Amendment, in government and law, an addition or alteration made to a constitution, statute, or legislative bill or resolution. Amendments can be made to existing constitutions and statutes and are also commonly made to bills in the course of their passage through a legislature.
"Genetic power is far more potent than atomic power. And it will be in everyone's hands. It will be in kits for backyard gardeners. Experiments for schoolchildren. Cheap labs for terrorists and dictators. And that will force everyone to ask the same question—What should I do with my power?— which is the very question—science cannot answer."
Answer:
These facts are true and disturbing
Explanation:
Genetics is a discipline that has advanced incredibly in the last years. For example, by using the versatile CRISPR-Cas9 genome editing system, we are now able to insert literally any sequence into a given genome in vivo. The CRISPR-Cas9 is a technology that can be used in a regular molecular biology laboratory. It is expected this technique will enable in the near future to correct genetic disorders that have plagued mankind since times immemorial. However, genomic technologies like that could be used by malignant persons to hurt innocent people, thereby it is imperative that countries regulate their use.
Considering the samples given to the
student groups, what would be the BEST
physical property to use for identification?
A specific heat
B
mass
C hardness
D density
Hardness is the best physical property to use for identification in the samples given to the student groups. The correct option to this question is C.
One of the most helpful characteristics for classifying minerals is their resistance to scratching, or hardness. The ability of one mineral to scrape another mineral determines how hard something is. A hardness scale was created by German mineralogist Federick Mohs utilizing a group of ten reference minerals. The scale puts the minerals in ascending order of hardness. Each harder (higher-numbered) material will scuff any harder (lower-numbered) mineral (softer).A set of useful tools can be put together to provide a crude measurement of mineral hardness. The hardness of a fingernail is between 2 and 2.5, that of a penny is between 3 and 5, that of window glass is between 5.5 and around 6, and that of a knife blade is often between 2 and 3.For more information on physical property kindly visit to
https://brainly.com/question/18327661
#SPJ1
Can someone write this in different words please?
I believe that this experiment was helpful in helping me understand the concept of
DNA and DNA fingerprinting. The lab made it very simple to understand the concept of DNA fingerprinting and how it is used. It gave a helpful simulation of how DNA finger printing is used in crime scenes and how different everyone's DNA is. Overall, this lab did help me understand the concept of DNA fingerprinting more
Which agent is most likely the cause of chemical weathering to the tombstones in the cemetery? a)acid precipitation b)oxidation c)gravity
Which of the following correctly describes a graded potential?
Answer:
Graded potentials are changes in membrane potential that vary in size, as opposed to being all-or-none.
Explanation:
btw, where are the options?
The statement which correctly describes a graded potential is: amplitude of various sizes.
Graded potential refers to a temporary change in electric or membrane potential of a stimulus with respect to both its size and distance.
Amplitude can be defined as the maximum displacement of a wave when measured from its equilibrium position.
Thus, amplitude is measured vertically from an equilibrium position.Generally, a graded potential is directly proportional in amplitude to the size of the stimulus that is send as an input due to the following:
DepolarizationHyperpolarizationIn conclusion, the statement which correctly describes a graded potential is amplitude of various sizes.
Read more on graded potential here: https://brainly.com/question/25377211
Help ASAP
Which statement applies Newton's laws of motion and gravity to explain why the Moon stays in orbit around Earth?
A.
Revolution and rotation keep the Moon in orbit.
B.
Gravity and rotation keep the Moon in orbit.
C
Rotation and inertia keep the Moon in orbit.
D.
Gravity and inertia keep the Moon in orbit.
Answer:
D
Explanation:
The Moon stays in orbit around the Earth because the Earth's gravity keeps the Moon orbiting us. The gravity makes the Moon accelerate all the time, even it's speed remains constant.
Data that is observable and non numerical
Answer:
Observable and non-numerical data is typically referred to as qualitative data. This type of data can be descriptive or categorical and is often collected through interviews, surveys, or observations. Examples of qualitative data include the color of a flower, the texture of a fabric, or the opinions expressed by individuals in a focus group.
Explanation:
distribution of chlorophyll, stomata, mesophyll cells and vascular bundles support photosynthesis
Yes, the distribution of chlorophyll, stomata, mesophyll cells, and vascular bundles supports photosynthesis.
Let us discuss each separately.
Chlorophyll: It absorbs light energy from the sun, which is essential for photosynthesis. The distribution of chlorophyll within the mesophyll cells ensures that it is positioned optimally to capture sunlight.Mesophyll cells: Mesophyll cells are the main site of photosynthesis in plant leaves. It contains chloroplasts and provides a spongy texture to the leafy surface.Stomata: Stomata are small openings on the surface of leaves that regulate gas exchange, including the uptake of carbon dioxide (CO2) required for photosynthesis and the release of oxygen (O2) produced during photosynthesis. Vascular bundles: Specialized tissues composed of xylem and phloem, responsible for transporting water, minerals, sugars, and other substrates throughout the plant body.To know more, refer to;
https://brainly.com/question/29764662
What does the moon not have on its own?
O rotational period
O gravity
O revolution period
Olight
How can a longer seed be an advantage to the Red Mangrove?
Explanation
Once the propagule drops from the parent tree there is an obligate dispersal period which each species’ propagule must remain in the water. During this period embryonic development continues. For the red mangrove this dispersal period is the longest at 40 days. The black mangrove’s propagule must drift for at least 14 days. The white mangrove’s dispersal period is the shortest at 5 days, which also includes germination.
What is stabilizing selection?
A stabilizing selection is a type of natural selection in which the selective forces/pressures such as a favor for dark-skinned against strong sunlight compared to light-skinned individuals resulted in the decrease of population's genetic variance stabilizing on a median non-extreme phenotype/trait and when average phenotypes/traits are in favor against extreme variations.
PLEASE I NEED THIS
Part 1
With your graph, explain what could be done to reduce the number of deaths by infectious diseases worldwide.
Submit your bar graph that you made of the seven deadliest infectious diseases
Part 2
A scientist conducts a test and finds out that the LD50 of a certain chemical is 20 mg per kilogram. Explain what this means.
Part 3
Describe three methods for controlling malaria in developing countries. Explain why malaria is still a problem even when we know of ways to control it.
Assignment Guidelines:
Respond to each part with a complete paragraph.
State a clear topic sentence.
Support each topic sentence with clear support.
Submission Requirements:
A bar graph
Responses to each part
When submitting written assignments please remember to:
Submit the assignment question(s) and your responses.
Proofread for spelling, grammar, and punctuation.
Remember to use complete sentence structure.
Include at least six sentences in each paragraph.
part 1 : hi! just try to do it with yourself
Which statement best illustrates how an organism maintains homeostasis?
Desert pack rats are active at night to conserve water.
Young hawks have different kinds of feathers than adult hawks.
Parents pass their traits to their offspring.
Female barn swallows mate with long-tailed males.
Answer:
first one
Explanation:
makes most sense,taking testrn
consider pea plants with the genotypes ggtt and ggtt. how many types of gametes can be produced by each of these two plants?
The pea plants with the genotypes ggtt and ggtt can be produced only one type of gamete, i.e., gametes with the genotype gt.
What are gamete combinations?The expression gamete combinations is used in genetics to denote the segregation of different alleles in the germinal cells during meiosis in order to increase genetic variation after this process during fecundation, which in this case cannot segregate because there are two genes with the same alleles.
Therefore, with this data, we can see that gamete combinations depend on the presence of different alleles in parents.
Learn more about gamete combinations here:
https://brainly.com/question/27048113
#SPJ1
NEED HELP ON QUESTION ASAP! !
If answer is correct I'll rate you five stars a thanks and maybe even brainliest!
Please can you explain what this paragraph is trying to say. Also what does it mean in the sentence 'the difference in charge across the battery provides push for current' and what is the difference in charge.
Here's paragraph I need to have a simple definition of:
A high waterfall is also like a large voltage. It will transfer a lot of energy to the water (charge), making the river flow very fast (a large current) the difference in height makes the river flow. In a circuit , the difference in charge across battery provides push for the current.
Answer:
This paragraph is drawing an analogy between a high waterfall and an electric circuit to explain the concept of voltage and current.
It is saying that a high waterfall has a lot of potential energy that can transfer to the water and cause it to flow very fast, which is similar to how a large voltage in an electric circuit can create a large current. The difference in height of the waterfall causes the water to flow, just as the difference in charge across a battery provides the push or force for the current to flow in a circuit.
In an electric circuit, voltage is the measure of the electric potential difference between two points, and it is measured in volts. Current is the flow of electric charge through the circuit, and it is measured in amperes or amps. The difference in charge across the battery refers to the potential difference or voltage between the positive and negative terminals of the battery, which creates an electric field and provides the force or push for the current to flow through the circuit.
Brainlist Please
This paragraph is using an analogy between a high waterfall and a large voltage to explain the concept of voltage and current in a circuit.
The paragraph starts by comparing a high waterfall to a large voltage. Just as a high waterfall transfers a significant amount of energy to the water, a large voltage in a circuit transfers a significant amount of energy to the flow of electric charge.
The energy transfer in the waterfall causes the river to flow very fast, which is likened to a large current in a circuit.
The "difference in height" in the waterfall analogy refers to the variation in elevation between different points in the waterfall. This difference in height creates a force that propels the water downstream, causing the river to flow. Similarly, in a circuit, the "difference in charge" refers to the disparity in electric charge between two points in the circuit.
This difference in charge, also known as voltage, provides the "push" or driving force for the flow of electric current. It is this voltage difference across the battery that causes the electric current to move through the circuit.
In summary, the paragraph illustrates that just as a high waterfall with a significant difference in height creates a fast-flowing river, the difference in charge (voltage) across a battery in a circuit provides the driving force (push) for the flow of electric current.
For more such answers on analogy
https://brainly.com/question/30302605
#SPJ8
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.
template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’
Answer:
DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.
Explanation:
Fats, sugars, and proteins are important food molecules. Which statement about these types of molecules is true?
The statement "There are all macronutrients" is true about these types of molecules
What are macronutrients?Macronutrients, essential components required by the body in substantial quantities, furnish energy, foster tissue growth and mending, and govern physiological processes. The trio of primary macronutrients encompasses carbohydrates, protein, and fat.
The precise magnitude of macronutrient requisites relies on factors such as age, gender, physical exertion, and overall well-being of an individual.
Learn about macronutrients here https://brainly.com/question/28837185
#SPJ1
Complete question:
Fats, sugars, and proteins are important food molecules. Which statement about these types of molecules is true?
a. There are all macronutrients
b. Sugar makes one fat
c. Sugar is the only thing that makes you fat
ssignm I. Write TRUE if the statement is correct and FALSE if it is incorrect for the 1. Viruses are considered to be intermediate between living and non-living things. 2. Pasteurization is a method of heating milk and other food stuffs which is followed by rapid cooling. 3. White blood cells (lymphocytes) produce special protein called antigen. 4. Species are a group of organism that can breed successfully with one other to produce fertile offspring. 5. Tuberculosis caused by bacterium called salmonella typical. 6. In the scientific naming of organism, the 1st name is genus name. 7. Gymnosperm plants are lower plants that have well developed root, stem and Space for Tutorial Comment Marks leaves. 8. Sunlight is the primary source of energy for all plants. 9. Autotrophs are organisms that can synthesize their own energy from the raw material. 10. The major organic substances in living organisms are carbohydrate, lipid and protein. hest answer for the following questions. niem is fungus? arium
The following are:
TRUE. Viruses are not considered to be aliveTRUE. Pasteurization is a method of heating milk TRUE. White blood cells (lymphocytes) are a type of immune cell TRUE. A species is a group of organisms FALSE. Tuberculosis is caused by a bacterium TRUE. In the scientific naming of organismsFALSE. Gymnosperm plants are a group of plantsTRUE. Sunlight is the primary source of energy for all plantsTRUE. Autotrophs are organisms that can synthesizeTRUE. The major organic substances in living organisms What are the reasons?1. TRUE. Viruses are not considered to be alive because they do not have their own metabolism and they cannot reproduce on their own. However, they do have some of the characteristics of living things, such as the ability to evolve and to interact with their environment.
2. TRUE. Pasteurization is a method of heating milk and other food stuffs to a specific temperature for a set period of time, followed by rapid cooling. This kills harmful bacteria without affecting the taste or nutritional value of the food.
3. TRUE. White blood cells (lymphocytes) are a type of immune cell that produces antibodies. Antibodies are proteins that bind to specific antigens, which are molecules that are foreign to the body. This binding helps to protect the body from infection.
4. TRUE. A species is a group of organisms that can breed successfully with one other to produce fertile offspring. This means that the offspring will be able to reproduce themselves.
5. FALSE. Tuberculosis is caused by a bacterium called Mycobacterium tuberculosis. Salmonella typhi is a bacterium that causes typhoid fever.
6. TRUE. In the scientific naming of organisms, the first name is the genus name. The genus name is followed by the species name. For example, the scientific name for humans is Homo sapiens.
7. FALSE. Gymnosperm plants are a group of plants that have seeds that are not enclosed in an ovary. They are considered to be higher plants, along with angiosperms (flowering plants).
8. TRUE. Sunlight is the primary source of energy for all plants. Plants use sunlight to convert carbon dioxide and water into glucose, which is a sugar that they use for energy.
9. TRUE. Autotrophs are organisms that can synthesize their own energy from the raw materials. They are able to do this through a process called photosynthesis.
10. TRUE. The major organic substances in living organisms are carbohydrate, lipid, and protein. Carbohydrates are used for energy, lipids are used for storing energy, and proteins are used for building and repairing cells.
Find out more on Pasteurization here: https://brainly.com/question/11156209
#SPJ1
In humans, normal color perception (N) dominates the expression of color blindness (n), and both of these genes are carried on the X chromosome (XN or Xn). A woman with normal color vision has a color-blind father. Her husband is also color-blind.
a. What is the genotype of the colorblind man? ____
b. What is the genotype of the woman? ______
c. What is the probability of her daughter to be colorblind? __________%
d. What is the probability of her sons to be colorblind? _________%
CAN SOMEONE HELP MEEE eeee
What do foods with no carbohydrates have in common?
Answer:
They have more of the Macro nutrients Fat and Protein
Explanation:
Protein and Fat amd Carbs make the three macros
SPEED
Some factories have started using large tanks of bacteria to remove carbon dioxide from the atmosphere. As more factories start to do this, the amount of carbon dioxide in the atmosphere could decrease over time. If this happens, and if energy coming from the sun and the amount of carbon dioxide being put into the atmosphere otherwise stay the same, what would happen to the total amount of energy in the Earth system and to global average temperature? If there is a change, explain how that change would happen.
Answer:The answer is A
Explanation:I hope u get a A+
Which climate favors mechanical weathering?
O dry climate
O cold climate
O warm climate
O desert climate
Answer:
cold climate
Explanation:
Cold climates favor mechanical weathering. Chemical reactions occur faster at higher temperatures.
HOPE THIS HELP YOU!! :)))))
The ADP is turned into ATP by?
Answer:
ADP is converted to ATP for the storing of energy by the addition of a high-energy phosphate group. The conversion takes place in the substance between the cell membrane and the nucleus, known as the cytoplasm, or in special energy-producing structures called mitochondria.
Explanation:
Hope this helped Mark BRAINLEST!!
Question 10 ot 25
The practice of science can answer only scientific questions. And scientific
questions guide the design of investigations. What is usually true of the
possible answers to a scientific question?
OA. They can lead to additional questions about the phenomenon.
OB. They overturn an established scientific theory.
OC. They lead to the discovery of a new scientific law.
OD. They remove the need for further scientific inquiry.
Answer:
B. they can overturn. an established scientific theory
Answer:They can lead to additional questions about the phenomenon
Explanation:
what are biopolymers
Answer:
Biopolymers are natural polymers produced by the cells of living organisms. Biopolymers consist of monomeric units that are covalently bonded to form larger molecules
Biopolymers are natural polymers produced by the cells of living organisms. Biopolymers consist of monomeric units that are covalently bonded to form larger molecules. There are three main classes of biopolymers, classified according to the monomers used and the structure of the biopolymer formed: polynucleotides, polypeptides, and polysaccharides. Polynucleotides, such as RNA and DNA, are long polymers composed of 13 or more nucleotide monomers. Polypeptides and proteins, are polymers of amino acids and some major examples include collagen, actin, and fibrin. Polysaccharides are linear or branched polymeric carbohydrates and examples include starch, cellulose and alginate. Other examples of biopolymers include natural rubbers (polymers of isoprene), suberin and lignin (complex polyphenolic polymers), cutin and cutan (complex polymers of long-chain fatty acids) and melanin.
The complementary DNA sequence of AATTCG is:
Answer:
Complementary DNA sequence of AATTCG is: TTAAGC
In a DNA sequence A forms complementary double hydrogen bond with T & G forms triple hydrogen bond with C.
Both the nucleotide stands in DNA are antiparallel so they form complementary base pairs.
Which of these species might be classified as a pioneer species ? A.Choke cherry B.ponderosa pine C.Aspen D. Lichen
Answer:
aspen
Explanation:
Answer:
lichen
Explanation:
they are the first to grow on bear rock
Why is it hard to model the inheritance of more than one gene?
Answer:
because all of them are different?
Explanation:
4. What are the parent genotypes for pea seed color shown in this Punnett
Square?
Answer:
heterozygous and homozygous recessive
In which of the following ways do vaccines promote public health? Reduce the number of fatalities due to infection Prevent cancer development following infection with an oncogenic virus Contribute to herd immunity Prevent Type I diabetes (T1D)
Option C, Contribute to herd immunity the following ways do vaccines promote public health.
Vaccines, When a sufficient number of people are immunized against a disease and have produced protective health antibodies against upcoming infection, herd immunity can also be attained. Vaccines build immunity without resulting in disease or other negative side effects on health, in contrast to the natural health infection technique. The incidence and spread of the illness are reduced as the population becomes more immune. Indirect protection from illness is provided by immunizations for others.
The complete Question is:
In which of the following ways do vaccines promote public health?
A) Reduce the number of fatalities due to infection.
B) Prevent cancer development following infection with an oncogenic virus
C) Contribute to herd immunity
D) Prevent Type I diabetes (T1D)
learn more about vaccines here:
https://brainly.com/question/625596
#SPJ4