what is a normal resting heart rate for adults over the age 18?

Answers

Answer 1

The normal resting heart rate for adults over the age of 18 ranges between 60-100 beats per minute (BPM).

What is heart rate?

Heart rate refers to the number of times the heart beats per minute (BPM).

What is considered a normal heart rate for an adult?

A normal resting heart rate for an adult is between 60 and 100 BPM. However, the range of normal heart rates can vary among individuals. The healthy range for resting heart rates can vary depending on factors such as age, sex, physical fitness, and overall health. Athletes who engage in endurance sports like running may have lower resting heart rates because of the strength and efficiency of their hearts.

In conclusion, a healthy resting heart rate for adults over the age of 18 is generally between 60-100 BPM.

To know more about BPM, visit:

https://brainly.com/question/28098999

#SPJ11


Related Questions

Housing rats in a complex social environment with much stimulation leads to some changes in brain structure, including __________:
a) increased cortical mass.
b) all of the given answers
c) increased dendritic branching of cortical neurons.
d) prolonged neural health, well into senescence.

Answers

Housing rats in a complex social environment with much stimulation leads to some changes in brain structure, including b) all of the given answers.

Housing rats in a complex social environment with much stimulation can result in various changes in brain structure. These changes include increased cortical mass, increased dendritic branching of cortical neurons, and prolonged neural health, well into senescence. The complex social environment provides opportunities for social interactions, cognitive stimulation, and physical activity, which can lead to enhanced brain development and plasticity. Increased cortical mass suggests structural adaptations in the brain, potentially indicating improved cognitive abilities. The increased dendritic branching of cortical neurons signifies increased synaptic connections and neural complexity, which can enhance information processing and learning. Prolonged neural health into senescence suggests that the enriched environment may have a protective effect against age-related cognitive decline. Overall, a complex social environment with stimulation has a positive impact on brain structure in rats.

learn more about brain structure here:

https://brainly.com/question/5361122

#SPJ11

2) The diagram below represents a change in guard cells that open and close pores in a plant. Guard cell Open pore Closed pore This change directly helps to A) regulate water loss B absorb minerals C) increase heterotrophic nutrition D) reduce seed production​

2) The diagram below represents a change in guard cells that open and close pores in a plant. Guard cell

Answers

Answer:

A) regulate water loss

Explanation:

Guard cells refer to the cells enclosing each stomata. They assist in monitoring the rate of transpiration by closing and opening the stomata. The guard cells possess the tendency to monitor the closing and opening of stomata by changing shape. The shape of the guard cells modifies on the basis of the concentration of potassium ions and water found in the cells themselves.  

The stomatal pores get closed when carbon dioxide is no longer needed for the process of photosynthesis. The guard cells swell when movement of water takes place inside these pores, and thus, the opening of stomatal pores occurs, and as water moves out, the guard cell closes. Thus, guard cells play an essential role in regulating water loss.  

The country of Zombie Land's consumer spending was $200 for
2020. Its investment spending was $6000 and its government
spending was $1000. Its exports were $200, while its imports were
$750. What was Zombie Land's Nominal GDP for 2020?
O $7,200
O $6,650
O $8,150
O $7,750

Answers

According to the question zombie Land's Nominal GDP for 2020 is $7,750.

What is GDP?

Gross Domestic Product (GDP) measures the total value of goods and services produced in a country over a specific period of time. It is the most widely used indicator of a country’s economic health and performance. GDP is often used as a benchmark to compare economic performance between countries. It is also used to compare economic performance over time. In general, a higher GDP indicates a stronger economy. GDP is calculated by adding up the value of all goods and services produced in a year across all sectors of the economy. This includes goods and services produced by businesses, government, and households. Additionally, it includes investments from abroad that are used to produce goods and services.

Zombie Land's Nominal GDP for 2020 can be calculated by adding the four components of aggregate demand (consumer spending, investment spending, government spending, and net exports) together. This gives us ($200 + $6,000 + $1,000 + ($200 - $750)) = $7,750.

To learn more about GDP

https://brainly.com/question/1658172

#SPJ1

Which kind of trees are tropical forests likely to have?

A. Coniferous
B. Saguaro
C. deciduous
D. Broadleaf

Answers

Tropical forests are likely to have broadleaf trees. These trees are also known as angiosperms and are characterized by their large, flat leaves. Broadleaf trees are very common in tropical forests due to the warm and humid climate, which provides ideal growing conditions for this type of tree. They are able to photosynthesize efficiently in the low light conditions of the forest floor, which allows them to thrive in the dense canopy of the forest. Coniferous trees are typically found in cooler climates and tend to have needle-like leaves. Saguaro cacti are found in deserts and not in tropical forests. Deciduous trees, which lose their leaves in the winter, may be found in some tropical forests, but broadleaf trees are generally the dominant type.

ANSWER Is D.broadleaf

What would happen if the axis of the earth were NOT
tilted with reference to the plane of its revolution as
shown in the second figure below?

A
There would be no
difference at all.

b,The sun would rise in the
west and set in the east.

C
In any place, the weather
will be more uniform
throughout the year.

d,At any time, the weather
will be almost the same
throughout

Answers

Answer:

c prolly if not  that then d

Explanation:

thats my best bet. all the answer choices are kinda sucky, no offense

If at any given time the Earth's axis was not tilted with respect to the plane of its rotation, the weather would be approximately the same throughout the world. So, the correct option is (D).

What is Rotation of Earth?

Earth's rotation or Earth's rotation is defined as the rotation of the planet Earth around its own axis as well as the change in the orientation of the rotation axis in space, where the Earth rotates eastward, in prograde motion. . As seen from Polaris, the North Pole Star, the Earth turns counterclockwise.

This is the movement of something through one complete circle which the daily rotation of the Earth upon its axis. The Earth's axis runs from the North Pole to the South Pole which takes the Earth 24 hours, or one day, to make one complete rotation around this invisible line.

If the earth's axis was not inclined to the plane of its orbit, there would be no seasons and humanity would have to suffer.

Thus, if at any given time the Earth's axis was not tilted with respect to the plane of its rotation, the weather would be approximately the same throughout the world. So, the correct option is (D).

Learn more about Earth's Rotation, here:

https://brainly.com/question/16455426

#SPJ2

State the 4 motor areas of the cortex

Answers

Answer: posterior parietal, dorsolateral pre- frontal, secondary motor, and primary motor cortex.

Answer:

The motor cortex comprises three different areas of the frontal lobe, immediately anterior to the central sulcus. These areas are the primary motor cortex (Brodmann's area 4), the premotor cortex, and the supplementary motor area (Figure 3.1).

Explanation:

Hope it helps!

A race car travels around a track. It went 20 meters east in 1 second. What was his velocity?

A. 0.05 m/s

B. 20 m/s east

C. 0.05 m/s east

D. 20 m/s

Answers

B. 20 m/s east

This is the answer.

Answer:

The answer is 20m/s east or B

atp is a compound that is synthesized (created) when? responses chemical bonds between carbon atoms are formed during photosynthesis. chemical bonds between carbon atoms are formed during photosynthesis. energy stored in nitrogen is released, forming amino acids. energy stored in nitrogen is released, forming amino acids. digestive enzymes break amino acids into smaller parts. digestive enzymes break amino acids into smaller parts. energy stored in chemical bonds is released during cellular respiration.

Answers

Adenosine Triphosphate (ATP) is a compound that is synthesized (created) during a process that begins with photosynthesis.

Photosynthesis is the process in which plants absorb the energy of the sun and use it to form chemical bonds between carbon atoms. This energy is stored in the form of nitrogen and is then released, forming amino acids.

Amino acids are the building blocks of proteins and are further broken down into smaller parts by digestive enzymes. This energy is then used to fuel the processes of the body, such as cellular respiration, movement, and growth. During cellular respiration, energy stored in the chemical bonds of the amino acids is released and converted into Adenosine Triphosphate (ATP).

ATP is a high-energy compound that is used to power all cellular processes. When cells need energy, ATP molecules are broken down, releasing energy that is used by the cells for the various tasks they perform. It is the main source of energy for the cells and is thus essential for all cellular functions.

Learn more about Adenosine Triphosphate (ATP) at : https://brainly.com/question/897553

#SPJ4

cells in the nervous system which have various functions related to support and nourishment are called:

Answers

brain or nervous system cells are called as neurons

Cells in the nervous system which have various functions related to support and nourishment are called glial cells.

What are the functions of glial cells?

Glia, also called glial cells (gliocytes) or neuroglia, are non-neuronal cells in the central nervous system (brain and spinal cord) and the peripheral nervous system that do not produce electrical impulses.

Functions include: clean up brain "debris"; transport nutrients to neurons; hold neurons in place; digest parts of dead neurons; regulate content of extracellular space; promote synaptic connections.

Any of the cells that hold nerve cells in place and help them work the way they should. The types of glial cells include oligodendrocytes, astrocytes, microglia, and ependymal cells.

Learn more about glial cells:

https://brainly.com/question/14921045

#SPJ2

3. What is the relationship of the sea and land breeze to the temperature of an area?
please ung matinong answer po need ko po kase​

Answers

Answer:

Sea breezes occur during hot, summer days because of the unequal heating rates of land and water. During the day, the land surface heats up faster than the water surface. Therefore, the air above the land is warmer than the air above the ocean.

Explanation:

HOPE IT HELPS (≧▽≦)

Out of the three below, which is considered most practical for use anywhere around the world? And why?Geothermal EnergyBiofuelBiomass

Answers

biofuel i sthe most practical for use around the world because it is easily available from biomass. Geothermal energy is location restricted and has many disadvantages such as posible volcanic eruptions, environment side effects and high cost.

The genetic composition of an organism is called the

Answers

Answer:

The genetic composition of an organism is called the genotype.

What is the function of the hydrogen bonds?

Answers

Hydrogen bonding is important in many chemical processes. Hydrogen bonding is responsible for water's unique solvent capabilities. Hydrogen bonds hold complementary strands of DNA together, and they are responsible for determining the three-dimensional structure of folded proteins including enzymes and antibodies.

Answer:

ambot

Explanation:

pag answer ug imo kay wla ko kabalo

Biology question! Please help if you can :)

Biology question! Please help if you can :)

Answers

Answer:

Budding

Explanation:

Answer:

Budding

Explanation:

Budding, in biology, is a type of asexual reproduction in which a new individual develops from a generative anatomical point of the parent organism. The initial protuberance, the bud, will eventually develop into an organism duplicating the parent.

Figure 1 represents a metabolic process involving the regulation of lactose metabolism by E. Coli bacteria. Lactose is utilized for energy by E. Coli when glucose is not present. Allolactose is an isomer of lactose that is in the environment of these bacteria when lactose is present. The CAP site prevents the binding of RNA polymerase when glucose is present in the environment. The lacZ, lacY, and lacA genes code for proteins needed for lactose metabolism

Answers

According to the scientific hypothesis of lactose degradation that is supported by the data in figure 1, allolactose functions as an inducer that binds to the operator and enables E. coli to metabolize lactose. Hence, the correct option is D.

What is lactose degradation?

The process of breaking down alpha lactose into its component sugars and generating energy is known as lactose degradation.

In response to the presence of lactose and glucose in the environment, the lac operon is controlled by a repressor protein and an activator protein (CAP), as shown in the image. Allolactose, which is created from lactose when it is present, attaches to the repressor protein and inhibits it from binding to the operator, allowing RNA polymerase to transcribe the genes responsible for lactose metabolism. Therefore, the correct option is D.

Learn more about lactose degradation,  here

https://brainly.com/question/30685689

#SPJ1

The question is incomplete, but most probably the complete question is,

Figure 1 represents a metabolic process involving the regulation of lactose metabolism by E. coli bacteria. Lactose is utilized for energy by E coll when glucose is not present. Allolactose is an isomer of lactose that is in the environment of these bacteria when lactose is present. The CAP site prevents the binding of RNA polymerase when glucose is present in the environment. The lacZ, lacY, and lac A genes code for proteins needed for lactose metabolism.

Which is the scientific claim that is consistent with the information provided in the figure 1.

a. The presence of excess lactose blocks the functioning of RNA polymerase in this operon.

b. When bound to the operator, the repressor protein prevents lactose metabolism in E. coli.

c. The binding of the repressor protein to the operator enables E. coli to metabolize lactose.

d. Allolactose acts as an inducer that binds to the operator, allowing E. coli to metabolize lactose.

Figure 1 represents a metabolic process involving the regulation of lactose metabolism by E. Coli bacteria.

Are Theca and pollen sac the same?

Answers

Answer:

Each theca contains two microsporangia, also known as pollen sacs

Explanation:

Each theca contains two microsporangia, also known as pollen sacs. The microsporangia produce the microspores, which for seed plants are known as pollen grains. If the pollen sacs are not adjacent, or if they open separately, then no thecae are formed.

BRAINLINEST PLEASE
Are Theca and pollen sac the same?

"The {{c1::sympathetic nervous system}} is the ""fight or flight"" system and restricts bloodflow to the digestive and excretory systems"

Answers

The sympathetic nervous system is the "fight or flight" system and restricts blood flow to the digestive and excretory systems.

The sympathetic nervous system is a part of the autonomic nervous system, which controls involuntary bodily functions. When faced with a perceived threat, the sympathetic nervous system activates various responses to help the body cope with the situation. This includes releasing adrenaline and norepinephrine, hormones that increase heart rate and blood pressure.

As a result, more blood is directed towards the muscles, heart, and brain to enhance physical and mental performance during the fight or flight response. To achieve this, the sympathetic nervous system restricts blood flow to the digestive and excretory systems. This is because these systems are not essential for immediate survival and can be temporarily compromised to conserve energy and resources.

By constricting blood vessels in the digestive and excretory systems, the body focuses on responding to the threat at hand. Once the danger has passed, the parasympathetic nervous system, responsible for the "rest and digest" response, takes over to restore normal blood flow and resume the functioning of the digestive and excretory systems. In summary, the sympathetic nervous system's fight or flight response prioritizes survival by diverting resources away from non-essential systems, such as digestion and excretion, to more critical functions that help the body overcome the perceived threat.

Learn more about sympathetic nervous system here: https://brainly.com/question/17602350

#SPJ11

The newly defined protist group SAR consists of __________. View Available Hint(s)for Part A multicellular autotrophic algae unicellular and multicellular autotrophic algae and unicellular heterotrophs and mixotrophs unicellular heterotrophs and mixotrophs unicellular autotrophic algae

Answers

The newly defined protist group SAR consists of unicellular and multicellular autotrophic algae, unicellular heterotrophs, and mixotrophs.

The newly defined protist group SAR, which stands for Stramenopiles, Alveolates, and Rhizarians, consists of unicellular and multicellular autotrophic algae, unicellular heterotrophs and mixotrophs. This group is characterized by the presence of unique organelles called tubular mitochondrial cristae, which are not found in other eukaryotes.

Stramenopiles, such as diatoms and brown algae, are characterized by having two flagella, one of which is covered with hair-like projections. Alveolates, such as dinoflagellates and ciliates, are characterized by the presence of small sacs called alveoli underneath their cell membrane. Rhizarians, such as foraminifera and radiolarians, are characterized by having pseudopodia, which are used for locomotion and feeding.

The SAR group is a diverse group of organisms that play important roles in aquatic ecosystems, including being major producers of oxygen and serving as food for larger organisms. Understanding the diversity and ecology of SAR protists is important for understanding the overall functioning of aquatic ecosystems.

To learn more about Protista visit: https://brainly.com/question/26924542

#SPJ11

bones go through both building and breakdown cycles. how will calcium levels be affected in the blood as a result of these cycles?

Answers

The calcium levels will be affected in the blood as a result of the breaking and building of bones as follows: Blood calcium levels increase when a bone breaks down, and decrease when a bone is built.

Bones can be described as the structures of the body that make up the skeletal system of an individual. Bones are living tissues and calcium is an important and major constituent in bones.

When a bone is broken, the calcium from the broken bone will be released into the blood and hence the blood calcium level will increase.

On the other hand, if a bone is built, calcium from the blood will be utilized in order to form the bone. Hence, there will be a reduction in the calcium levels in the blood during bone formation.

To learn more about bones, click here:

https://brainly.com/question/412179

#SPJ4

While running to class, Jennifer slipped and skinned her knee. The wound appeared superficial, and there is no bleeding. Based on your knowledge about the integument, you determine that the wound penetrated Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a not even the epidermis b all layers of the epidermis, dermis, and the subcutaneous layer с all layers of the epidermis and part of the dermis d layers of the epidermis but not the dermis

Answers

Answer:

D should be the right answer

Explanation:

Answer:

d. layers of the epidermis but not the dermis

Explanation:

From the given information we know that there is a wound but no blood. This means that the epidermis is surely damaged, because it is the top layer of the skin. Additionally, the epidermis is avascular, meaning it does not have any type of blood vessels. This information rules out letter a.

Underneath the epidermis is the dermis. However, this layer is vascular. This means it does have blood vessels, and if it becomes damaged, blood will come out. Hence, it cannot be letter c.

Then under the dermis is the subcutaneous layer. This layer is also vascular, which means it cannot be the answer either. Additionally, this layer could not be damaged if the dermis was not damaged. You would have to go through the epidermis and dermis first.

Pls help assignment do soon (30 points)
Some mutations, or changes in the sequence of DNA, do not have any effect on the characteristics of the organism. Why is this?

A. The protein built from this mutated sequence is deactivated by the cell.

B. The cell recognizes mutations and ignores them when expressing the gene.

C. The mutated sequence still codes for the same amino acid.

D. The immune system repairs the mutated sequence during development.

Answers

Answer:

C

Explanation:

This type of mutation is called a silent mutation. Despite a nucleotide in the codon being changed, the original codon and the mutated codon still code for the same amino acid. This results in no observable effect on the characteristics of the organism.

Why are scientific investigations so important?

Complete the interactive. Identify and describe each step of the scientific method.
Step one:
Step two:
Step three:
Step four:
Step five:
Step six:

Answers

Scientific investigations are important because they help us understand the natural world around us and develop new technologies and medicines.

What are step of the scientific methods?

The scientific method is a systematic approach to conducting scientific investigations that involves the following steps:

Step one: Make an observation This is where scientists observe something in the natural world that they want to investigate further.

Step two: Form a question Based on the observation, scientists form a question they want to answer through their investigation.

Step three: Form a hypothesis A hypothesis is a tentative explanation for the observation or question. Scientists use their knowledge and understanding of the topic to create a hypothesis that can be tested.

Step four: Conduct an experiment An experiment is designed to test the hypothesis. Scientists collect data through observation or by conducting experiments in a controlled environment.

Step five: Analyze data and draw conclusions Scientists analyze the data they have collected to see if it supports or refutes their hypothesis. Based on their analysis, they draw conclusions about their hypothesis.

Step six: Communicate results Scientists communicate their results to other scientists through scientific papers, conferences, or other means. This allows other scientists to evaluate their work and build upon it to expand our collective understanding of the natural world

Learn more about scientific investigations at:

https://brainly.com/question/8386821

#SPJ1

What are index fossils and how can they be used to help find the relative age of the rock layers?

Answers

Answer:

Certain fossils, called index fossils, help geologists match rock layers. To be useful as an index fossil, a fossil must be widely distributed and represent a type of organism that existed for a brief time period.

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write

Answers

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

what characteristic of rna makes it a likely candidate for the first genetic material in the history of life? group of answer choices it can catalyze its own replication it is more stable than dna all of these it is the most common type of genetic material in microorganisms

Answers

The characteristic of RNA that makes it a likely candidate for the first genetic material in the history of life is that it can catalyze its own replication.

This ability is due to the unique structural and functional properties of RNA. RNA can form complementary base pairs and fold into complex three-dimensional structures that can catalyze chemical reactions. This property, known as ribozyme activity, suggests that RNA was capable of both storing genetic information and catalyzing its own replication, potentially leading to the development of early life forms. Additionally, RNA is simpler than DNA and can be synthesized from simpler precursor molecules, making it a more plausible candidate for the first genetic material in the primordial world.

To know more about replication click here:

brainly.com/question/29794330

#SPJ4

Which material is the medium of ocean waves?
A. Sand
B. Water
O C. Air
O D. Rock
SUBMI

Which material is the medium of ocean waves?A. SandB. WaterO C. AirO D. RockSUBMI

Answers

Answer:

Water

Explanation:

A medium is the substance through which a wave can propagate. Water is the medium of ocean waves.

this classified as a living or non living thing.​

this classified as a living or non living thing.

Answers

Answer:

Explanation:

Um....I don’t think light is a living thing....So...i would say no living??

how does an entire population become adapted to its environment

a. traits that help individuals survive and reproduce become more common in the population over successive generations
b. each new variation becomes an adaptation as the organisms learn to use it
c. a population chooses which traits will help it survive
d. individuals develop changes during their lifetime and pass good changes to their offspring

Answers

The correct answer is a. Traits that help individuals survive and reproduce become more common in the population over successive generations. This process is known as natural selection.

why is it important that biotin be linked to a flexible arm of pyruvate carboxylase?

Answers

Biotin's attachment to a flexible arm in pyruvate carboxylase is important because it allows for efficient catalysis and proper enzyme function.

Biotin, a coenzyme, plays a vital role in pyruvate carboxylase's ability to catalyze the carboxylation of pyruvate to oxaloacetate.

The flexible arm, also known as a biotinylated domain, enables biotin to move between different active sites within the enzyme.

This flexibility is crucial for the enzyme's ability to perform its catalytic function, as it allows for proper positioning and interaction with the substrates involved in the reaction.



Summary: The linkage of biotin to a flexible arm in pyruvate carboxylase is essential for the enzyme's function and efficient catalysis, as it enables biotin to move between active sites and interact with substrates effectively.

Learn more about enzyme click here:

https://brainly.com/question/1596855

#SPJ11

PLEASE HELP!!!!!!

Most nerves of one of the sense organs go to the spinal cord before they go to the brain. Which organ is
this? (Think of your own body.)

Answers

Answer:

Umm every sense of organs travels in the spinal cord.

Most nerves of one of the sense organs go to the spinal cord before they go to the brain, and that organ is the one that is involved in the reflex action because it happens in a very short time and is controlled by the spinal cord before the brain..

What is the significance of the reflex action?

Reflex actions are important because they allow the body to respond quickly to stimuli without waiting for the brain, and they can be especially important in situations where a quick response is necessary to avoid danger, such as when the hand touches hot substances and the hand suddenly goes back, which is due to the motor neuron action of the spinal cord.

Hence, most nerves of one of the sense organs go to the spinal cord before they go to the brain, and that organ is the one that is involved in the reflex action because it happens in a very short time and is controlled by the spinal cord before the brain.

Learn more about the significance of the reflex action here.

https://brainly.com/question/14495937

#SPJ2

Other Questions
50 POINTS! Describe the structure of Afghanistan's government. (site 1) data redundancy leads to repetition of data hence extra space is required and anomalies are encountered. (True or False) WILL MARK AS BRAINLIEST IF CORRECT 1. True False Many presidents have studied law but Herbert Hoover was an engineer. 2. True False Hoover and his wife spent many years working at gold mines in South Africa. 3. True False Hoover, a Republican, worked in the administration of Democratic President Woodrow Wilson. 4. True False Hoover attended the Versailles Peace Conference at the end of World War I. 5. True False Hoover was Secretary of Standards for President Warren Harding. 6. True False Hoover was the vice presidential candidate with Calvin Coolidge. 7. True False Hoover was not re-elected president because of the Great Depression. 8. True False One of the causal factors in the Great Depression was World War I. 9. True False Hoover lost his bid at re-election to Theodore Roosevelt. 10. True False The American people blamed Hoover for not stopping the Great Depression How old was selena gomez in another cinderella story What type of function does the following represent and what is the correct equation? the length of time needed to complete a certain test is normally distributed with mean 44 minutes and standard deviation 8 minutes. find the probability that it will take less than 34 minutes to complete the test. a) 0.0528 b) 0.5000 c) 0.9472 d) 0.1056 e) 0.8944 f) none of the above Residents from five districts of a city were asked whether they were in favor of a city proposal to create new bike lanes in the roads. The following bar chart shows the relative frequency in each district of those who responded that they were in favor of the proposal. Which of the following statements is supported by the bar chart? One window washer can wash the windows in 15 hours, another can wash the windows in only 10 hours. to the nearest half-hour, how many hours would they need to do the job working together? Tasha needs to walk 7/10 miles to school. She has already walked 3/5 mile. How much farther does Tasha need to walk? Answer in simplified form, if needed. How does a federal system differ from a unitary system? The Council House Fight included chiefs from which Native American group?. 2 and 6 form the nickname for a woman who worked as a "computer" at NASA inthe 1950s2.6.5. an animal only found in Madagascar7. Complete this sentence: If I hadn't missed the bus, I would haveon time.9. Complete this sentence: I prefer teacoffee.10. another expression for "I wish"11. the superpower most explorers wished they had was to beDown1. another word for an aim3. an aim that is usually an amount or a number4. what you want to achieve (often in your career)8. If you create a sound, you "make a Explain how Hydro One implemented its Enterprise Risk Management (ERM) program. Analyze the method Hydro One used in identifying the key Risk Indicators (KRI). Explain how Hydro One setup its risk controls to mitigate the KRIs. Select SIX KRIs Hydro One faced. Three of the KRIs should be systematic and the other Three should be unsystematic risks. Explain how Hydro One mitigated these identified risks Why is the cosmic background radiation uneven in some places? What does the graph show?The S and P waves travel the same distance through Earths crust in the same amount of time.The P wave travels through Earths crust more quickly than the S wave travels.It takes the P wave 18 minutes to travel 6,000 km through Earths crust.It takes the S wave 11 minutes to travel 8,000 km through Earths crust. Nathan gauged the level of exposure to his marketing campaign using the percentage of the target population exposed at least once to his advertisement, representing itsReach Find the complete solution of each equation. Express your answer in degrees. sin+5sin =0 The poll tax was aimed at preventing African Americans from exercising their rights. Many could not afford to pay this fee required for voting.How do you think the 24th Amendment affected elections? The population of a large city increases by a rate of 3% a year. When the 2000 censuswas taken, the population was 1.2 million.a. Write a model for this population growth.b. What should the population be now? What is the projected population for 2030?