what do you use to fight snow and ice on roads?

Answers

Answer 1

Answer:

For melting snow and ice, salt, liquid calcium chloride and a few other de-icing chemical products are clearly superior to sand, or a sand/salt mixture. In fact, sand by itself has no de-icing capacit

Explanation:

Answer 2

ice salt

Explanation:

they lower the freezing Pronto the ice and snow thus breaking them apart


Related Questions

What is humus made of? (Select all that apply.)

A. earthworms
B. nutrients
C. bacteria
D. rocks

Answers

Answer:

A. earthworms

B. nutrients

C. bacteria

Explanation:

Humus is rich in organic matter and also is abundant in inorganic mineral nutrients.

(*) Sorry for my late answer but I hope this helps others that are looking for this.

100% in the test  ;)

Humus is made of Earthworms, nutrients and bacteria. So, the correct options are A, B and C.

What is Humus?

Humus is the soil's black organic material that results from the breakdown of plant and animal debris. It is a type of organic material for soil. It has a lot of nutrients and keeps the soil moist. The Latin word for "earth" or "ground" is humus.

Humus is described as a dark organic substance that develops in soil as a result of plant and animal debris decomposing. It is organic and dark in colour because carbon has accumulated there. It contains elements that are crucial to maintaining healthy soil. Earthworms, nutrients, and microbes make up humus.

Because humus is a feature of loamy soils, the high concentration of nutrients in the soil is caused by humus. Humus reduces a substance's porosity by obstructing the pores that permit the passage of water and air.

Therefore, the correct options are A, B and C.

Learn more about Humus, here:

https://brainly.com/question/19831951

#SPJ3

What phase is represented as anaphase?Select one:a.letter E in the diagramb.letter D in the diagramc.letter B in the diagramd.letter C in the diagrame.letter A in the diagram

What phase is represented as anaphase?Select one:a.letter E in the diagramb.letter D in the diagramc.letter

Answers

On anaphase, the sisters chromatids separate, then, the correct image is C on the diagram, since it shows how the spindle fibers are shortened

newly formed blood cells enter circulation from the bone marrow and lymphatic organs by passing through the walls of which of the following?

Answers

Answer:

For example, when bone marrow forms new blood cells, the cells must enter the blood supply and can only do so through the large openings of a sinusoid capillary; they cannot pass through the small openings of continuous or fenestrated capillaries

Newly formed blood cells enter circulation from the bone marrow and lymphatic organs by passing through the walls of sinusoids. Therefore, option A is correct.

Sinusoids are specialized blood vessels found in certain organs, particularly in the liver, bone marrow, and spleen. They are characterized by their unique structure, which allows for the exchange of various substances between the blood and the surrounding tissues.

Sinusoids have larger and more irregularly shaped lumens compared to regular capillaries. The walls of sinusoids are discontinuous and contain gaps or fenestrations, allowing for the movement of cells, molecules, and fluids between the bloodstream and the surrounding tissue.

Learn more about sinusoids, here:

https://brainly.com/question/29358152

#SPJ4

Your question is incomplete, most probably the full question is this:

Newly formed blood cells enter circulation from the bone marrow and lymphatic organs by passing through the walls of which of the following?

A) Sinosoids

B) Arteries

C) Veins

D) Lymphatic vessels

1. Which gene mutation (insertion, deletion, or substitution) appears to have the biggest impact on an amino acid sequence? Explain your answer.​

Answers

Answer:

A frameshift mutation caused by an insertion or deletion of one or more nucleotides in the coding sequence of a gene has the most significant impact on the amino acid sequence of the resulting protein. This is because the genetic code is read in groups of three nucleotides (codons), and an insertion or deletion shifts the reading frame and changes the codon sequence downstream of the mutation. As a result, all the amino acids downstream of the mutation are different from those in the original protein sequence.

A dehydrator runner drinks a lot of water after race he or she rehydrate because 

Answers

Answer:

Water helps regulate their temperature and gives energy to the cells which are tired and can't function as good after using the energy for the race.

Explanation:

How does a cell's external environment affect the movement of water across the cell membrane?

Answers

Answer:

water molecules move according to the energy from where they are to where they're going.

Explanation:

The external environment of the cell significantly affects the movement of water across the cell membrane when a cell is placed in three types of solution.

What is a cell membrane?

A cell membrane may be defined as a type of biological membrane that significantly separates and protects the interior environment of all cells with respect to the outside environment. It is semi-permeable in nature which regulates the transport of materials entering and exiting the cell.

If a cell is placed in a hypertonic solution, water will migrate out of the cell, and the cell will shrink. In an isotonic environment, there is no net water movement, so there is no change in the size of the cell. When a cell is placed in a hypotonic environment, water will enter the cell, and the cell will swell.

Therefore, the external environment of the cell significantly affects the movement of water across the cell membrane when a cell is placed in three types of solution.

To learn more about Cell membranes, refer to the link:

https://brainly.com/question/1768729

#SPJ2

Reactions in the mitochondria convert O2 and small molecules in to ----------------- ? *
1.CO2 + H2O + food
2.CO2 + H2O + ATP
3.CO2 + O2 +Hydrogen
4.ATP only

Answers

Answer:

3

Explanation:

C02+02+Hydrogen I think

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

why is protein synthesis different in prokaryotes and eukaryotes

Answers

Protein synthesis, the process by which cells generate proteins, differs in prokaryotes and eukaryotes due to several factors related to their cellular structures and mechanisms. Prokaryotes, such as bacteria, lack a distinct nucleus and other membrane-bound organelles, while eukaryotes, including plants, animals, and fungi, have a well-defined nucleus and various organelles. This difference affects the localization and regulation of protein synthesis. In prokaryotes, transcription (the synthesis of RNA from DNA) and translation (the synthesis of proteins from RNA) are coupled, meaning they occur simultaneously. The mRNA transcript is rapidly translated into protein by ribosomes as it is being synthesized. In contrast, eukaryotes separate transcription and translation in time and space. Transcription occurs inside the nucleus, and the mRNA is then processed, modified, and transported to the cytoplasm, where translation takes place. Eukaryotic mRNA undergoes various modifications before it can be translated into protein. This includes the addition of a 5' cap and a poly(A) tail, as well as the removal of introns through a process called splicing. These modifications provide stability, facilitate transport to the cytoplasm, and allow for the production of multiple protein isoforms. Prokaryotes do not typically undergo extensive mRNA processing. Prokaryotic and eukaryotic ribosomes differ in size and composition. Prokaryotes have smaller ribosomes (70S) composed of a 30S and a 50S subunit, while eukaryotes have larger ribosomes (80S) consisting of a 40S and a 60S subunit. These structural differences impact the initiation, elongation, and termination of protein synthesis. Eukaryotes possess more complex mechanisms for regulating gene expression compared to prokaryotes. Eukaryotic gene expression is regulated at multiple levels, including transcriptional control, post-transcriptional modifications, and translational control. This allows for fine-tuning of protein synthesis in response to various internal and external signals. Prokaryotes primarily regulate gene expression at the transcriptional level.

Overall, the differences in protein synthesis between prokaryotes and eukaryotes are rooted in their distinct cellular organization, mechanisms of gene expression, and the need for eukaryotes to coordinate protein synthesis within a more complex and compartmentalized cellular environment.

What would most likely happen to this ecosystem if all of the gray wolves
were removed?
Secondary
consumers
Primary
consumers
Primary
producers
Red fox
Red squinel
Pine
Snowshoe
hore
Gray woll
Roven (debivore)
Moose
Beaver
WA
Maple Bolsam Fir Cottonwood Aquatic plants
OA. The cottonwood population would decrease.
OB. The snowshoe hare population would decrease.
OC. The fox population would decrease.
OD. The moose population would decrease.

Answers

C. the fox population would decrease

Is the round-the-alimentary canal trip interesting? What are the classes of food that have been digested by and absorbed into the body? Are there any classes of food that leave the body undigested?

Answers

The process of a round-the-alimentary canal trip is very interesting. This is because it moves the food processed through the action known as Peristalsis.

What is an alimentary canal?

The alimentary canal may be dfeined as the pathway through which food enters our body and moves out through the anus after digestion. It is a tube-like structure that starts from the mouth and ends in the anus. Humans are complex multicellular organisms.

The food contains three macronutrients that require digestion before it can be absorbed. They include fats, carbohydrates, and proteins. Through the process of digestion, these macronutrients are broken down into molecules.

Roughages, also known as dietary fibers are the type of carbohydrates, which are undigested by the body.

To learn more about the Alimentary canal, refer to the link:

https://brainly.com/question/881890

#SPJ1

If the entire mRNA sequence for a polypeptide was AUGUACUCGCGACCGUAA, how many amino acids does the polypeptide have

Answers

Answer:

5 amino acids

Explanation:

The process of translation involves synthesizing a sequence of amino acids from a mRNA template. The mRNA molecule is read in a group of three nucleotides called CODONS. A codon specifies or codes for an amino acid.

In the question, a mRNA sequence was given as follows: AUGUACUCGCGACCGUAA. From this sequence comprising of 6 codons, 5 possible amino acids will be contained in the polypeptide encoded by this mRNA molecule as the last codon (UAA) is a STOP codon. The following are the codons in the mRNA sequence and their respective amino acids:

*AUG- methionine (met)

*UAC - tyrosine (Tyr)

*UCG - Serine (Ser)

*CGA - Arginine (Arg)

*CCG - Proline (Pro)

*UAA - Stop

Which of the following is a positive effect that technologies like the Internet have had on workers?

Answers

Access to knowledge and information is made easier for workers because to technology like the Internet. Workers now find it simpler to conduct research, develop new skills, and keep up with industry trends because to the revolutionary changes the Internet has brought about in information access and sharing.

Because of this, it has become easier for employees to continue their professional growth and learn new things that will improve their job performance and career prospects.

The Internet has also increased chances for freelance work and flexible scheduling. Workers may now work from almost anywhere thanks to the ability to connect and interact online, which eliminates the need for commuting and gives them more flexibility in maintaining work-life balance. Due to this, employees now have greater influence over their schedules and working conditions, which has risen.

To know more about technology

https://brainly.com/question/29850930

#SPJ1

An mRNA macromolecule transcribes genetic code from a DNA macromolecule in a cell’s nucleus and carries the code into the cytoplasm to synthesize a protein.

Which of the following statements is true about the nucleotides in the mRNA macromolecule and the DNA macromolecule?

The number of uracil bases in the mRNA is the same as the number of cytosine bases on the strand of DNA that it transcribed.

The number of uracil bases in the mRNA is the same as the number of thymine bases on the strand of DNA that it transcribed.

The number of uracil bases in the mRNA is the same as the number of adenine bases on the strand of DNA that it transcribed.

The number of uracil bases in the mRNA is the same as the number of guanine bases on the strand of DNA that it transcribed.

Answers

Answer:

The number of uracil bases in the mRNA is the same as the number of thymine bases on the strand of DNA that it transcribed.

Explanation:

Give me brainliest if that helped :)

15. List the 4 major nutrient cycles

Answers

It’s A

Hope fully this helps!!
Four major nutrient cycles: water cycle or hydrologic cycle. Carbon cycle. Nitrogen cycle. Oxygen cycle

You want to prepare a 1:50 dilution of your protein extract in a total volume of 1000 uL. You will need ___ uL of protein extract and ___ uL of water.

Choices
A) 5; 495
B) 20;980
C) 100;900
D) 10;990
E) 50;950

Answers

Answer:

The answer is c

Explanation:

What is the flexibility of spider silk determined by the structure of its molecules

Answers

The flexibility of spider silk determined by the structure of its molecules is quite strong.

The components that make up spider silk are what give it its flexibility. Proteins called fibroins, which are made up of amino acids organised in a certain sequence, make up spider silk. The arrangement of amino acids in fibroin proteins results in a helical structure, which is held together by hydrogen bonds between the amino acids.

The fibroin protein chain's exact arrangement of amino acids and hydrogen bonds produces a special blend of strength and flexibility. The silk is flexible enough to stretch and absorb energy without breaking and robust enough to resist significant stress. Spider silk is a fantastic material for many uses, including clothes, medical equipment, and even bulletproof vests, thanks to its unique mix of qualities.

Read more about spider silk on:

https://brainly.com/question/31059418

#SPJ1

N O 2) Select the best answer. What are three important minerals found in soil? O nitrogen, phosphorous, potassium O carbon, oxygen, calcium aluminum, lithium, magnesium copper, gold, silver​

Answers

Answer:

Nitrogen, phosphorus, and potassium

Explanation:

Answer:

phosphorus, nitrogen and potassium

Explain the steps of Beta oxidation of palmitic acid.​

Answers

Here are the steps

Dehydrogenation which removes two hydrogens between carbons 2 and 3.In this process acyl-CoA dehydrogenase is used as catalyst which makes it happen faster.Hydration which adds water across the double bond.In this process enoyl-CoA is used as catalyst. Dehydrogenation , which generates NADH.In this step 3-hydroxyacyl-CoA dehydrogenase is used as catalyst.Thiolytic cleavage happens in end in which cleaves the terminal acetyl-CoA group and forms a new acyl-CoA which is two carbons shorter than the previous one.In this process beta-ketothiolase is used as catalyst

Let’s review the normal baroreceptor reflex. Drag the labels onto the figure to create a flow chart of how the baroreceptor reflex would respond to decreased mean arterial pressure. View Available Hint(s)

Answers

Mechanoreceptors known as baroreceptors enable the autonomic nervous system to communicate information generated from blood pressure.

Thus,  Baroreceptors come in two varieties: low-pressure volume receptors and high-pressure arterial baroreceptors, both of which are triggered by stretching of the vessel wall.

Carotid sinuses and the aortic arch both include arterial baroreceptors. The atria, ventricles, and pulmonary vasculature all include low-pressure volume receptors (also known as cardiopulmonary receptors).

When you experience something that raises or lowers your blood pressure, the baroreceptor reflex keeps it constant. Your blood pressure is swiftly returned to normal range after a complicated sequence of procedures.

Thus, Mechanoreceptors known as baroreceptors enable the autonomic nervous system to communicate information generated from blood pressure.

Learn more about Baroreceptors, refer to the link:

https://brainly.com/question/29618046

#SPJ1

Features of veins: 1 Wide lumen 2) Thin wall 3 tissue in the walls to control blood flow

Features of veins: 1 Wide lumen 2) Thin wall 3 tissue in the walls to control blood flow

Answers

Veins are the ones that transport blood from the body into the heart and are characterized because transport blood poor in oxygen and transport carbon dioxide as well as other cellular debris, they are composed of three layers and a thin layer of smooth muscle. So the sentences are as follows

1)Wide lumen (there is no blank space)

2) Thin inner wall (in general all the wall is thin but is divided into three parts being the inner, tunic intima the thinnest)

3) smooth muscle tissue in the walls (the inner layer is composed of endothelial cells, middle smooth muscle, and outer connective tissue)

4) Valves to control blood flow ​

Which statement is true about cellular respiration?
a. It produces glucose, which provides energy for the cell.
b. It produces carbon dioxide, which combines with hydrogen to form sugar
c. It produces ATP, which stores energy that is used by the cell.
d. It produces oxygen, which combines with hydrogen to prevent cell poisoning.

Answers

Answer:

I think b.

Explanation:

Cellular respiration uses glucose and oxygen to form co2.

It produces glucose, which provides energy for the cell.

Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.

What is cellular respiration?It is the process by which organisms combine oxygen with foodstuff molecules, diverting the chemical energy in these substances into life-sustaining activities and discarding, as waste products, carbon dioxide and water.There are four stages:-  glycolysis, the link reaction, the Krebs cycle and oxidative phosphorylation.

To know more about cellular respiration here

https://brainly.com/question/13721588

#SPJ2

hellppppp please will give brainliest ​

hellppppp please will give brainliest

Answers

Answer.) A


A is the only answer that made sense but pls give brainliest if I’m right! And tell me if I’m wrong

Desert

Explanation:

Did so research about plants with spines

Design and organise learning experiences according to your local circumstances when teaching Processing (including traditional processing of raw materials; metal processing; food processing)​

Answers

When teaching Processing, it is essential to design and organize learning experiences that align with local circumstances and provide practical applications.

Here is a suggested approach for teaching Processing, including traditional processing of raw materials, metal processing, and food processing, considering local circumstances:

1. Introduction and Contextualization:

Start by introducing the concept of processing and its importance in various industries. Provide examples of local raw materials, metals, and food products that undergo processing. Discuss the significance of processing in the local economy and its impact on society.

2. Field Trips and Industry Visits:

Arrange field trips to local processing facilities such as factories, mills, or food processing plants. These visits offer students firsthand exposure to different processing techniques and machinery. Encourage students to observe and interact with professionals in the field, asking questions and understanding the practical aspects of processing.

3. Hands-on Workshops:

Organize hands-on workshops where students can engage in practical activities related to processing. For example, set up a metalworking workshop where students can learn basic metal processing techniques like cutting, shaping, and welding. Provide guidance on safety measures and proper tool usage.

4. Local Case Studies:

Explore local case studies of successful processing businesses or initiatives. This could involve inviting guest speakers from local processing companies or inviting entrepreneurs who have started their own processing ventures. Students can learn about the challenges, opportunities, and sustainable practices in the local processing industry.

5. Project-Based Learning:

Assign project-based tasks that allow students to apply their knowledge of processing. For example, students could design and develop a prototype for a food processing machine or propose innovative methods to improve traditional processing techniques using local resources. Encourage creativity, critical thinking, and problem-solving skills throughout the project.

6. Community Engagement:

Encourage students to engage with the local community by organizing outreach programs related to processing. This could involve organizing workshops for local artisans or collaborating with local farmers to develop value-added food products. Such activities foster a sense of social responsibility and provide students with real-world experiences.

7. Assessment and Reflection:

Regularly assess student understanding through quizzes, assignments, and presentations. Encourage reflective practices where students can evaluate their own learning journey and identify areas for improvement. Incorporate feedback mechanisms to continuously enhance the learning experiences.

By designing learning experiences that incorporate field trips, hands-on workshops, local case studies, project-based learning, community engagement, and reflective practices, students will develop a holistic understanding of processing and its significance in their local context. This approach will equip them with practical skills, foster creativity, and promote an entrepreneurial mindset, preparing them for future opportunities in the processing industry.

For more questions on Workshops, click on:

https://brainly.com/question/27603871

#SPJ8

6. All of the following are ways that carbohydrates help plants to survive, except?
a. Provides cellular protection
b. Supports cellular structure
c. Provides cellular insulation
d. Supports cellular growth

Answers

Answer:

D

Explanation:

Carbohydrates are good for energy and for strength and structure in plants, meaning A and B are correct. Insulation is also provided so D is the only one that does not work.

Which governmental level usually administers permitting and regulation of land use?

Answers

Answer: Local Governments

Explanation:

Generally, local governments have a large degree of autonomy to control land use within their jurisdictions. States typically grant them the authority to pass ordinances and regulations as long as they do not conflict with other laws. Furthermore, all states give municipalities the power to enact zoning regulations. In 15 states, state legislation also requires municipalities to adopt a Comprehensive Plan. Similarly, in 8 states local governments are required to adopt Local Zoning Ordinances.

Anyone know the answer ?! Please help !! This is 8th grade science. If it’s to blury zoom in!!

Anyone know the answer ?! Please help !! This is 8th grade science. If its to blury zoom in!!

Answers

Answer:

The answer would be A

Explanation:

I took the test last year

elect the correct answer.
You're going to a restaurant for dinner. How can you select healthier foods without giving up on taste?
select a meal with thick sauces
select a grilled or steamed meal
select a fried meal

Answers

Answer:

Select a grilled or steamed meal.

Explanation:

Grilling over heat releases fat from meat. Grilled meats are lower in calories than others. Although grilled meats can cause cancer so..

Which of the following is not an example of defensive communication?

Answers

The statement that is not an example of defensive communication is “I would love to talk about this with you if you have the time.” That is option C.

What is a defensive communication?

A defensive communication is defined as the type of communication that has the ability to stimulate anxiety and threat in an individual by another person.

Typical examples of defensive communication include the following:

“Why can’t you think about someone else for a change?”"You never listen to me.”"You always do this.”

These statements above are able to trigger anxiety and threat to the person it's been referred to.

Therefore, the statement that is not an example of defensive communication is “I would love to talk about this with you if you have the time.”

Learn more about communication here:

https://brainly.com/question/26152499

#SPJ1

Complete question:

Which of the following is not an example of defensive communication?

Which of the following is not an example of defensive communication?

a.“Why can’t you think about someone else for a change?”

b.“You never listen to me.”

c.“I would love to talk about this with you if you have the time.”

d.“You always do this.”

Muscle fibers contain which of the following?
A.
Sarcolemma
B.
Sarcoplasm
C.
Multi-nuclei
D.
All of the above

Answers

Answer: D

Explanation: Muscles are made of sarcolemma (membrane), sarcoplasm(tissue), and they have multi nuclei inside of them.

Other Questions
What national organization recommends safety checklists for a variety of health care settings? Solve each equation.3(a+4)+2(a-1)=a . Find a regular expression for L = {vwv : v, w {a, b}*, |v| 4}The answer is not (a + b)*. Exchange rate systems vary in the degree to which a country's central bank control its currency's exchange rate. Many countries allow their currency to float, yet periodically engage in interventions to control the exchange rate. Explain why and how a central bank intervene to control the currency exchange rate. Be sure to explain the impact of such intervention on the economy including interest rates, inflation, and balance oftrade. ming-na, a marketing data analyst with robust brews coffee, was tasked with determining if customers liked the new blond roast blend. according to robust brews' sales data, over 4,000 customers purchased the new coffee last month. if ming-na surveys 25 of those customers to determine if they like the coffee or not, she will most likely suffer from confirmation bias.true or false Read the sentences.The wind whipped the branches into a frenzy. It looked like the tree was doing a crazy dance.Which revision correctly uses a subordinating conjunction to combine the sentences?The wind whipped the branches into a frenzy, so that, it looked like the tree was doing a crazy dance.The wind whipped the branches into a frenzy until it looked like the tree was doing a crazy dance.The wind whipped the branches into a frenzy, and it looked like the tree was doing a crazy dance.The wind whipped the branches into a frenzy; consequently, it looked like the tree was doing a crazy dance. the main achievement of the hortensian law in roman constitutional history was its A certain string processing language allows the programmer to break a string into two pieces. It costs n units of time to break a string of n characters into two pieces, since this involves copying the old string. A programmer wants to break a string into many pieces, and the order in which the breaks are made can affect the total amount of time used. For example, suppose we wish to break a 20-character string after characters 3, 8, and 10. If the breaks are made in left-right order, then the first break costs 20 units of time, the second break costs 17 units of time, and the third break costs 12 units of time, for a total of 49 steps. If the breaks are made in right-left order, the first break costs 20 units of time, the second break costs 10 units of time, and the third break costs 8 units of time, for a total of only 38 steps. Give a dynamic programming algorithm that takes a list of character positions after which to break and determines the cheapest break cost in O(n3) time. What values complete each square?x+3 x If an auditor does not assess a client's risks of material misstatement, they:Can support their audit opinion by performing the substantive procedures in their standardized third-party audit program.Can support their audit opinion by performing the same procedures they performed previously for a similar client.Can support their audit opinion by altering the nature, timing, and extent of their substantive proceduresCannot support their audit opinion. Desert pavement is the result of ________. Group of answer choices abrasion by windblown sand erosion by running water intense chemical weathering deflation which of the following describes the function and location of golgi tendon organs? which of the following describes the function and location of golgi tendon organs? monitor muscle length, situated in series with muscle fibers monitor muscle length, situated in parallel with muscle monitor muscle tension, situated in parallel with muscle fibers monitor muscle tension, situated in series with muscle fibers chapter 2 the basic idea of perceived organizational support is that people are willing to work hard and commit to their organizations when they believe that the organization truly cares about their best interests.a. true b. false 3AWhat is the area! Round to thenearest tenth, use x.HINT: 2.0410862-10-8-6-22- 2 4 6 8 10-8-10 A 20 kg bowling ball is hanging from a 5 meter long string, and it is pulled back at a 15 degree angle to make a pendulum. Find the following:a) What will be the period of this pendulum?b) What would be the frequency?c) What force would it be swinging with?d) What would be it's maximum acceleration?HELP PLEASE in a copper wire, electrons move to the right, the direction of the magnetic field is toward you. in which direction is the magnetic force on the copper wire? a. up b. down c. away from you d. to the left please explain why ?Which statementWhich statement describes them essential part of the rule of law A float wooden block has a Volume 70.6m and displaces 0.8m of water. Determine the density of the block? frames, inc. picture frames each require $19 of direct materials and $40 of direct labor. variable manufacturing overhead cost is $9 per frame and variable selling and administrative expense is $13 per frame sold. total fixed manufacturing overhead cost per month is $15,000 and the company produces 5,000 frames each month. the unit product cost of each frame using variable costing is $ . (enter your answer as a whole number without decimal places.) Compute the modulus of the complex number. (-4+71) (1 + li) Round your answer to two decimal places, i.e. 4.33