or foodborne illnesses because bacteria often thrive there.
Bacteria can grow and breed rapidly when food is not stored properly. Microorganisms called bacteria can contaminate food and create toxins, which reduce the quality and safety of food. When food loses its taste, texture, appearance, or nutritional value, it becomes unpalatable or unsafe to eat. This is called food spoilage.
Foodborne infections can occur more frequently when dangerous bacteria are present in improperly stored food. These infections can be spread by consuming contaminated food, which can cause symptoms such as nausea, vomiting, diarrhea, abdominal discomfort and, in some circumstances, more serious health problems.
Learn more about Foodborne infections, here:
https://brainly.com/question/33445743
#SPJ7
How can mass be modeled?????
Explanation:
maybe if Density=Mass/Volume can we say that Mass=Density*Volume?
A protein on a cell surface that binds to a signaling molecule is an example of which of the following elements of cellular communication?
A. a signaling cell
B. a signaling molecule
C. a receptor molecule
D. a responding cell
E. None of these choices are correct.
A protein on a cell surface that binds to a signaling molecule is an example of a receptor molecule, which is involved in cellular communication. Therefore, the correct answer is option C.
Cellular communication involves various elements, including signaling cells, signaling molecules, receptor molecules, and responding cells. In this scenario, the protein on the cell surface that binds to the signaling molecule acts as a receptor molecule.
Receptor molecules are responsible for recognizing and binding to specific signaling molecules, initiating a signaling cascade within the cell.
This interaction is crucial for transmitting signals from the extracellular environment to the interior of the cell, triggering appropriate cellular responses.
Hence, option C, "a receptor molecule," accurately describes the protein's role in cellular communication.
Learn more about protein here: brainly.com/question/31017225
#SPJ11
how does the body maintain a constant partial pressure of oxygen in the arteries even as exercise intensity increases?
During exercise, the body needs more oxygen to meet the increased demand of the muscles.
To maintain a constant partial pressure of oxygen in the arteries, the body employs a few mechanisms:
1. Increased breathing rate: During exercise, the respiratory rate and depth of breathing increase. This allows more oxygen to be taken in and delivered to the lungs for oxygenation.
2. Increased heart rate: The heart pumps blood faster during exercise, which means that oxygen-rich blood is delivered to the tissues more quickly.
3. Vasodilation: The arteries supplying the muscles dilate during exercise. This widening of the blood vessels allows for increased blood flow, delivering more oxygen to the muscles.
4. Red blood cell production: With regular exercise, the body adapts by producing more red blood cells. Red blood cells carry oxygen, so an increase in their numbers enhances the oxygen-carrying capacity of the blood.
By combining these mechanisms, the body ensures that a constant partial pressure of oxygen is maintained in the arteries, even as exercise intensity increases. These adaptations support the increased oxygen demand of the muscles and promote optimal functioning during physical activity.
To know more about arteries visit:
https://brainly.com/question/33378057
#SPJ11
_______ is the movement of the external medium across the respiratory membrane, while _______ is the movement of an internal medium, such as blood, over the respiratory membrane.
Answer:
ventilation and perfusion
Explanation:
cognitive operations cannot occur without the effective functioning of what part of the brain?
Cognitive operations cannot occur without the effective functioning of prefrontal cortex of the brain
The prefrontal cortex is the front part of the brain that is responsible for executive functions such as working memory, decision-making, problem-solving, attention, and planning. It is involved in the integration of sensory information and regulates the emotional and social behavior of an individual.
The prefrontal cortex is also responsible for higher-order thinking, which includes abstract thinking and reasoning.
The prefrontal cortex is connected to other areas of the brain, including the hippocampus, which is responsible for the formation of memories, and the amygdala, which is responsible for emotional responses.
Damage to the prefrontal cortex can cause cognitive impairments, such as difficulties in decision-making and problem-solving, and changes in personality and behavior.
To know more about prefrontal cortex, refer here:
https://brainly.com/question/29835533#
#SPJ11
Auxin is a plant hormone that causes the cells on the shady side of a plant shoot to elongate. The response enabled by auxin is known as -
Answer: phototropism
Explanation:
Auxin is a plant hormone that causes the cells on the shady side of a plant shoot to elongate. The response enabled by auxin is referred to as phototropism.
Phototropism simply refers to the growth of an organism towards light. It is usually common in plants, even though it can be seen in other organisms like fungi as well. The auxin in the plant cells that are farthest away from the light reacts when there's phototropism.
When we drink water, we feel good
because water helps move nutrients
to our what?
A blood
B. cells
C waste
Answer:
B. Cells
Explanation:
It's the answer
Select the correct answer from each drop-down menu. complete these sentences from george bernard shaw's the doctor's dilemma with words that are punctuated and spelled correctly. this, of course, does amount to a sort of working or rule-of-thumb but it means that you will do anything, good or provided you get enough people to keep you in countenance by doing it also. it is the sort of conscience that makes it possible to keep order on a pirate or in a troop of brigands. it may be said that in the last analysis there is no other sort of honor or conscience in existence—that the assent of the majority is the only sanction known to ethics.
The correct answers are: [1] D) conscience; [2] B) bad, [3] D) ship,
Explanation:The semicolon is required in the first answer. That's because there are two separate clauses, or two independent clauses. In this case, we should use a semicolon to join them.The second answer needs a comma because there are appositives that don't provide important information. Therefore, it indicates additional information and should be separated by commas to keep the sentence structure complete and clear. The third answer needs a comma just before the conjunction or as the rest of the sentence means the same thing as the one before it. In this case, the comma is used as an equivalence sign to clarify that the pirate ship is equivalent to the brigand's troop.To learn more about conjunction visit:
https://brainly.com/question/28839904
#SPJ4
Complete question is this:
Select the correct answer from each drop-down menu. Complete these sentences from George Bernard Shaw's The Doctor's Dilemma with words that are punctuated and spelled correctly. This, of course, does amount to a sort of working or rule-of-thumb [1] ____ but it means that you will do anything, good or [2] ____ provided you get enough people to keep you in countenance by doing it also. It is the sort of conscience that makes it possible to keep order on a pirate [3] ____ or in a troop of brigands. It may be said that in the last analysis there is no other sort of honor or conscience in existence—that the assent of the majority is the only sanction known to ethics.
[1] Choices:
A) conscience.
B) conscience:
C) conscience
D) conscience;
[2] Choices:
A) bad:
B) bad,
C) bad;
D) bad.
[3] Choices:
A) ship:
B) ship;
C) ship
D) ship,
The function of thick mucus in the stomach is to Group of answer choices promote fat digestion. activate stomach enzymes. protect stomach cells from acid and enzymes. keep the stomach bacteria-free.
Answer:
protect stomach cells from acid and enzymes.
Explanation:
This prevents peptic ulcers.
the function of nad+/nadh in the cell is best described as
The function of NAD+/NADH in the cell is best described as a coenzyme involved in redox reactions, specifically in the transfer of electrons during cellular respiration.
NAD+ is reduced to NADH during glycolysis, the citric acid cycle, and oxidative phosphorylation. NADH then donates electrons to the electron transport chain, ultimately leading to the production of ATP. NAD+ also plays a role in other cellular processes, such as DNA repair and regulation of gene expression.
NAD+/NADH acts as a mediator in redox reactions, facilitating the transfer of electrons from one molecule to another. It serves as a coenzyme in numerous enzymatic reactions, playing a vital role in metabolic pathways such as glucose metabolism, fatty acid oxidation, and amino acid metabolism.
Know more about cellular respiration here:
https://brainly.com/question/29760658
#SPJ11
Please help (if you know how to do this )
The answer choices are
A-Substrate
B-Product
C-Active site
D- Enzyme-substrate complex
Explanation:
I think the answer is A-substrate
After surgical removal of the spleen (i.e., a splenectomy), some other organs take over most of its functions. Which of the following spleen functions in the adult can not be performed by bone marrow
After a splenectomy, some organs take over the functions previously performed by the spleen. While bone marrow plays a crucial role in the production of blood cells, it does not perform all the functions of the spleen.
One of the primary functions of the spleen is the filtration and removal of old and damaged red blood cells from circulation. The spleen also helps to store platelets and iron, which are essential for blood clotting and oxygen transport, respectively. Additionally, the spleen plays a role in the immune system by producing and storing certain types of white blood cells that help fight infection. While bone marrow does produce white blood cells, it does not store or release them in the same way that the spleen does. It is important for individuals who have undergone a splenectomy to consult with their healthcare provider to understand the potential implications and necessary precautions to maintain their health.
Therefore, the function of storing and releasing white blood cells cannot be performed by bone marrow after a splenectomy.
To know more about bone marrow visit :
https://brainly.com/question/30754540
#SPJ11
Which of the following statements is a principle of the cell theory that supports the idea that new cell will replace damaged cells in a scraped knee
when is the dna of the cells' chromosomes copied? a) after g2 b) at the beginning of mitosis c) during s phase
The DNA of the cells' chromosomes is copied during S phase of the cell cycle.
The full form of DNA is deoxyribonucleic acid. It is a molecule that contains genetic information and instructions for the development and function of living organisms. S-phase or synthesis phase is a stage of interphase, which is the cell cycle's most prolonged phase.
DNA replication occurs in this stage, which means that the cell's DNA is duplicated to prepare for mitosis, which happens during the next stage, the G2 phase.
S phase also ensures that the DNA is correctly copied before being separated during cell division. Chromosome duplication happens in the S-phase of interphase.
To know more about DNA visit the link
https://brainly.com/question/30006059
#SPJ11
1.Karyose" comes from a Greek word that means "kernel," and “promeans "before." Based on this information, prokaryotic means– 2.What is the structure of prokaryotic cells?
Answer:
The Prokaryotic Cell
Prokaryotes are unicellular organisms that lack organelles or other internal membrane-bound structures. Therefore, they do not have a nucleus, but, instead, generally have a single chromosome: a piece of circular, double-stranded DNA located in an area of the cell called the nucleoid
please give brainlist
hope this helped...
A new species of Polynesian Butterflies was discovered. The population consists of two discrete phenotypes (solid blue and mottled orange/black ventral surfaces).
A cross of two individuals produced the following data:
1. Construct a model that would illustrate the inheritance pattern for the above cross.
2. State which allele is dominant? Use evidence to support answer.
The models that depicts the inheritance pattern after cross breeding is shown below, while the allele of the blue phenotype (B) is dominant in the offspring.
What is Cross-BreedingCross breeding, or cross-pollination, is the process of interbreeding two different varieties or species of plants to produce a hybrid variety. This is done to combine the desirable traits of different varieties in order to create a new, improved strain with desirable traits.
1. The model that would illustrate the inheritance pattern for the above cross would be a Punnett square. The two phenotypes would be represented by the alleles B (for blue) and O (for orange/black). The cross would be represented as follows:
Parent 1: B/B
Parent 2: O/O
Offspring: B/O
2. The allele for the blue phenotype (B) is dominant, as it is expressed in the offspring. This is supported by the fact that the offspring have a blue dorsal surface, even though the parents have both orange/black and blue phenotypes.
Learn more on cross breeding here;
https://brainly.com/question/8588470
#SPJ1
Hardy-Weinberg equilibrium will not occur in a population in which individuals mate at random. mutations do not occur. individuals immigrate or emigrate. sexual selection does not occur. natural selection does not occur.
Hardy-Weinberg equilibrium will not occur in a population in which individuals do not mate at random, mutations occur, individuals immigrate or emigrate, sexual selection occurs, and natural selection occurs.
The Hardy-Weinberg equilibrium is a principle that states that the frequencies of alleles and genotypes in a population will remain constant from generation to generation in the absence of other influences. In order for this equilibrium to occur, the following conditions must be met:
1. Random mating: Individuals in the population must mate at random, without any preference for specific genotypes or phenotypes.
2. No mutations: There must be no new mutations occurring in the population.
3. No migration: There must be no immigration or emigration of individuals in or out of the population.
4. No sexual selection: There must be no preference for certain traits during mating.
5. No natural selection: There must be no differential survival or reproduction of individuals based on their genotypes or phenotypes.
If any of these conditions are not met, the Hardy-Weinberg equilibrium will not occur and the frequencies of alleles and genotypes in the population will change over time.
Here you can learn more about Hardy-Weinberg equilibrium
https://brainly.com/question/29773694#
#SPJ11
Explain thoroughly how hurricanes lead to deforestation?
A hurricane is a tropical storm with winds that have reached a constant speed of 74 miles per hour or more. High winds that oust trees and massive rains that flooding are the main ways that hurricane destruct a forest. The storm surge that follow hurricanes can create further flooding and immerse freshwater habitats, accumulating salt and debris inland from the coast. The long-term aftermath of an elevated salt levels in soil can cause deferred mortality of several tree species, forest deterioration and eventually dieback. The biggest clear and actual effect of hurricane is on timber and the economic value it represents. The lifelong effect of hurricanes may agitate some of the other ecosystem services that the forest convey such as water purification and carbon storage. Carbon storage is esential to alleviate the effects of climate change.
What is a trait that appears only if an organism has two factors for the trait?
When an organism has two recessive alleles, its gene forms, the recessive trait manifests.
What is called organism?A biological organism that can perform the functions of life, whether it is a human, plant, or animal, thanks to organs with specialized functions but interdependent connections. organismic. An organism is a living being with an organized structure, the ability to respond to stimuli, the capacity to reproduce, develop, adapt, or maintain homeostasis. Therefore, every animal, plant, fungus, protist, bacterium, or archaeon found on Earth would be considered an organism.
What are organisms made of?Every living creature is made up of cells, that are regarded as the fundamental building blocks of life. Even one-celled organisms are sophisticated! Atoms produce molecules, which in turn produce the cell organelles as well as other structures. Similar cells form tissues in multicellular organisms. Anything with life and cells as its fundamental unit of organization is considered a living entity. Humans, fungus, algae, trees, animals, bacteria, protozoa, and insects are examples of living things.
To know more about Organism visit:
https://brainly.com/question/13278945
#SPJ4
Which of these is made up of cells and tissues that perform a larger function?
Answer:
The answer is organs
Explanation:
1. Explain the difference between
transcription and translation in DNA.
Make sure you are able to take a DNA
segment and transcribe it and
translate it into mRNA and proteins.
Transcription is the process by which an RNA molecule is produced from one of the DNA strands whereas translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein.
What is the difference between transcription and translation in DNA?Transcription is the process by which RNA polymerase enzyme reads the DNA sequence and synthesizes an RNA molecule that is complementary to one of the DNA strands.
During transcription, the DNA double helix is unwound, and the RNA polymerase enzyme adds nucleotides to the growing RNA molecule following the base-pairing rules of A-U and G-C. The resulting RNA molecule is called messenger RNA (mRNA), and it carries the genetic information from DNA to the site of protein synthesis.
Translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein. Translation occurs in the ribosome, where transfer RNA (tRNA) molecules with attached amino acids bind to the mRNA codons in a complementary fashion. This process results in the formation of a polypeptide chain that folds into a functional protein.
To demonstrate these processes, let's take the following DNA segment as an example:
DNA sequence: TACAGCGACGCGTATCGAGG
Transcription:
The first step in transcription is to identify the DNA strand that will serve as the template for the RNA synthesis. In this case, we will use the template strand (the complementary strand to the coding strand).
Template DNA strand: ATGTCGCTGCGCATACTCC
The RNA polymerase enzyme will read this template strand and synthesize a complementary RNA molecule by adding nucleotides to the growing chain. The resulting mRNA molecule will have the same sequence as the coding strand (except for U instead of T).
mRNA sequence: AUGUCGCUGCGCAUACUCCG
Translation:
The mRNA sequence can now be translated into a protein sequence using the genetic code, which is a set of rules that determine how the nucleotide sequence of an mRNA molecule is translated into the amino acid sequence of a protein.
AUG-UCG-CUG-CGC-AUA-CUC-CG
Using the genetic code table, we can determine the amino acid sequence of the protein:
AUG: Methionine
UCG: Serine
CUG: Leucine
CGC: Arginine
AUA: Isoleucine
CUC: Leucine
The resulting protein sequence is: Met-Ser-Leu-Arg-Ile-Leu.
Learn more about transcription and translation at: https://brainly.com/question/11214205
#SPJ1
HELP PLEASE DUE SOON
Explain how building the lake near Galetown could affect the amount of water vapor and the amount of rain.
Answer:
Adding a lake near any town will most likely increase rainfall because of the added water, and water vapor levels will also increase. Because of the excess water in the environment, more water will be found in the surrounding atmosphere (the same reason precipitation will increase in the area.)
The graph below shows the number of sunspots observed between 1750 and 2000.
Based on the graph, which of these statements is most likely correct about the period between 1900 to 1950?
There was a decrease in global temperatures.
There was an increase in global temperatures.
There was no significant change in global climate.
There was no significant change in solar activity.
]Based on the graph, the most likely correct statement about the period between 1900 to 1950 is that there was no significant change in solar activity.
The graph shows the number of sunspots observed during this period, and if there were no significant changes in solar activity, it suggests that the sunspots remained relatively consistent. Sunspots are dark areas on the surface of the sun, and their presence indicates increased solar activity.
It is important to note that the graph does not directly provide information about global temperatures or climate. Therefore, we cannot conclude whether there was an increase or decrease in global temperatures based solely on the information provided in the graph.
I will do brainliest
submit your answer for exam activity 3-2 regarding the zones of lake michigan scuba divers will pass through
To answer your question about the zones that scuba divers will pass through in Lake Michigan, there are generally three main zones that divers encounter:
the littoral zone, the limnetic zone, and the profundal zone. 1. Littoral Zone This is the shallowest zone near the shore, where light can penetrate to the bottom. It usually extends to a depth of about 20 feet. Scuba divers in this zone will encounter a variety of plant and animal life, including submerged vegetation, fish, and invertebrates. 2. Limnetic Zone This is the open water zone beyond the littoral zone. It is characterized by its deep, clear water and limited light penetration. Scuba divers in this zone may encounter larger fish species, such as trout and salmon, as well as plankton and other microscopic organisms. 3. Profundal Zone This is the deepest part of Lake Michigan, typically below 300 feet. It is a dark and cold zone, with limited oxygen and light. Scuba divers exploring this zone will encounter unique species adapted to the extreme conditions, such as deep-water fish and benthic organisms. It's important to note that diving in Lake Michigan requires proper training, equipment, and safety precautions. Divers should always follow local regulations and dive within their certified depth limits.About Lake MichiganLake Michigan is one of the 5 Great Lakes in North America. It has a surface area of 22,300 square miles. It is 307 miles long and 118 miles wide. Lake Michigan is the 5th largest lake in the world. Bounded by the states of the United States Indiana, Illinois, Wisconsin, and Michigan. Lake Michigan is the only large lake whose entire territory is in the United States. The Great Lakes System is the largest freshwater system in the world.
Learn More About Lake Michigan at https://brainly.com/question/14661388
#SPJ11
From the meaning of the suffix, we can tell that a valvulotome would be an instrument used to ________ a valve.
The meaning of the suffix "tome" is to cut, which implies that a valvulotome is an instrument used to cut a valve. Therefore, the answer is 'cut.' The term valvulotome refers to an instrument used to cut a valve.
It is important to note that surgical instruments are named based on their intended function, shape, or the person who discovered them. Valvulotome can also be described as an instrument used to cut the valve's fibrous ring. It is mainly used in cardiac surgical procedures, and it is inserted through a small incision into the patient's heart.
From the meaning of the suffix, we can tell that a valvulotome would be an instrument used to cut a valve.
To know more about valve, refer
https://brainly.com/question/14420296
#SPJ11
AP English Language and Composition and 2007 Scoring Guidelines Question 2
In your journal, complete a PASAFE + TEAR paragraph analyzing the student writer's use of refutation to build his/her own argument.
ANSWER:
In response to the essay by Scott Russel Sanders, “the belief that movement is inherently good” (Sanders). The genre is this essay is an opinionated essay throughout the essay he haves a natural tone against Rushdie even towards the end. He claims that we should root ourselves in places rather than ideas, that we should care for the earth rather than our own selfish desires. In quoting Rushdie directly and repeating his words and syntax, Sanders not only assures the reader of his careful thoughtfulness on the issue but also states his own belief that moving does nothing to rid us of the unfortunate aspects of the humanity of which we all wish to be free. Sanders and Rushdie have agreement and disagreement quotes that they want to share with others, but maybe more to themselves. But still, there is no argument in this essay, and is still respectful. The audience is for all people, as one that we all should hold as a fundamental belief of society. How can one create a new relationship with the world when they are constantly altering their place in it? The gradual movement from agreement to complete disagreement reinforces Sander’s point and respectfully refutes Rishdie’s point consequently. Yet he is still respectful towards Rushdie and admits that even though he disagrees completely with him, Rushdie articulated his views “as eloquently as anyone” (Sanders). He finishes by asserting that we must root ourselves to a specific place in order to “pay enough head and respect to where are are” (Sanders).
¿Por qué piensas que existe la separación de poderes del Estado?
Answer:
El propósito de la separación de poderes es evitar la concentración de poder sin control y proporcionar frenos y contrapesos, en los que los poderes de una rama del gobierno están limitados por los poderes de otra rama, para prevenir abusos de poder y evitar la autocracia.
Explanation:
¡espero que esto ayude!
what is the relationship between tissues, organs, and organ system?
Answer:
.
Explanation:
Cells make up tissues, tissues make up organs, and organs make up organ systems.